Development and evaluation of hexaplex PCR for rapid detection of methicillin, cadmium/zinc and antiseptic-resistant staphylococci, with simultaneous identification of PVL-positive and -negative Staphylococcus aureus and coagulase negative staphylococci

Authors


Abstract

We developed a multiplex PCR to detect the presence of methicillin- (mecA), cadmium/zinc-(czrC) and antiseptic-resistant (qacA/B) staphylococci and to identify Panton–Valentine leukocidin (PVL)-positive and -negative Staphylococcus aureus and coagulase-negative staphylococci (CoNS) from infected and healthy eyes. The assay was validated on 177 staphylococci comprising of 55 each of S. aureus and CoNS isolated from infected eyes and five S. aureus and 62 CoNS isolated from healthy eyes and nine direct ocular samples. Nine direct ocular samples for in situ testing consisted of corneal scrapings (4), conjunctiva swabs (2) and others (3). Multiplex PCR result was correlated with genotype data obtained with single PCR and dot-blot assay. The control strains that were positive in multiplex PCR for 16S rRNA, nuc, mecA, pvl, czrC and qacA/B genes were also positive in the dot-blot assay. The specificity of amplified genes obtained with reference strains was further confirmed by DNA sequencing. The single step-hexaplex PCR method can be used for rapid detection of mecA, nuc, pvl, czrC and qacA/B genes in staphylococci with simultaneous identification of PVL-positive and -negative S. aureus and CoNS from a variety of ocular samples.

Introduction

Staphylococcus aureus, a gram-positive bacterium, is one of the most common pathogens isolated from conjunctivitis and other ocular infections, for example bacterial keratitis, blepharitis, endophthalmitis (Kunimoto et al., 1999; Sj Matheson, 2000; Benz et al., 2004; Blomquist, 2006; Khan et al., 2010). Methicillin-resistant S. aureus (MRSA), which causes bacterial keratitis, a serious infection of cornea, has been reported in different parts of the world (Fukuda et al., 2002; Sharma et al., 2004; Shanmuganathan et al., 2005; Chuang et al., 2012). Coagulase-negative staphylococci (CoNS) were not recognized as important human pathogens (Fukuda et al., 2002; von Eiff et al., 2002) until their frequent isolation was reported from bloodstream infections, clinical microbiological laboratories and ocular infections (Pfaller & Herwaldt, 1988; Kunimoto et al., 1999; von Eiff et al., 2002; Sharma et al., 2004; Gopinathan et al., 2009). Community-associated MRSA (CA-MRSA) has been reported to carry Panton–Valentine leukocidin (PVL), which plays a role in pathogenesis and mobile staphylococcal cassette chromosome mec (SCCmec) genetic element harboring methicillin (MET) resistance (mecA) gene (Vandenesch et al., 2003; Zhang et al., 2004, 2005; Diep et al., 2010). The presence of czrC gene in SCCmec encoding for cadmium and zinc resistance (CZR) has also been reported in S. aureus isolated from pigs in Denmark (Aarestrup et al., 2009; Cavaco et al., 2010). Antiseptic resistance genes qacA/B conferring resistance to quaternary ammonium compound (QACs) has been reported in MRSA isolated from a variety of infections (Noguchi et al., 2005; Ho & Branley, 2012). However, benzalkonium chloride, a quaternary ammonium compound, has been used to treat conjunctivitis caused by MRSA (Horil et al., 2001; Noecker, 2001). Lysostaphin, a zinc metalloproteinase that lyses S. aureus has been found effective against S. aureus in treating experimental keratitis and endophthalmitis caused by MRSA (Schindler & Schuhart, 1965; Dajcs et al., 2000). However, the presence or absence of PVL, czrC and QACs genes in S. aureus and CoNS isolated from ocular infection is not well studied.

