SEARCH

SEARCH BY CITATION

Keywords:

  • PSK1 ;
  • oxidative stress;
  • yeast

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

The Per–ARNT–Sim (PAS) domain serine/threonine kinase PAS kinase is involved in energy flux and protein synthesis. In yeast, PSK1 and PSK2 are two partially redundant PASK homologs. We recently generated PSK2 deletion mutant and showed that Psk2 acts as a nutrient-sensing protein kinase to modulate Ultradian clock-coupled respiratory oscillation in yeast. Here, we show that deletion of PSK1 increased the sensitivity of yeast cells to oxidative stress (H2O2 treatment) and partially inhibited cell growth; however, the growth of the PSK2-deleted mutant was similar to that of the wild type. Superoxide dismutase-1 (SOD1) mRNA and protein levels were lower in PSK1-deletion mutant than the wild type. The mRNA levels of stress response genes CTT1, HSP104, ATH1, NTH1 and SOD2 were similar in both the PSK1-deleted mutant and wild-type yeast. Furthermore, intracellular accumulation of reactive oxygen species (ROS) was noted in PSK1-deleted mutant. These results suggest that PSK1 induces SOD1 expression to protect against oxidative stress in yeast.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

The Drosophila proteins PER, ARNT, and SIM (PAS) are involved in the control of circadian rhythms. In yeast, PSK1 and PSK2 are two partially redundant PASK homologs (Rutter et al., 2002). Psk1p and Psk2p, which contain PAS domains, are evolutionarily conserved signaling modules that act as sensors for a variety of stimuli including small molecule ligands, light, oxygen, and the redox state (Zhulin et al., 1997). PAS domains are found in a variety of other signaling molecules including receptors and transcription factors, as well as protein kinases. Rutter et al. (2002) found that yeast lacking PSK1 and PSK2 genes fail to grow on galactose at elevated temperatures. Their screening for high-copy suppressors of this phenotype yielded several genes involved in protein synthesis and carbohydrate metabolism, including three PSK kinase (PASK) substrates, Caf20p (cap-associated factor 20), the yeast counterpart of the 4E-BP or PHAS proteins, UDP-glucose pyrophosphorylase (Ugp1p), and glycogen synthase Gsy2p (Rutter et al., 2002). Thus, these two PAS kinases seem to function as nutrient-sensing proteins that regulate a broad range of metabolic processes such as promotion of protein synthesis as well as suppression of glycogen accumulation and control glucose partitioning (Crespo & Hall, 2002).

We investigated in a previous study the role of PSK2 kinase in Ultradian clock-coupled respiratory oscillation (UCRO) in yeast. Specifically, we examined the effects of this protein on glucose uptake and regulation of storage carbohydrate synthesis in maintaining proper UCRO. The results showed oscillations in PSK2 mRNA levels were in concert with oscillations in UCRO. PSK2-mutant cells showed reduced glucose uptake and low synthesis of storage carbohydrates compared with the wild-type yeast. The results suggested that Psk2 acts as a nutrient-sensing protein kinase to modulate UCRO in yeast (Ouyang et al., 2011). It is well known that the UCRO is coupled to the cell division cycle and resistance to stress (Wang et al., 2000). Furthermore, PSKs are involved in stress response, and PASK-deficient yeast are sensitive to stress stimuli that affect cell integrity, for example, treatment with agents that cause cell wall perturbation induces growth defects (Smith & Rutter, 2007). Stresses of cell integrity activate PASK and phosphorylate Ugp1, which leads to increased cell wall glucan biosynthesis and maintenance of cell wall integrity (Grose et al., 2007; Smith & Rutter, 2007). PSK-dependent phosphorylation of Ugp1 also leads to the formation of a signal complex with Rho guanine nucleotide exchange factor (RhoGEF) Rom2 and mRNA-binding protein Ssd1 to induce Rho1 activation, which stimulates cell growth and stress resistance (Grose et al., 2007). In Candida albicans, Sko1 is necessary for the cell wall damage response, and PSK1 positively regulates the expression of SKO1 and SKO1-dependent genes in response to caspofungin, an inhibitor of beta-1, 3-glucan synthase (Rauceo et al., 2008). PSK1 deletion mutant is also hypersensitive to caspofungin (Rauceo et al., 2008). These data suggest that Psk1-dependent induction of SKO1 is critical for an effective response to cell wall perturbation (Rauceo et al., 2008). Although PSK2 mRNA levels seem to be altered in Aspergillus nidulans exposed to oxidative stress, as demonstrated by DNA microarray analysis (Pocsi et al., 2005), the exact roles of PASK in the regulation of oxidative, heat, and osmotic stress responses are unknown.

