SEARCH

SEARCH BY CITATION

Keywords:

  • fungal;
  • plant;
  • oxidative;
  • stress

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References

The transcription factors ChAP1 and Skn7 of the maize pathogen Cochliobolus heterostrophus are orthologs of Yap1 and Skn7 in yeast, where they are predicted to work together in a complex. Previous work showed that in C. heterostrophus, as in yeast, ChAP1 accumulates in the nucleus in response to reactive oxygen species (ROS). The expression of genes whose products counteract oxidative stress depends on ChAP1, as shown by impaired ability of a Δchap1 mutant to induce these ‘antioxidant’ genes. In this study, we found that under oxidative stress, antioxidant gene expression is also partially impaired in the Δskn7 mutant but to a milder extent than in the Δchap1 mutant, whereas in the double mutant – Δchap1-Δskn7 – none of the tested genes was induced, with the exception of one catalase gene, CAT2. Both single mutants are capable of infecting the plant, showing similar virulence to the WT. The double mutant, however, showed clearly decreased virulence, pointing to additive contributions of ChAP1 and Skn7. Possible mechanisms are discussed, including additive regulation of gene expression by oxidative stress.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References

Histidine kinase-based phosphorelays are widespread in prokaryotes and are also found in lower eukaryotes and in plants (Wuichet et al., 2010). Some of these two-component signaling systems have important roles in stress responses. Histidine kinases respond to specific signals and are activated by autophosphorylation of a conserved histidine residue; after a cascade of phosphotransfers from His-to-Asp, the phosphoryl group is transferred to a conserved aspartate residue in the receiver domain of a response regulator. The details were worked out first for the osmotic stress response in Saccharomyces cerevisiae (Fassler & West, 2011). In budding yeast, three phosphotransfers follow activation of the membrane-localized histidine kinase Sln1: First, the conserved sensor domain histidine is phosphorylated in response to the stress signal; the phosphate is transferred to an aspartate residue, then to the phosphorelay protein Ypd1, and finally from Ypd1 to either of two downstream response regulators, Ssk1 or Skn7. The response regulators’ phosphorylation levels control their activity. Osmotic stress decreases Sln1 phosphorylation, decreasing the phosphorylation of the phosphorelay Ypd1 and consequently of Ssk1. Dephosphorylation of Ssk1 allows activation of Hog1. The other branch of the pathway downstream of Sln1 is mediated by Skn7, a highly conserved, stress-responsive transcription factor whose activity depends on osmotic, cell wall and oxidative stresses. The mechanism by which Skn7 responds to these stresses is different. In response to cell wall stress, Skn7 is phosphorylated, again via Ypd1, on the conserved aspartate residue, D427, while hyperosmotic stress has the opposite effect, dephosphorylating Skn7 (Fassler & West, 2011). The Skn7 response to oxidative stress is independent of the Sln1 pathway, however. In budding yeast, Skn7 cooperates with the redox-sensitive transcription factor Yap1. Phosphorylation on the D427 residue of Skn7 is not absolutely necessary for Yap1 recruitment; rather, phosphorylation on threonine 437 is required for stabilization of the Skn7-Yap1 complex (He et al., 2009; Fassler & West, 2011).