Various multiplex PCRs have been reported for identification of human-associated staphylococci and animal-associated coagulase positive staphylococci (CoPS; Sasaki et al., 2010; Hirotaki et al., 2011). In addition, multiplex PCR assay has also been used to detect pvl and mecA genes and at the same time to discriminate between MRSA and methicillin- sensitive S. aureus (MSSA; Zhang et al., 2004, 2008; McClure et al., 2006). Similarly, quadriplex PCR was used to detect methicillin- and mupirocin-resistant staphylococci with simultaneous detection of S. aureus from CoNS (Pérez-Roth et al., 2001; Zhang et al., 2004). Another multiplex PCR has been described by Strommenger et al. (2003) for the detection of nine clinically relevant antibiotic resistant genes of S. aureus. To the best of our knowledge, there is no PCR method which can detect MET-, CZ-, QAC-resistance genes, and PVL-positive and -negative staphylococci in a single reaction tube. Since cadmium and zinc chloride are used as additives in antiseptics in hospitals, lysostaphin in treating experimental keratitis (Dajcs et al., 2000; Mayer et al., 2001; Noguchi et al., 2005; Aarestrup et al., 2009), and PVL plays an important role in the pathogenesis of murine keratitis (Zaidi et al., 2013), it has become important to detect cadmium/zinc-, antiseptic- and methicillin-resistant staphylococci and PVL-positive and -negative S. aureus and CoNS isolated from ocular infections. Here we report on the development and evaluation of a hexaplex PCR assay for rapid detection of CZ, QAC and MET-resistant genes with simultaneous identification of PVL-positive and -negative S. aureus and CoNS isolated from ocular infections.

Materials and methods

Sample collection and identification

Clinical samples were collected from patients suffering from bacterial keratitis, endophthalmitis/tunnel infection, conjunctivitis, dacryocystitis/nasolacrimal duct obstruction and other ocular infections by an ophthalmology clinical faculty after clinical examination and from conjunctiva of asymptomatic healthy individuals and referred to Microbiological Services at LV Prasad Eye Institute, Patia, Bhubaneswar, India, during March 2007 to December 2011. The samples were cultured for bacteria by standard microbiological methods and the isolates were identified based on gram staining, catalase production, fermentation of glucose in oxidation-fermentation media, growth, and fermentation of mannitol salt agar. The identity of the culture was confirmed with ID 32 STAPH strips inoculated with strains by using atbnew v.1.0.0 software on an ATB™ reader (bioMérieux, France). The number of staphylococcal strains with the species used in the study is shown in Supporting Information, Table S1. Strains of S. aureus and CoNS obtained from the American Type Culture Collection (ATCC, Manassas, VA) and previously identified isolates from our laboratory were used as controls for the presence or absence of 16S rRNA nuc, mecA, pvl, czrC and qacA/B genes. These strains include S. aureus ATCC 43300, S. aureus Mu50, S. aureus ATCC 25923, S. aureus 1295, Staphylococcus epidermidis ATCC 12228, S. epidermidis 1056, Staphylococcus haemolyticus ATCC 29970, S. haemolyticus 118, S. haemolyticus 263, Staphylococcus saprophyticus ATCC 15305, Staphylococcus simulans ATCC 27851, Staphylococcus warneri ATCC 49454, Staphylococcus gallinarum ATCC 700401, Staphylococcus sciuri ATCC 29060, Staphylococcus xylosus ATCC 29971, Staphylococcus lugdunensis ATCC 49576, Staphylococcus lentus, ATCC 700403, Staphylococcus capitis 527. To determine the specificity, Streptococcus pyogenes ATCC 19615 and an ocular strain of Streptococcus pneumoniae were used as negative controls in this study. All the staphylococcal and streptococcal strains were stored in 20% glycerol in tryptic soy broth at −80 °C.

Template DNA and hexaplex PCR assay

Bacterial cell lysate was prepared according to the method described previously (Arciola et al., 2001). Briefly, 100 μL of culture overnight grown in tryptic soy broth was centrifuged and the pellet resuspended in 45 μL of Milli-Q water. Lysostaphin solution 5 μL was then added (100 μg mL−1) and incubated at 37 °C for 10 min. Subsequently, 5 μL of proteinase K was added (100 μg mL−1) and 150 μL of 0.1 M Tris-HCl (pH 7.5), and incubated at 37 °C for 10 min. The sample was then boiled for 5 min at 100 °C, chilled and kept at −20 °C until further use, and was used as template DNA in PCR. Streptococcus pyogenes ATCC 19615 and Streptococcus pneumoniae isolated from ocular infections were used as negative controls. The sequences of primers used in the study are given in Table 1.