The present study was designed to determine the roles of PSK1 and PSK2 in the stress response. The results showed that deletion of PSK1 resulted in failure of cell growth under oxidative stress conditions, but not under heat or osmotic stress. In contrast, the growth of PSK2-deletion mutant was similar to that of the wild type under similar stress conditions. Analysis of the mRNAs levels of several genes related to the stress response showed that deletion of PSK1 reduced only superoxide dismutase-1 (SOD1) mRNA compared with wild type. The PSK1-deletion mutant also showed decreased levels of Cu/Zn-SOD protein and increased levels of intracellular reactive oxygen species (ROS). The results suggest that PSK1 regulates SOD1 expression to protect the cell against oxidative stress damage.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

Yeast and culture

The Saccharomyces cerevisiae S288C (MATa mal gal2 SUC2) yeast strain was used in this study. Cells were cultured either in YPAD medium (1% yeast extract, 2% polypeptone, 40 mg mL−1 adenine sulfate, and 2% glucose) or a synthetic medium (SD medium) containing 2% glucose, 6.7 g L−1 yeast nitrogen base (Difco Laboratory, Detroit, MI), free of amino acids and supplemented with essential amino acids. When necessary, these media were supplemented with 500 mg L−1 G-418, a kanamycin derivative.

Construction of PSKs deletion mutant

PSK1 was deleted in S288C yeast using a deletion cassette carrying loxP-kanMX-loxP, a kanamycin-resistant (kanr) gene of Escherichia coli, which was amplified by polymerase chain reaction (PCR) directed on the template plasmid pUG6 (a kind gift from Dr. J.H. Hegemann, Washington University, St. Louis, MO; Gueldener et al., 2002; Ouyang et al., 2009) using synthetic oligonucleotides, 5′-CAGTAGCTTACCAATTGAGTGAAAGTTTCCGTTCGTCATCTCCCCAGCTGAAGCTTCGTACGC-3′ named PSK1-KnockF and 5′-CCAACTCATTACTGAAGAAAGTAAGAAGAACGACATACCAAGCGCATAGGCCACTAGTGGATCTG-3′named PSK1-KnockR, as the forward and reverse primers, respectively. S288C was transformed with the PCR product, and the PSK1-deleted transformants (PSK1∆) were selected by culturing cells on the YPAD plate (1% yeast extract, 2% polypeptone, 40 mg mL−1 adenine sulfate, and 2% glucose) containing the kanamycin derivative G-418 at 500 mg L−1. Deletion of PSK1 was verified by detecting the PCR product from the kanr gene using synthetic oligonucleotides PSK1-KnockF and the kanr-specific primer Kan-R378 5′-CAGGAACACTGCCAGCGCATC-3′ and also by disappearance of PCR product from the PSK1 open-reading frame using 5′- CGGTGCTTCCAACCTCTCAG-3′ named PSK1fwd and 5′-CCATAGAGGGTCCATGGTGCGG-3′ named PSK1rev, as the forward and reverse primers, respectively. The PSK2 deletion mutant (PSK2∆) was constructed as described previously (Ouyang et al., 2011).

Stress treatment assay

The heat shock survival assay on solid media was performed as described previously (Nwaka et al., 1995). For heat stress treatment, wild type, PSK1, and PSK2 mutant cells were streaked out on medium YPAD plate and incubated at 30 °C for 3 days. The cells were replica plated onto fresh plates and shifted to 52 °C for 4 h. Then, cells were shifted back to 30 °C, and recovery was analyzed after 2 days. For chemical stress, the wild type, PSK1, and PSK2 mutant cells were streaked out on YPAD plate containing 5 mM H2O2 (Sigma) or 1.5 M NaCl, then cultured at 30 °C for 1.5 and 2 days, respectively (Slekar et al., 1996). The wild type, PSK1, and PSK2 mutant cells were serially diluted in water. These diluted samples were spotted onto YPAD plate or YPAD plate containing 5 mM H2O2 and incubated at 30 °C for 1.5 days.