Fungal pathogens that attack plant leaves encounter plant defenses when they breach the initial barrier presented by the cuticle and epidermis. One defense mechanism used by plant cells is the release of reactive oxygen species (ROS), produced in part by a NOX (NADPH oxidase) complex whose catalytic subunit shares sequence homology with mammalian NOX enzymes. The plant's oxidative burst is thought to inhibit the progress of the invader. Furthermore, ROS provide a signal to promote programmed death of neighboring cells, a hallmark of the hypersensitive response (HR). The complete picture is more complex, because ROS also provide signals in addition to those for the HR (Torres & Dangl, 2005). Necrotrophic fungal pathogens that kill host tissue appear to thrive in an oxidant environment, as shown for the gray mold pathogen Botrytis cinerea (Govrin & Levine, 2000). They produce their own ROS in addition to those originating from the host (see Heller & Tudzynski, 2011). To establish infection, the pathogen must be able to cope with oxidative stress. Cochliobolus heterostrophus, a necrotrophic foliar pathogen of maize, counteracts oxidative stress by several pathways. The redox-sensitive transcription factor ChAP1 is responsible for induction of a set of genes with predicted functions in detoxifying ROS, for example glutathione reductase (GLR1) and thioredoxin (TRX2); loss-of-function mutants in ChAP1 are hypersensitive to oxidants (Lev et al., 2005). Loss of the stress-activated MAPK ChHog1, its upstream two-component system response regulator Ssk1, and the response regulator Skn7 also result in hypersensitivity to oxidants (Izumitsu et al., 2007; Igbaria et al., 2008; Oide et al., 2010). Although Δchap1 and Δskn7 mutants are sensitive to oxidants in culture, no difference in virulence to maize was reported (Lev et al., 2005; Oide et al., 2010). If the pathways mediated by these two transcription factors act in an additive, rather than sequential manner, a double mutant would be expected to show a more severe phenotype than either single mutant. Two independent stress response pathways would, in this way, act together to provide tolerance to oxidants. To address this question, we generated double mutants in which the coding sequences of both ChAP1 and Skn7 were replaced by selectable antibiotic resistance markers and tested their virulence and tolerance to stresses.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References

Fungal strains and growth media

Wild-type C4 (MAT1-2 Tox1+), Δchap1 and Δskn7 strains of C. heterostrophus were described previously (Turgeon et al., 1987; Lev et al., 2005; Oide et al., 2010). Standard growth medium was complete xylose medium (CMX, see Turgeon et al., 2010). The Δchap1-Δskn7 mutant was constructed starting with Δskn7. Linear DNA for double-crossover integration was amplified using the split-marker method (Catlett et al., 2003). A linear DNA construct was made, consisting of the neomycin selectable marker flanked on both sides with ChAP1 UTR`s, targeting the integration to the ChAP1 locus in the Δskn7 genome. Reactions with primer pairs 1 and 2 (Table 1) were carried out using C. heterostrophus genomic DNA as template. Reactions with pairs 3 and 4 were carried out using pATBS-NEO (M. Ronen, PhD thesis, Technion, 2011) plasmid DNA as template. Round-II used, to construct the 5′ side of the final sequence, the products of pairs 1, 3 as template and FP1, NLC37 as primers; for the second half, the products of pairs 2 and 4 as template and NLC38, RP2 as primers. The two final products were integrated into the Δskn7 genome by double-crossover recombination, resulting in reconstruction of the complete neomycin resistance cassette replacing the entire predicted coding region of ChAP1. Fungal protoplasts were prepared and transformants selected for neomycin and hygromycin resistances as described (Turgeon et al., 2010; Turgeon et al., 1987; Wirsel et al., 1996).

Table 1. Primers for split-marker gene replacement strategy
PairsPrimerSequence
  1. Lower case indicates sequences that are not complementary to the template in the first PCR step. In the second PCR step, these sequences, which are complementary to the ends of the selectable marker, allow joining of the fragments.

ChAP1 gene region
 Pair 1Ch1n-FP1GTAGACGACACAGGCGGCGG
 Ch1n-RP1tcctgtgtgaaattgttatccgctGGGGTGAATGTGGAAAGACG
 Pair 2Ch1n-FP2gtcgtgactgggaaaaccctggcgCTGTGCATTGGGTCGGACTG
 Ch1n-RP2CACAGACATTTCATCACCCGC
For selectable marker (neomycin)
 Pair 3M13RhygAGCGGATAACAATTTCACACAGGA
 TtrpCSTARTrTCCGGAGCTGACATCGACACC
 Pair 4M13FhygCGCCAGGGTTTTCCCAGTCACGAC
NeoFCTGTCATCTCACCTTGCTCCTG

Gene expression assays

To assay gene expression, cultures were grown in liquid CMX with shaking (200 r.p.m.) for 4 days at 22 °C, the mycelium centrifuged and transferred to fresh CMX with 20 mM final concentration of hydrogen peroxide and incubated at 22 °C for 30 min. RNA isolation was done as described in (Shanmugam et al., 2010). For cDNA synthesis, 2 μg of RNA was used for reverse transcription with random primers following the protocol supplied with the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Abundance of transcripts was measured by quantitative real-time PCR in a 7300 cycler (Applied Biosystems), with 15 μL reaction volumes, using Quanta Biosciences SYBR mix with two technical replicates for each PCR reaction. Data shown are means of three biological replicate experiments. The C. heterostrophus actin gene was used as ‘housekeeping’ gene to normalize the amount of cDNA. The primers used for real-time PCR are shown in Table 2. Calculation of CT values was done using Applied Biosystems software dataassist.