Table 1. Sequences of primers used in the simplex and hexaplex polymerase chain reaction
Target genePrimer sequence (5′–3′)Amplicon size (bp)References
Staph16S-FAACTCTGTTATTAGGGAAGAACA756McClure et al. (2003)
Staph16S-RCCACCTTCCTCCGGTTTGTCACC  
czrC-FTAGCCACGATCATAGTCATG655Cavaco et al. (2004)
czrC-RATCCTTGTTTTCCTTAGTGACTT  
PVL505-FTCAATGGGGAATAAAAGCTAAT505This study
PVL505-RTCAACCTTTTTCTCACTTACAG  
Au-FTCGCTTGCTATGATTGTGG349Sasaki et al. (2001)
auNuc-RGCCAATGTTCTACCATAGC  
mecA264-FGGTGAAGTAGAAATGACTGAACGT264This study
mecA264-RCAATATGTATGCTTTGGTCTTTCTGC  
QacA/B-FAGCAGGTAATGCAGCTGCTGTTG192This study
QacA/B-RAGCTACTTCGACAGCGCCCAC  

PCR amplification of target DNA was carried out in a thermal cycler (Bio-Rad) with a 200-μL PCR tube containing a reaction mixture volume of 40 μL. Each reaction contained 8 μL of 5× PCR buffer [500 mM KCl, 100 mM Tris-HCl (pH 9.0), 1.0% Triton X-100] (Promega, Madison, WI), 2.5 μL of MgCl2 (25 mM), 2.5 μL each of 2.5 M of dATP, dCTP, dGTP and dTTP (Promega), 1.0 μL of the forward and reverse primer for 16S rRNA gene (20 ng μL−1), 1 μL of DMSO (2.5%, Sigma), 0.75 μL of Taq DNA polymerase of 5 U μL−1 (Promega), Milli-Q water to a final volume of 37, and 3 μL of cell lysates (template DNA). PCR was programmed as follows: an initial denaturation at 94 °C for 2 min followed by 35 cycles consisting of denaturation at 94 °C for 30 s, annealing at 65 °C for 30 s, and extension at 72 °C for 30 s, and a final extension at 72 °C for 10 min.

Hexaplex PCR was carried out by simultaneous addition of primer pairs for mecA, nuc, pvl, czrC and qacA/B in the same reaction mixture. In the initial experiments, mecA, nuc, pvl, czrC and qacA/B primer concentration varied between 25 and 40 ng, keeping the staphylococcal 16S rRNA gene primer concentration fixed at either 15 or 20 ng in the PCR reaction mixture of 40 μL. Optimum results were obtained with a primer concentration of 25 ng for mecA, 35 ng for nuc, and 40 ng each for pvl, czrC and qacA/B genes. PCR condition for amplification remains the same for the first 10 cycles, followed by additional 25 cycles of denaturation at 94 °C for 30 s, annealing at 50 °C for 1 min and extension at 72 °C for 1 min, and a final extension at 72 °C for 10 min. Amplified products were separated by 1.5% agarose gel electrophoresis in Tris acetate buffer (1× TAE), stained with ethidium bromide and visualized with Fluoro-S-Multi Imager (Bio-Rad). Control strains of S. aureus and CoNS used in the standardization of PCR were verified for the presence or absence of 16S rRNA, nuc, mecA, pvl, czrC and qacA/B genes by dot-blot hybridization.

Probes and hybridization

Dot-blots were prepared with nylon membrane (Hybond-XL; GE Healthcare) and processed by a standard method (Maniatis et al., 1982). Briefly, the cell lysates denatured by boiling and incubating in 1 M NaOH for 20 min were transferred to nylon membrane using Bio-Rad Dot-Blot apparatus. The membrane was then neutralized for 30 min in 100 mL of neutralizing solution (1 mM EDTA, 1.5 M NaCl, 0.5 M Tris, pH 7.2). The DNA was fixed to the nylon membrane using UV cross-linker (Bio-Rad) for 2 min.