Northern blot analysis and RT-PCR

Total RNA was isolated with Isogen (Nippon Gene, Tokyo, Japan), and 20 μg of RNA was electrophoresed on a 1% agarose-formaldehyde gel. Probes for hybridization to mRNAs were PCR amplified on genomic DNA using the forward and reverse primers listed in Table 1. Probe labeling and hybridization were performed with the PCR DIG-labeling mix and DIG system according to the instructions supplied by the manufacturer (Roche, Mannheim, Germany). The mRNA levels were normalized to the level of the control, ACT1 mRNA. For RT-PCR, 0.2 μg of total RNA was used for reverse transcription (ReverTra Ace qPCR RT Kit; TOYOBO, Osaka, Japan). The cDNA obtained was used for PCR. Primers for PSK1 were PSK1fwd and PSK1rev.

Table 1. Oligonucleotide sequences of the primers used in the Northern blot analysis
PrimersSequence 5′-3′
TPS1
ForwardCAATGTCGTCCGGAGGGCTG
ReverseCTGCCCTGGTATTCCACC
NTH1
ForwardGCCAAGGACCGGTAGCCCAAG
ReverseGGTACCTGGATAAGCCTGTTTCGGG
ATH1
ForwardGGGTTCGGCTATGCCTTAGACACC
ReverseGCAAACTCGTCGGGATCTGTC
HSP104
ForwardGACTCTCGTGGCGCTGATACG
ReverseCTCTTGCGACGGCGACACCAGC
CTT1
ForwardCGAACAGCCAAGAGCTC
ReverseGGTTCCCAAGGAACTCCC
SOD1
ForwardAAGCAGTCGCAGTGTTAAAGG
ReverseTTAGACCAATGACACCACAGG
SOD2
ForwardATGTTCGCGAAAACAGCAG
ReverseTCTTGCCAGCATCGAATCTT

Treatment with dihydroethidium

Intracellular ROS were detected with dihydroethidium (Sigma-Aldrich, Deisenhofen, Germany). Dihydroethidium (5 μg) was added to 1 mL cell suspension (1 × 108 cells mL−1) and incubated at 30 °C for 8 h. Cells were then observed under an Olympus BX50 fluorescence microscope (Abudugupur et al., 2003).

Western blotting

The protein levels of Cu/Zn- and Mn-SODs, and actin as a control, were measured by Western blotting using anti-human Cu/Zn-SOD and Mn-SOD (SOD-100 and SOD-111; Stressgen, Victoria, Canada), and anti-actin antibodies. Western blot analysis was performed as described previously (Mitsui et al., 1994), and blots were stained by the ECL detection system (Amersham, UK).

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

PSK1 mutants are sensitive to oxidative stress

Previous reports indicated that activation of PASK allows the cell to respond to harsh extracellular conditions and continue to survive and grow (Cardon & Rutter, 2012). Psk1/2 regulates glucose partitioning for either glucan or glycogen synthesis, and Scpsk1 Scpsk2 double mutants are sensitive to cell wall damage (Smith & Rutter, 2007). Psk1 is also required for functional expression of SKO1 in response to cell wall perturbation (Rauceo et al., 2008). To investigate whether PSKs are involved in the stress response, we constructed PSK1- and PSK2-deletion mutants by PCR. Deletion of PSK1 by the kanr gene in PSK1∆ transformant was verified by detecting PSK1- and kanr-specific PCR products (Fig. 1a, left). The PSK1 mRNA was detectable only in the wild type but not PSK1∆ by RT-PCR (Fig. 1a, right). These results confirm the replacement of PSK1 with Kanr gene and the lack of expression of PSK1 mRNA in PSK1∆. The construction of PSK2 deletion mutant was described previously (Ouyang et al., 2011).

image

Figure 1. Deletion of PSK1 in S288C-derived PSK1∆ and patterns of stress response. (a) Deletion of PSK1 was verified by disappearance of the PCR product directed against the PSK1 open-reading frame using PSK1 forward and reverse primers, and detection of PCR products directed against the kanr gene using PSK1-Knock forward and Kan-reverse primers. RT-PCR analysis of PSK1 mRNA level in wild type (WT) and PSK1∆ (left). Equal amounts of RNA were reverse transcribed to generate cDNA, which was subjected to PSK1-specific PCR. The quality of RNA was confirmed by RT-PCR amplification of ACT1 (right). (b) Representative pattern of wild type, PSK1- and PSK2-mutants treated with heat shock, oxidative, and osmotic stress. Wild type S288C, PSK1- and PSK2-mutants were cultured in the YPAD medium. The cells were streaked out on YPAD plate and allowed to grow for 2 days at 30 °C, replica plated onto a fresh YPAD plate and then incubated at 52 °C for 4 h, then changed to 30 °C for 2 days (top panel). The cells were streaked out on YPAD plate plus 1.5 M NaCl and incubated at 30 °C for 2 days (bottom right). The cells were streaked out on YPAD plate plus 5 mM H2O2 and incubated at 30 °C for 1.5 days (bottom left). (c) The cells were serially diluted in water. These diluted samples were spotted onto YPAD plate (left) or YPAD plate containing 5 mM H2O2 (right) and incubated at 30 °C for 1.5 days.