Table 2. List of primers used for Real-time PCR
GeneProtein IDAbrSequence
Actin31040ActF- TCAAGATCATCGCTCCTCCC
   R- GGACCGCTCTCGTCGTACTC
Catalase 1115312CAT1F- GTCACGCGTAATGAGCGTACA
   R- CAGGTCGGTACCGATATTATATTGCT
Catalase 2110605CAT2F- ACCGACGACTGGCTAAAGGTT
   R- ATGGTCGAATCGGTGGATCT
Catalase 3109994CAT3F- CAACCCTCGCAACTACTTTGC
   R- CGAGATGACCAGGTTGGAACA
Glutathione reductase 169967GLR1F- GATTCGGCGTAGCGATCAA
   R- AGACCGGATGGATTGCCA
Superoxide dismutase 124548SOD1F- CATCTGCTGGACCCCACTTC
   R- CCCTGGCCATCAGTCTTGAA
Thioredoxin 231517TRX2F- CGTCCACAACCTTACCACCAA
   R- CATGTCGCGAAGCAGTCAAG
Thioredoxin reductase 1100777TRR1F- CACGGACGAAGTCGAGAACTT
   R- TGTTCACGCATTTGTTCCATG
γ-glutamylcysteine synthetase 179161GSH1F- AGACCGGGAATGCCGACACA
   R- CAATTCCCCATGGCTTTCCT

Stress sensitivity assay

Solid CMX was amended with 20 mM hydrogen peroxide, 0.4 M potassium chloride, 0.75 M sorbitol, 30 μM menadione or 25 mM calcofluor white stain (CWS). Control was solid CMX without additives. All plates were incubated under 16 h light–8 h dark at 22 °C for 6 days, and colonies were photographed.

Chemicals

Sorbitol, calcofluor white stain, menadione, and MES hydrate were purchased from Sigma-Aldrich. Hydrogen peroxide was purchased from Carlo Erba. Potassium chloride was purchased from MERCK. Murashige and Skoog medium was purchased from Duchefa Biochemie.

Plant inoculation

Maize plants (Royalty, local hybrid, purchased from Ben Shachar, Tel Aviv) were grown in hydroponic culture for 12 days in a medium containing 2.15 g L−1 of Murashige & Skoog medium (0.5 MS), 0.25 mM MES, adjusted to pH 5.7 with KOH. Plants – with their roots – were attached to a tray and kept moist. The second leaf was inoculated with 7-μL droplets of 0.02% Tween 20 in ddW containing about 500 C. heterostrophus spores. Trays were closed in plastic bags to keep the plants moist. Lesions were measured after 2 days. Two independently isolated double-mutant transformants were tested, and the results were similar; data for one isolate are shown in Fig. 3.

Statistical analyses

Statistical analyses were performed with graphpad Prism software version 5.00 (GraphPad Software, San Diego, CA). Unless otherwise indicated, the threshold level chosen for comparison of means was P < 0.01 by Student's t-test (one-tailed, nonpaired, equal variance), corrected for multiple comparisons (Šidák, 1967).