PCR amplified products obtained from S. aureus strain Mu50 for staphylococcal 16S rRNA, nuc, mecA, qacA/B genes; S. aureus strain ATCC 25923 for pvl gene and S. epidermidis strain ATCC 12228 for czrC gene were used as probes, randomly labeled (Feinberg & Vogelstein, 1984) with [α-32P] dCTP (3000 Ci mmol−1; BARC, Bombay, India) and hybridized at 65 °C in phosphate buffer containing 500 mM Na2HPO4 (pH 7.2), 7% (w/v) sodium dodecyl sulfate (SDS), 1 mM EDTA, and 1% (w/v) bovine serine albumin. Hybridized blots were washed once in 2× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate) for 15 min at 65 °C, twice in 2× SSC–0.1% SDS for 15 min at 65 °C, and once in 0.1× SSC–0.1% SDS for 15 min at 65 °C. Autoradiographs were obtained from the hybridized membrane with Molecular Imager screen and visualized in a Pharos FX Plus Molecular Imager (Bio-Rad) and also by exposing the hybridized membrane to X-ray film (Kodak).

Ocular sample analysis

Nine ocular samples (four corneal scrapings, two conjunctival swabs, one scleral buckle and two pus) were collected aseptically, inoculated into brain heart infusion broth (BHIB, Difco) and incubated at 37 °C. After overnight incubation, 100 μL of enriched culture was used for lysate preparation as described above, stored at −20 °C until further testing. Simultaneously, the culture was streaked on blood agar plates and incubated overnight at 37 °C. Isolates were identified and lysate prepared by the method described above to use as template DNA in PCR assay, with a turn-around time of 24–30 h.

Limiting-dilution experiments for estimation of multiplex PCR sensitivity

Briefly, bacterial cultures from overnight growth at 37 °C on a tryptic soy agar plate were suspended in normal saline (bioMérieux, France) to a density of 1.0 McFarland turbidity standard using a Densimat (bioMérieux). The suspensions were used to prepare serial 10-fold dilutions with sterile double-distilled water and 100 μL of the suspensions were used for lysate preparation. The minimal numbers of detectable CFU of the target genes by multiplex PCR were calculated based on correlation of the 1.0 McFarland standards to 3 × 108 CFU mL−1.

Results

We developed a hexaplex PCR for rapid detection of genes encoding for CZ-, QAC- and MET-resistance in staphylococci with simultaneous identification of PVL-positive and -negative S. aureus and CoNS. To do so, we targeted the 16S rRNA, nuc, pvl, czrC, qacA/B, mecA genes and performed optimization of PCR using individual primer pairs for amplification of all six genes using reference and control strains. The amplified fragment sizes of individual genes comprising 16S rRNA, czrC, pvl, nuc, mecA and qacA/B genes were of expected sizes of 756, 655, 505, 359, 264 and 192 bp (Fig. 1a). The optimization result of hexaplex-PCR was obtained using different concentrations of primers corresponding to targeted genes and other components of PCR that gave amplifications of 16S rRNA, nuc, mecA, pvl, czrC and qacA/B genes corresponding to phenotypic and genotypic characteristic of control strains, including MET-, CZ-, and QAC- sensitive and -resistant, PVL-positive and -negative S. aureus and CoNS in a single reaction tube producing distinct bands corresponding to respective fragment sizes (Fig. 1b). The sensitivity of multiplex PCR using positive control strains was found to be 3.5–7.0 × 105 cells per PCR, but the value varied slightly depending on the strain and specific gene corresponding to single PCR (data not shown). The control strains that were positive in multiplex PCR for 16S rRNA, nuc, mecA, pvl, czrC and qacA/B genes were also positive in the dot-blot assay and the strains negative for these genes were negative in dot-blot assay (Fig. S1). The specificity of genes encoding for 16S rRNA, nuc, mecA, pvl, czrC and qacA/B genes and obtained with reference strains was further confirmed by sequencing (data not shown).