Download figure to PowerPoint

We tested the effects of heat, osmotic, and oxidative stresses on the growth of the prepared mutants. As shown in Fig. 1b and c, all stains grew well on YPAD plates in the absence of stress. PSK1 and PSK2 mutants recovered in 2 days at 30 °C after culture at 52 °C for 4 h, indicating their resistance to heat stress. PSK1 and PSK2 mutants were also resistant to osmotic stress when the cells were treated with 1.5 M NaCl. Surprisingly, PSK1 mutant was sensitive to oxidative stress as shown by reduced cell survival after treatment with 5 mM H2O2 compared with the wild type (Fig. 1b and c). This specific sensitivity to oxidative stress by PSK1 mutant was confirmed in experiments that showed resistance of PSK2 mutant yeast to the same type of oxidative stress. These results suggest that PSK1 may play a role in oxidative stress response signaling.

PSK1 regulates SOD1 expression during oxidative stress

To further examine the mechanisms of PSK1 in stress response, we measured the mRNA expression level of several genes related to stress response in yeast treated with H2O2, trehalose-6-phosphate synthase 1 (TPS1), acid and neutral trehalase (ATH1 and NTH1), heat shock protein 104 (Hsp104), cytosolic catalase T (CTT1), superoxide dismutases (SOD1, SOD2). As shown in Fig. 2, treatment with H2O2 strongly induced HSP104 and SOD2 mRNAs in wild type as well as PSK1 and PSK2 mutant yeast. However, SOD1 mRNA level was decreased in PSK1-deletion mutant compared with wild type and PSK2 deletion mutant. Interestingly, NTH1, ATH1, and CTT1 mRNA levels were low, and TPS1 was undetected in wild type, PSK1, and PSK2 deletion mutants (Fig. 2a). We also measured the protein levels of Cu/Zn-SOD and Mn-SOD to determine whether SOD gene expression was inhibited in the PSK1-deletion mutant. The anti-Cu/Zn-SOD and anti-Mn-SOD antibodies were used to detect Cu/Zn-SOD and Mn-SOD protein expression in H2O2-treated cells by Western blot. Only PSK1-deletion mutant showed low Cu/Zn-SOD expression compared with wild type and PSK2-deletion mutant (Fig. 2b). These results suggest that PSK1 regulates SOD1 gene expression to protect the cells from oxidative stress.

image

Figure 2. The mRNA level of stress-related genes and protein levels of SOD1 and SOD2 in PSK1-deficient yeast. (a) Changes in mRNA levels in wild type, PSK1-mutant and PSK2-mutant yeast. Cells were treated with 5 mM H2O2. Total RNA (20 μg) was electrophoresed on 1% agarose-formaldehyde gel and hybridized with PCR-amplified and DIG-labeled DNA probes. Northern blots were visualized on a lumino-image analyzer. (b) Protein levels of Cu/Zn-SOD, Mn-SOD, with actin used as a control, in wild type, PSK1-mutant and PSK2-mutant cells determined by Western blotting.

Download figure to PowerPoint

Accumulation of ROS in PSK1-deletion mutant

In yeast, eighty to ninety percent of the total SOD activity during growth on glucose is Cu/Zn-SOD (Jamieson et al., 1994; Costa et al., 1997), and disruption of Cu/Zn-SOD results in severe shortening of life span due to increased intracellular free radicals or ROS. One potential mechanism of the decreased survival of PSK1 mutant on H2O2 is increased intracellular ROS. For this reason, intracellular ROS levels were measured using dihydroethidium. Before treatment with H2O2, fluorescent microscopy showed undetected levels of ROS in the PSK1 mutant, PSK2 mutant, and wild type. However, after 8 hr treatment with H2O2, intracellular accumulation of ROS was observed in the PSK1 deletion mutant but not in the wild type and PSK2 deletion mutant (Fig. 3).

image

Figure 3. Accumulation of ROS in PSK1-deletion mutant yeast cells. Intracellular levels of endogenous ROS examined using dihydroethidium in the wild type (left), PSK1 mutant (middle) and PSK2 mutant (right) cells treated with 5 mM H2O2. Cells were observed by Nomarski imaging (a–c, g–i) and fluorescent microscopy (d–f, j–l) at 0 hr and 8 h after exposure to oxidative stress.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