Results and discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References

Resistance to stresses

To test the sensitivity of the double mutant to different stressors, WT, Δchap1, Δskn7, and Δchap1-Δskn7 (ΔΔ) were grown on solid CMX containing either 0.75 M sorbitol – hyperosmotic stress, 0.4 M KCl – hyperosmotic and salt (ionic) stress, 20 mM H2O2 – oxidative stress, 30 μM menadione – superoxide stress or 25 mM CWS – interference with cell wall integrity (Ram & Klis, 2006) (Fig. 1). Growth of Δchap1, Δskn7, and ΔΔ in the presence of 20 mM H2O2 was completely inhibited compared with WT which showed about 40% growth relative to control (solid CMX without additives). On 0.4 M KCl, growth of the ΔΔ mutant was also inhibited compared with WT, but not completely, and it showed similar growth rate to the Δskn7 mutant. On 0.75 M sorbitol, the double mutant showed almost complete inhibition, but again similar to the Δskn7 mutant; WT and Δchap1 were also inhibited, Δchap1 more than WT, but both less than Δskn7 and the double mutant. CWS affected the growth of Δchap1 (55%) and the double mutant (47%), whereas growth of the WT and Δskn7 was less inhibited (about 65%). On menadione, the double mutant was inhibited more than the WT and Δskn7 but as much as Δchap1 (Fig. 1a).

image

Figure 1. Response of the mutants to different stressors. (a) WT, Δchap1, Δskn7 and ΔΔ were grown on solid CMX with different conditions for 6 days, and colony diameters were measured. Average colony diameter relative to control (solid CMX without additives) (mean and SEM for three replicates) is shown. (b) WT and mutants were grown on liquid CMX with different hydrogen peroxide concentrations; fungal mats were dried and weighed after 5 days. Dots represent growth rate calculated from the average of six biological repeats, relative to the average of nine control repeats of each strain (grown on liquid CMX without H2O2).

Download figure to PowerPoint

The double mutant (ΔΔ) is sensitive to oxidative and osmotic stresses, as well as to stressors that compromise cell wall integrity, but to the same extent as each single mutant, and there is no evidence for an additive effect on inhibition of growth. The only additive effect on growth rate was found with the cell wall stressor CWS, where the double mutant was more sensitive than either single mutant (significant at P < 0.01). WT and the mutants were also grown on liquid CMX with lower concentrations of hydrogen peroxide (0.625–10 mM) to test whether the double mutant is more sensitive than each single mutant (Fig. 1b). WT grew normally on all concentrations; apparently at these oxidant levels, WT can overcome the stress by expression of antioxidant genes, as shown previously (Lev et al., 2005). All three mutants show lower growth percentages than WT, but similar to each other.

Antioxidant gene expression changes in response to hydrogen peroxide

We tested the expression of antioxidant genes shown previously (Lev et al., 2005) to be under regulation by the transcription factor ChAP1: glutathione reductase, GLR1; thioredoxin, TRX2; thioredoxin reductase, TRR1; γ-glutamylcysteine synthetase, GSH1. In addition, we followed the expression of a superoxide dismutase gene, SOD1, and three catalase-encoding genes CAT1,2,3 (Robbertse et al., 2003). We performed quantitative real-time PCR experiments on WT, both single mutants and the double mutant after exposure to 20 mM H2O2 for 30 min in shake culture (see 'Materials and methods'). The H2O2-induced transcript levels of most of the genes tested depended strongly on ChAP1, and several required Skn7 for full induction. The gene for glutathione reductase (GLR1) was only twofold induced in Δchap1 compared with 52-fold in WT and 16-fold and Δskn7. In the double mutant, the transcript level was similar to the basal level in the untreated control, indicating that either transcription factor is sufficient only for partial expression, while both transcription factors are required for full expression (Fig. 2). TRX2 showed the same pattern as GLR1, but the additive effect was not statistically significant. The TRR1 gene is under the regulation of ChAP1 alone. While superoxide dismutase (SOD1) expression is not strongly decreased by loss of either ChAP1 or Skn7 alone, the double mutant failed to upregulate the expression of SOD1. The catalase genes CAT1 and CAT3 seem ChAP1 dependent and Skn7 independent; however, this regulation is not significant at P < 0.01 by the multiple-comparison t-test used here. CAT2 is expressed in all three mutants. The expression of γ-glutamylcysteine synthetase (GSH1) was also tested, and only minor upregulation was observed in WT and Δskn7.

image

Figure 2. Antioxidant gene expression in WT vs. mutants. Expression of several known antioxidant genes was measured in WT vs. Δchap1, Δskn7 and Δchap1skn7 (ΔΔ) mutants in response to 30-min exposure to 20 mM hydrogen peroxide in shake culture by RT-qPCR. Transcript levels shown are the average of three biological repeats – fold induction relative to control (CMX with no H2O2) is shown (** and *** indicate significance at P < 0.01 and 0.001). CAT1 – catalase 1; CAT2 – catalase 2; CAT3 – catalase 3; GLR1 – glutathione reductase 1; SOD1 – superoxide dismutase 1; TRR1 – thioredoxin reductase 1; TRX2 – thioredoxin 2; GSH1 – γ-glutamylcysteine synthetase 1.