Figure 1.

(a) Agarose gel electrophoresis of simplex products obtained with reference strains of Staphylococcus aureus and Staphylococcus epiderimidis and stained with ethidium bromide. Lane M, 100-bp DNA ladder (NEB); lane 1, S. aureus ATCC 43300 (16S rRNA+); lane 2, Staphylococcus epidermidis ATCC 12228 (czrC+); lane 3, S. aureus ATCC 25923 (pvl+); lane 4, S. aureus ATCC 43300 (nuc+); Lane 5, S. aureus ATCC 43300 (mecA+); lane 6, S. aureus Mu50 (qacA/B+). (b) Agarose gel electrophoresis of hexaplex PCR products obtained with reference and control strains of S. aureus and CoNS and stained with ethidium bromide. Lane M, 100-bp DNA ladder (NEB); lane 1, S. aureus ATCC 43300 (16S rRNA+, nuc+, mecA+); lane 2, S. aureus Mu50 (16S rRNA+, nuc+, mecA+, qacA/B+); lane 3, S. aureus ATCC 25923 (16S rRNA+, nuc+, pvl+); lane 4, S. aureus 1295 (16S rRNA+, nuc+, pvl+, mecA+); lane 5, S. epidermidis ATCC 12228 (16S rRNA+, czrC+); lane 6, S. epidermidis 1056 (16S rRNA+, mecA+, qacA/B+); lane 7, Staphylococcus haemolyticus ATCC 29970 (16S rRNA+); lane 8, S. haemolyticus 119 (16S rRNA+, mecA+, czrC+, qacA/B+); lane 9, S. haemolyticus 263 (16S rRNA+, mecA+, czrC+); lane 10, Staphylococcus saprophyticus ATCC 15305 (16S rRNA+); lane 11, Staphylococcus simulans ATCC 27851 (16S rRNA+, czrC+); lane 12, Staphylococcus warneri ATCC 49454 (16S rRNA+); lane 13, Staphylococcus gallinarum ATCC 700401 (16S rRNA+); lane 14, Staphylococcus sciuri ATCC 29060 (16S rRNA+); lane 15, Staphylococcus xylosus ATCC 29971 (16S rRNA+); lane 16, Staphylococcus lugdunensis ATCC 49576 (16S rRNA+); lane 17, Staphylococcus lentus ATCC 700403 (16S rRNA+); lane 18, Staphylococcus capitis 527 (16S rRNA+, mecA+); lane 19, Streptococcus pyogenes ATCC 19615; lane 20, Streptococcus pneumoniae and lane 21, Milli-Q.

Validation of hexaplex PCR was done using 177 well characterized strains comprising 55 strains each of S. aureus and CoNS isolated from infected eyes and five S. aureus and 62 CoNS isolated from healthy eyes (Table S1). We found that all of the 55 S. aureus strains isolated from infected eyes were positive by PCR for 16S rRNA and nuc genes, except for one strain that failed to amplify the nuc gene, 18 for pvl gene, four for mecA gene and none for czrC and qacA/B genes. Whereas all of the 55 CoNS strains were positive for the 16S rRNA gene, 29 for mecA gene, one for pvl gene, five for czrC gene and six for qacA/B gene, two CoNS strains, one each identified as Staphylococcus hominis and S. lentus, amplified a portion of nuc gene 359 bp in size (Table 2). Similarly, all five S. aureus strains from healthy eyes were positive using PCR for 16S rRNA, nuc genes and one for pvl gene but were negative for mecA, czrC and qacA/B genes. Whereas all of the 62 CoNS strains were positive using PCR for 16S rRNA gene, 28 for mecA gene, four for czrC gene, 13 for qacA/B gene and none for the pvl gene, three of the 62 CoNS strains, identified as S. hominis, amplified a portion of nuc gene as well (Table 2). Results of multiplex PCR obtained with representative strains of S. aureus and CoNS are shown in Fig. 2a and b. There was good correlation between the presence of mecA and czrC genes, but no correlation was found between the presence of mecA and qacA/B or czrC and qacA/B genes. Although there was good concordance between microbiological data and PCR results, five CoNS strains identified as S. hominis or S. lentus and isolated from infected and healthy eyes were positive using PCR for nuc gene, indicating that these isolates belong to S. aureus. Thus hexaplex PCR is specific, sensitive and accurate in detecting MET-, CZ- and QAC-resistant staphylococci and in identifying PVL-positive and -negative S. aureus and CoNS isolated from infected and healthy eyes.