We reported recently in our study on the role of PSK2, suggesting PSK2 coordinates glucose metabolism and utilization to maintain UCRO in yeast (Ouyang et al., 2011). As the UCRO is known to be associated with the cell division cycle, resistance to oxidative stress, heat, and osmotic stress (Wang et al., 2000), the above results were considered to reflect the importance of PSKs in the stress response. PASK has been reported to be involved in cell wall damage stress based on studies that demonstrated the sensitivity of both PSK1/PSK2 double mutants to cell wall perturbation (Smith & Rutter, 2007). PSKs phosphorylate Ugp1 to produce cell wall glucans at the expense of glycogen biosynthesis. Phosphorylation of Ugp1 also promotes the formation of a signaling complex with Ssd1 and Rom2, which leads to the activation of Rho1 to stimulate cell survival and division (Cardon et al., 2012). Rauceo et al. (2008) also showed the C. albicans ortholog Psk1 deletion strains were hypersensitive to the cell well damage reagent caspofungin. In the present study, we investigated the role of PSKs in stress response using the PCR method to construct PSK1 and PSK2 deletion mutants. The results showed that deletion of PSK1 resulted in increased sensitivity of the cells to H2O2 (oxidative stress), compared with the wild type and PSK2 mutant. Interestingly, PSK1/PSK2 deletion mutants tolerated heat stress and osmotic stress similar to the wild type.

Although the amino acid sequence in PSK1 and PSK2 is highly conserved (with 71% homology) and shows high homology in the kinase (90%) and PAS (81%) domains (Grose et al., 2009), PSK1 and PSK2 seem to have different functions. It is reported that phosphorylation of Ugp1 in response to growth on a nonfermentative carbon source requires PSK1 only, while phosphorylation of Ugp1 in response to cell integrity stress requires both PSK1 and PSK2 (Grose et al., 2009). Our data also showed the involvement of PSK1 only, but not PSK2, in oxidative stress signaling. The PSK1-deletion mutant was sensitive to oxidative stress, while PSK2-deletion mutant was not. The results suggest that PSK2 expressed in PSK1-deleted mutant cannot compensate the function of the PSK1 when the latter is deleted, with the resultant failure of cell survival under oxidative stress condition. These results indicate the close evolvement of PSK1 and PSK2 although they have separate functions.

Our data showed the oxidative stress stimulus of H2O2 resulted in upregulation of the oxidative stress response genes, such as SOD2, in wild type, PSK1- and PSK2-deletion mutants. This finding is in agreement with those of a previous study, which reported that oxidative stress induced SOD1 and SOD2 expression (Lee et al., 2002). However, SOD1 mRNA and Cu/Zn-SOD protein levels were lower in PSK1-deletion mutant compared with the wild type and PSK2-deletion mutant. Consistent with our results, Dr. Liu reported that SOD1Δ cell sensitive to H2O2, and SOD1 is required for cell wall structure and for tolerance to cell-wall-perturbing agents in S. cerevisiae (Liu et al., 2010). These results suggest that PSK1 is required for expression of SOD1 in response to oxidative stress. This conclusion is consistent with the finding that protein kinase Psk1 acts as regulator of SKO1 expression in response to caspofungin (Rauceo et al., 2008). It is not clear, however, whether PSK1 acts directly or upstream of SOD1 to regulate the transcription of SOD1. Although PAS domains are found in a variety of other signaling molecules including receptors and transcription factors (Rutter et al., 2002), there is no evidence to show that PSKs act as transcription factors for direct regulation of transcription. It is also possible that PSK1 phosphorylates transcription factor(s) involved in the regulation of SOD1 expression. Psk1 and Psk2 have high homology in the kinase domain regions, however, the Psk2-deficient yeast grew well like the wild type and did not show the sensitivity to H2O2 treatment. Thus, the kinase activity of Psk1 may be necessary for the SOD1 expression, but the PAS domain sensors the oxidative stress and plays a more important role for the regulation of SOD1 expression. Further studies are needed to investigate the molecular mechanisms of Psk1action.

In conclusion, we have demonstrated in the present study that deletion of PSK1 in yeast increases the sensitivity of the cells to oxidative stress and that this effect is mediated by down-regulation of SOD1 expression and accumulation of ROS. These results highlight a new role for PSK1 in the regulation of expression of SOD1 and its involvement in oxidative stress tolerance in yeast.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References