Download figure to PowerPoint

Plant infection assay

To test whether both ChAP1 and Skn7 contribute to virulence on the host, infection assays on maize were carried out. To inoculate undetached maize leaves, maize plants were grown in hydroponics (as described in the Materials and Methods section) for 12 days, the plants were removed from the medium and transferred into a tray where the roots were kept moist. Spores from Δchap1, Δskn7, Δchap1-Δskn7 (ΔΔ) and WT were prepared in ddW with 0.02% Tween 20; at least four plants were used for each mutant, and the second leaf was inoculated with three 7-μL droplets containing about 500 spores. Lesion areas were measured using imagej software from images taken 2 days after inoculation (Fig. 3a). Δchap1 and Δskn7 mutants were not significantly different in virulence from WT, whereas ΔΔ showed significantly smaller lesions (about 30% smaller, Fig. 3b). This demonstrates an additive contribution of the two transcription factors that are lacking in the double mutant. These contributions may promote the ability to counteract the plant's oxidative burst as well as other stresses the pathogen encounters during infection. Thus, the double mutant may be sensitive to the HR or other plant defenses, preventing spreading of the mutant and resulting in smaller lesions than those formed by the WT.

image

Figure 3. Plant infection assay. Second leaves of 12-day-old maize plants were inoculated with three 7-μL droplets containing about 500 spores, leaves were photographed (a) and lesion area (y-axis, plotted starting at 10 mm2) was measured after 2 days (b). Number of lesions measured: WT, 28; Δchap1, 10; Δskn7, 12; Δchap1skn7, 25. WT and ΔΔ results are from two independent biological repeats combined. Bars indicate the SEM for the number of lesions (** and *** indicate significance at P < 0.01 and 0.001).

Download figure to PowerPoint

In vitro experiments showed that in response to some stressors, there is no additive contribution, whereas for others there is (Fig. 1). Loss of either of these transcription factors results in hypersensitivity to oxidants in plate assays, and the contribution of each is reflected in the expression of genes whose products allow the cell to cope with oxidative stress. ChAP1 is critical for increased expression of GLR1, TRR1, and TRX2 in response to hydrogen peroxide (Fig. 2), whereas loss of Skn7 results in a more modest decrease in expression as compared with WT. In the double mutant, expression of GLR1, for example, was about twofold lower than in Δchap1, reaching the level observed in the untreated WT control (no oxidant stress). In yeast, Yap1 and Skn7 coregulate some oxidative stress response genes (He et al., 2009), and our data provide the first genetic evidence, to our knowledge, that this mechanism acts in a filamentous fungus. Significantly, in the double mutant GLR1, TRX2 and SOD1 are not induced at all (Fig. 2). Thus, although Skn7 is not absolutely required for ChAP1 function, the combined contribution of both ChAP1 and Skn7 is needed for expression of GLR1, TRX2, and SOD1 in response to oxidant stress. The low transcript levels remaining in oxidant-stressed Δchap1 (Fig. 2) could still provide significant amounts of enzyme activity. Complete loss, in the double mutant, of oxidant-induced expression of some genes needed to cope with oxidative stress would imply that the ChAP1-dependent ROS detoxifying mechanism is severely impaired when Skn7 is absent. This prediction can be further tested at the protein abundance or enzyme activity levels. Skn7 control was most evident for the superoxide dismutase encoding gene SOD1, where ChAP1 control is minor if at all (Fig. 2). In Candida glabrata, superoxide dismutase (SOD) expression, critical for resistance to the superoxide-generating compound menadione, is independent of both CgSkn7 and CgYAP1 (Roetzer et al., 2011). The C. heterostrophus double mutant showed increased sensitivity to menadione (Fig. 1). Thus, the ‘wiring’ of the Skn7 and Yap1-dependent signaling pathways in the plant pathogen studied here is different from that in C. glabrata, but in both species SOD will be an important enzyme activity to study further.