Table 2. Genetic patterns of Staphylococcus aureus and coagulase negative staphylococci (CoNS) strains isolated from infected and healthy eyes
Genetic patternNo. of strains positive from infected eyesNo. of strains positive from healthy eyesStrains positive for gene(s) encoding for
pvl mecA czrC qacA/B nuc 16S rRNA
  1. PVL, Panton–Valentine leukocidin; MSSA, methicillin-sensitive S. aureus; MRSA, methicillin-resistant S. aureus; czrC, cadmium/zinc resistance gene; QacA/B, quaternary ammonium compounds; MSS, methicillin-sensitive staphylococci; MRS, methicillin-resistant staphylococci; +, presence of gene(s); −, absence of gene(s).

CoPS
PVL+, MSSA, czrC, qacA/B1501+++
PVL+, MRSA, czrC, qacA/B03Nil++++
PVL, MSSA, czrC, qacA/B3504++
PVL, MRSA, czrC, qacA/B01Nil+++
PVL, MSSA, czrC, qacA/B01Nil+
CoNS
PVL, MSS, czrC, qacA/B2128+
PVL, MSS, czrC+, qacA/B0101++
PVL, MRS, czrC, qacA/B2214++
PVL+, MSS, czrC, qacA/B01Nil+++
PVL, MSS, czrC, qacA/B0103++
PVL, MRS, czrC, qacA/B+0311+++
PVL, MSS, czrC, qacA/B+0202++
PVL, MRS, czrC+, qacA/B0303+++
PVL, MRS, czrC+, qacA/B+01Nil++++
Figure 2.

Agarose gel electrophoresis of hexaplex PCR products stained with ethidium bromide and obtained with staphylococcal strains isolated from infected and healthy eyes. (a) Infected eyes: Lane M, 100-bp DNA ladder (NEB); lane 1, Staphylococcus aureus 845 (16S rRNA+, nuc+, pvl+, mecA+); lane 2, S. aureus 1690 (16S rRNA+, nuc+, mecA+); lane 3, S. aureus 149 (16S rRNA+, nuc+, pvl+); lane 4, S. aureus 188 (16S rRNA+, nuc+); lane 5, Staphylococcus haemolyticus 119 (16S rRNA+, mecA+, czrC+, qacA/B+); lane 6, S. haemolyticus 263 (16S rRNA+, mecA+, czrC+); lane 7, Staphylococcus epidermidis 1056 (16S rRNA+, mecA+, qacA/B+); lane 8, S. haemolyticus 1752 (16S rRNA+, czrC+); lane 9, Staphylococcus warneri 1138 (16S rRNA+, qacA/B+); lane 10, S. epidermidis 108 (16S rRNA+, mecA+); lane 11, S. epidermidis 902 (16S rRNA+). (b) Healthy eyes: Lane M, 100-bp DNA ladder (NEB); lane 1, S. aureus N61OD (16S rRNA+, nuc+, pvl+); lane 2, S. aureus N9OD (16S rRNA+, nuc+); lane 3, S. epidermidis N3OD (16S rRNA+, mecA+, qacA/B+); lane 4, S. haemolyticus N28OS (16S rRNA+, mecA+, czrC+); lane 5, S. haemolyticus N57OD (16S rRNA+, czrC+); lane 6, S. epidermidis N16OD (16S rRNA+, mecA+); lane 7, S. epidermidis N1OD (16S rRNA+, qacA/B+); lane 8, S. haemolyticus N65OS (16S rRNA+).

Of the nine ocular samples, three were positive using PCR for 16S rRNA and nuc genes and one for pvl gene, indicating the presence of PVL-positive and -negative S. aureus. However, six ocular samples were positive using PCR for 16S rRNA, five for mecA, and four for qacA/B genes but failed to amplify nuc and pvl genes, indicating the presence of MET- and/or QAC-resistant and -sensitive CoNS (Fig. 3a). Of nine ocular samples, we were able to isolate and identify S. aureus from three samples and CoNS from the remaining six samples. When these three isolates of S. aureus were tested by multiplex PCR, all showed positive results using PCR for 16S rRNA, nuc genes and one for pvl gene, a finding similar to those obtained with direct enriched ocular samples. However, another six isolated CoNS strains showed positive results for 16S rRNA gene but only three were positive for mecA and one for qacA/B genes (Fig. 3b). These results indicate that although CoNS harboring the mecA and/or qacA/B genes was present in the ocular samples, strains with identical properties could not be isolated from these ocular samples, which were therefore missed during the isolation process. Therefore, this hexaplex PCR is useful in detecting MET-, CZ-, and QAC-sensitive and -resistant staphylococci and in identifying PVL-positive and -negative S. aureus and CoNS isolated from ocular infections. Further study of this PCR method with ocular samples is in progress.

Figure 3.

(a) Agarose gel electrophoresis of hexaplex PCR products obtained with direct ocular samples (enriched culture) from infected eyes and stained with ethidium bromide. Lane M, 100-bp DNA ladder (NEB); lane 1, sample I (16S rRNA+, mecA+, qacA/B+); lane 2, sample II (16S rRNA+, nuc+); lane 3, sample III (16S rRNA+, mecA+); lane 4, sample IV (16S rRNA+); lane 5, sample V (16S rRNA+, nuc+, pvl+); lane 6, sample IV (16S rRNA+, mecA+, qacA/B+); lane 7, sample VII (16S rRNA+, nuc+); lane 8, sample VIII (16S rRNA+, mecA+, qacA/B+); lane 9, sample IX (16S rRNA+, mecA+, qacA/B+). (b) Agarose gel electrophoresis of hexaplex PCR products obtained with identified Staphylococcus aureus and CoNS strains isolated from ocular samples and stained with ethidium bromide. Lane M, 100-bp DNA ladder (NEB); lane 1, Staphylococcus epidermidis from sample I (16S rRNA+, mecA+); lane 2, S. aureus from sample II (16S rRNA+, nuc+); lane 3, unidentified strain from sample III (16S rRNA+, mecA+); lane 4, S. epidermidis from sample IV (16S rRNA+); lane 5, S. aureus from sample V (16S rRNA+, nuc+, pvl+); lane 6, Staphylococcus haemolyticus from sample VI (16S rRNA+, mecA+, qacA/B+); lane 7, S. aureus from sample VII (16S rRNA+, nuc+); lane 8, S. epidermidis from sample VIII (16S rRNA+); lane 9, Staphylococcus simulans from sample IX (16S rRNA+).

Discussion

Several multiplex PCR were used to detect pvl-, mecA- and/or mupirocin-resistant genes in staphylococci (Zhang et al., 2004, 2008; McClure et al., 2006). Whereas the conserved 16S rRNA gene primer specific for staphylococci was used to differentiate Staphylococcus genus from other bacteria, the nucleotide sequences of nuc gene specific to S. aureus was used to identify S. aureus (Brakstad et al., 1992; Zhang et al., 2004, 2008; Sasaki et al., 2010). Similarly, the presence of czrC gene in SCCmec encoding for cadmium and zinc resistance (CZR) and antiseptic resistance genes qacA/B conferring resistance to quaternary ammonium compound was also determined by PCR in S. aureus strains (Noguchi et al., 2005; Aarestrup et al., 2009; Cavaco et al., 2010; Ho & Branley, 2012).