On commercial hybrid maize cultivars Jubilee (Lev et al., 2005) and Royalty (this study), loss of ChAP1 did not compromise virulence in droplet inoculation assays. On the maize cultivar W64A, spray inoculation with Δchap1 resulted in about twofold decreased lesion size as compared with WT (Zhang et al., 2013). Necrotrophs like C. heterostrophus are thought to thrive in an oxidant-rich environment (see Heller & Tudzynski, 2011). The fungus thus must contend with ROS produced by both members of the host–pathogen pair. Skn7 senses not only oxidant stress, but also osmotic and cell wall stresses (Izumitsu et al., 2007; Oide et al., 2010; Fassler & West, 2011), and ChAP1 also appears to have redox-independent sensory functions (Shanmugam et al., 2010; Shalaby et al., 2012). In Candida glabrata, certain combinations of oxidative, nitrosative and osmotic stress were more potent than each alone (Kaloriti et al., 2012). On the plant, C. heterostrophus may encounter combined stresses; therefore, loss of virulence when both ChAP1 and Skn7 functions are missing could be related to factors other than oxidants, and the approach used in Candida could be applied to plant pathogens.

The finding (Fig. 2) that different members of the ChAP1 regulon are affected differently by loss of Skn7 suggests that a genome-wide study of these mutants will uncover classes of genes whose promoters bind different combinations of transcription factors that transduce oxidant-related signals. Furthermore, the Δskn7 mutant is highly sensitive to ROS, similar to Δchap1 (Fig. 1 and Oide et al., 2010), yet the expression of the panel of known antioxidant genes (Fig. 2) is only modestly reduced. Again, this suggests that the Skn7 regulon includes additional genes that are critical for tolerance to oxidants and other stresses. C. heterostrophus should be a good model necrotrophic pathogen in which to address these questions at the systems level, considering that the genome is being studied intensively (Ohm et al., 2012; Condon et al., 2013), as is the genetic basis for stress physiology (Lev et al., 2005; Igbaria et al., 2008; Oide et al., 2010; Wu et al., 2012; Zhang et al., 2013).