We exploited the developed multiplex PCR for rapid detection of MET-, CZ-, QAC- resistance genes, and PVL-positive and -negative staphylococci isolated from ocular infection. Similar to other workers, we were able to identify S. aureus strains and differentiate them from CoNS, based on amplification of nuc and 16S rRNA genes (Brakstad et al., 1992; Zhang et al., 2004, 2008; Sasaki et al., 2010). However, two strains misidentified as CoNS because of showing a low score of ID 32 STAPH strip in atbnew V.1.0.0 software on an ATB™ reader, were correctly identified as S. aureus, as these strains amplify staph-specific nuc gene in multiplex PCR assay. Similarly, one strain misidentified as S. aureus which had shown low score of ID 32 STAPH strip in atbnew v.1.0.0 software on ATB™ reader was identified as CoNS, as this strain failed to amplify staph-specific nuc gene, indicating the usefulness of multiplex PCR in the correct identification of staphylococci. The majority of MRSA and methicillin resistance CoNS strains showed positive results for mecA gene in multiplex PCR; however, few strains failed to produce mecA amplicon. The absence of mecA gene may be explained either by the presence of variant of mecA gene or by the overproduction of penicillinases or alteration of other penicillin-binding proteins (Caierao et al., 2004). Several workers reported that MRSA have similar spectrum of ocular pathology to that of MSSA (Blomquist, 2006; Chuang et al., 2012). The results of this study also indicate that there is no correlation between isolation of MRSA and MSSA and methicillin-resistant and -sensitive CoNS from ocular infection. This finding was further substantiated by the fact that both MRSA and MSSA and methicillin-resistant and -sensitive CoNS were isolated from healthy individuals (Kar et al., 2013). PVL-positive strains were differentiated from PVL-negative strains on the basis of the presence or absence of pvl gene. When we examined the presence of PVL in S. aureus strains in ocular isolates, we did not find any definite correlation between presence of PVL gene and eye infection. This finding is similar to reports that PVL plays an inconsistent role in the pathogenesis and immunity of S. aureus (Zaidi et al., 2013).

Although quaternary ammonium compound is often used in hospital as disinfectant and for treating ocular infection, and zinc and cadmium compound as an additive in animal feed, there is a good chance of developing resistance against these compounds. While analyzing the multiplex PCR data, we found the presence of czrC and qacA/B genes in a few isolates of CoNS, particularly in S. haemolyticus and S. epidermidis, in ocular isolates. These findings are similar to those workers who reported the presence of czrC gene in staphylococci, albeit in animal isolates (Aarestrup et al., 2009; Cavaco et al., 2010). To our knowledge, this is the first report depicting the presence of czrC in human isolates and in staphylococci other than S. aureus. The development of resistance to CZ and QAC in ocular isolates is alarming; therefore, we suggest the need to monitor constantly the presence of these resistance genes in S. aureus and CoNS in ocular isolates. These observations further indicate that CoNS can serve as a reservoir for both CZ- and QAC- resistance genes.

From this study, it is concluded that staphylococcal strains belonging to S. aureus can be readily identified and the presence of PVL and MET, CZR and QAC genes determined in the one-step PCR, a method that can be used for rapid detection of antibiotic, cadmium/zinc and antiseptic resistance in PVL-positive and -negative S. aureus and CoNS. This method provides a valuable procedure for the detection of mecA, czrC, qacA/B genes and for identification of PVL-positive and -negative S. aureus and CoNS from a variety of ocular samples.

Acknowledgements

The study was supported partly by Department of Science and Technology, New Delhi grant no. SR/SO/HS-117 to S.S. and D.V.S., and DST-WOS-A grant no. SR/WOS-A/208/2009 to R.C., and a fund contributed by the Department of Biotechnology, New Delhi, to the Institute of Life Sciences, Bhubaneswar. S.P. is grateful to the Institute of Life Sciences for providing a Research Fellowship. S.K. is grateful to the Council of Scientific and Industrial Research, New Delhi, for providing a Senior Research Fellowship. The funders had no role in the study design, data collection, and analysis, decision to publish or preparation of the manuscript. Part of this work was presented in a poster presentation entitled ‘Hexaplex PCR assay for detection of Staphylococcus aureus, mecA, czrC, qacA/B and pvl genes with simultaneous discrimination from coagulase negative staphylococci’ during the 9th Convention of Biotech Research Society (India) at Patiala, India, 21–23 November 2012.

Ancillary