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References

This study and a postdoctoral fellowship award to O.L. were funded by Israel Science Foundation grant ISF 370/08. We are grateful to Lea Rosenfelder for her expert technical assistance. We thank Prof. B. Gillian Turgeon for the skn7 mutant strain. We are grateful to Naomi Trushina (Horwitz lab) and to the reviewers of the manuscript for their comments and suggestions.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References
  • Catlett NL, Lee B-N, Yoder O & Turgeon B (2003) Split-marker recombination for efficient targeted deletion of fungal genes. Fungal Genet. Newsl. Online 50: 911.
  • Condon B, Leng Y, Wu D et al. (2013) Comparative genome structure, secondary metabolite and effector coding capacity across Cochliobolus pathogens. PLoS Genet 9: e1003233.
  • Fassler JS & West AH (2011) Fungal Skn7 stress responses and their relationship to virulence. Eukaryot Cell 10: 156167.
  • Govrin EM & Levine A (2000) The hypersensitive response facilitates plant infection by the necrotrophic pathogen Botrytis cinerea. Curr Biol 10: 751757.
  • He XJ, Mulford KE & Fassler JS (2009) Oxidative stress function of the Saccharomyces cerevisiae Skn7 receiver domain. Eukaryot Cell 8: 768778.
  • Heller J & Tudzynski P (2011) Reactive oxygen species in phytopathogenic fungi: signaling, development, and disease. Annu Rev Phytopathol 49: 369390.
  • Igbaria A, Lev S, Rose MS, Lee BN, Hadar R, Degani O & Horwitz BA (2008) Distinct and combined roles of the MAP kinases of Cochliobolus heterostrophus in virulence and stress responses. Mol Plant Microbe Interact 21: 769780.
  • Izumitsu K, Yoshimi A & Tanaka C (2007) Two-component response regulators Ssk1p and Skn7p additively regulate high-osmolarity adaptation and fungicide sensitivity in Cochliobolus heterostrophus. Eukaryot Cell 6: 171181.
  • Kaloriti D, Tillmann A, Cook E et al. (2012) Combinatorial stresses kill pathogenic Candida species. Med Mycol 50: 699709.
  • Lev S, Hadar R, Amedeo P, Baker SE, Yoder OC & Horwitz BA (2005) Activation of an AP1-like transcription factor of the maize pathogen Cochliobolus heterostrophus in response to oxidative stress and plant signals. Eukaryot Cell 4: 443454.
  • Ohm RA, Feau N, Henrissat B et al. (2012) Diverse lifestyles and strategies of plant pathogenesis encoded in the genomes of eighteen dothideomycetes fungi. PLoS Pathog 8: e1003037.
  • Oide S, Liu J, Yun SH et al. (2010) Histidine kinase two-component response regulator proteins regulate reproductive development, virulence, and stress responses of the fungal cereal pathogens Cochliobolus heterostrophus and Gibberella zeae. Eukaryot Cell 9: 18671880.
  • Ram AF & Klis FM (2006) Identification of fungal cell wall mutants using susceptibility assays based on Calcofluor white and Congo red. Nat Protoc 1: 22532256.
  • Robbertse B, Yoder OC, Nguyen A, Schoch CL & Turgeon BG (2003) Deletion of all Cochliobolus heterostrophus monofunctional catalase-encoding genes reveals a role for one in sensitivity to oxidative stress but none with a role in virulence. Mol Plant Microbe Interact 16: 10131021.
  • Roetzer A, Klopf E, Gratz N et al. (2011) Regulation of Candida glabrata oxidative stress resistance is adapted to host environment. FEBS Lett 585: 319327.
  • Shalaby S, Horwitz BA & Larkov O (2012) Structure-activity relationships delineate how the maize pathogen Cochliobolus heterostrophus uses aromatic compounds as signals and metabolites. Mol Plant Microbe Interact 25: 931940.
  • Shanmugam V, Ronen M, Shalaby S et al. (2010) The fungal pathogen Cochliobolus heterostrophus responds to maize phenolics: novel small molecule signals in a plant-fungal interaction. Cell Microbiol 12: 14211434.
  • Šidák Z (1967) Rectangular confidence regions for the means of multivariate normal distributions. J Am Stat Assoc 62: 626633.
  • Torres MA & Dangl JL (2005) Functions of the respiratory burst oxidase in biotic interactions, abiotic stress and development. Curr Opin Plant Biol 8: 397403.
  • Turgeon BG, Garber RC & Yoder OC (1987) Development of a fungal transformation system based on selection of sequences with promoter activity. Mol Cell Biol 7: 32973305.
  • Turgeon BG, Condon BJ, Liu J & Zhang N (2010) Protoplast transformation of filamentous fungi. Molecular and Cell Biology Methods for Fungi, Springer Protocols, Vol. 4 (Sharon A, ed.) pp. 319. Humana/Springer, New York, NY.
  • Wirsel S, Turgeon BG & Yoder OC (1996) Deletion of the Cochliobolus heterostrophus mating-type (MAT) locus promotes the function of MAT transgenes. Curr Genet 29: 241249.
  • Wu D, Oide S, Zhang N, Choi MY & Turgeon BG (2012) ChLae1 and ChVel1 regulate T-toxin production, virulence, oxidative stress response, and development of the maize pathogen Cochliobolus heterostrophus. PLoS Pathog 8: e1002542.
  • Wuichet K, Cantwell BJ & Zhulin IB (2010) Evolution and phyletic distribution of two-component signal transduction systems. Curr Opin Microbiol 13: 219225.
  • Zhang N, Mohd Zainudin NAI, Scher K, Condon BJ, Horwitz BA & Turgeon BG (2013) Iron, oxidative stress and virulence: roles of iron-sensitive transcription factor Sre1 and the redox sensor ChAp1 in the maize pathogen Cochliobolus heterostrophus. Molec Plant-Microbe Interact 26: 14731485.