DsbM affects aminoglycoside resistance in Pseudomonas aeruginosa by the reduction of OxyR

Authors


Abstract

DsbM is a novel disulfide oxidoreductase that affects aminoglycoside resistance in Pseudomonas aeruginosa by an OxyR-regulated process. However, the detailed mechanism of interaction between DsbM and OxyR had not yet been elucidated. In this study, we expressed DsbM in Escherichia coli and showed that DsbM can oxidize and reduce disulfide. We also used a yeast two-hybrid assay to identify interactions between DsbM and OxyR. A subsequent GSH oxidation experiment revealed that DsbM could alter both the oxidized and reduced state of OxyR. We hypothesized that OxyR can be reduced by DsbM, and thus DsbM may be required for aminoglycoside resistance in P. aeruginosa. Our findings contribute to the understanding of the mechanisms underlying aminoglycoside resistance in P. aeruginosa.

Introduction

Pseudomonas aeruginosa is a common, opportunistic Gram-negative pathogen that often causes serious infections in susceptible populations, such as hospital patients (Hatano & Pier, 1998; Carmel-Harel & Storz, 2000). It has been reported that the incidence of clinical multidrug-resistant P. aeruginosa infections has been climbing steadily year after year (Chang et al., 2005; Lee et al., 2006). This trend complicates the treatment of P. aeruginosa infections and limits the use of currently available antibiotics (Lau et al., 2005). The mechanisms of antibiotic resistance in P. aeruginosa are complex, and the emergence of multidrug-resistant strains has been characterized by the interaction of different antibiotic resistance activities (Mathee et al., 2008). Investigation into the fundamentals of antibiotic resistance is progressing and plays a significant role in the development of clinic therapies (Wang et al., 2012b).

M122 is a streptomycin-resistant strain derived from P. aeruginosa PA68 by Mu transposon mutagenesis that has been used in previous experiments on aminoglycoside resistance. Previous studies in our lab have shown that mutation of dsbM, which encodes a 234-residue protein, contributed to the resistance of M122 to several different aminoglycosides. The DsbM protein can both oxidize and reduce disulfide and is considered to be a novel disulfide oxidoreductase (Wang et al., 2012b). In addition, Wang et al. (2012a) reported that the minimum inhibitory concentration (MIC) of streptomycin in the dsbM gene knockout strain ΔdsbM-PAK (64 μg mL−1) was fourfold higher than that of the standard strain PAK (16 μg mL−1). Hence, we hypothesized that the increased aminoglycoside resistance of the M122 strain is caused by dsbM inactivation.

The oxyR regulon is regulated by OxyR, a 34-kDa transcriptional activator (Zheng et al., 1998). The OxyR tetramer protein has two states, oxidized and reduced. Oxidized OxyR can activate the transcription of genes from the oxyR regulon, while reduced OxyR represses this transcriptional pathway (Hassett et al., 2000). In P. aeruginosa, the expression of several oxidative stress defense genes regulated by OxyR, including katB-ankB, ahpB and ahpCF, increased dramatically upon exposure to H2O2 or other redox-cycling agent paraquat (Ochsner et al., 2000). Microarray analysis has revealed that disruption of dsbM upregulated the expression of several antioxidases in the strain M122, including KatB (catalase), AhpB, and AhpCF (alkyl hydroperoxide reductase), all of which are part of the oxyR regulon (Wang et al., 2012b). With this in mind, we hypothesized that the interaction between DsbM and OxyR could affect aminoglycoside resistance in P. aeruginosa, and the objective of this study was to identify and characterize this protein–protein interaction.

Materials and methods

Construction of yeast two-hybrid plasmids

The full-length P. aeruginosa oxyR and dsbM genes were amplified from PAOI genomic DNA using PCR. The following primers, containing either EcoR I or Nde I restriction sites at their 5′ end, were used:

oxyRBD-F: 5′GGAATTCCATATGCGACTGCCCACCACCCCTT3′

oxyRBD-R: 5′GGCGAATTCCGGTGCTTGCAGGTTACCG3′

dsbMAD-F: 5GGAATTCCATATGAACGACCTCACCCTT3′

dsbMAD-R: 5′GGCGAATTCTTATCAGGCGACGTCGAT3′

Samples were denatured for 5 min at 95 °C and then amplified in 30 cycles of 95 °C for 30 s, 60 °C for 1 min, and 72 °C for 45 s. The PCR products were gel purified using an Agarose Gel DNA Fragment Recovery Kit Ver.2.0 (TaKaRa, Japan). A-tailed PCR products were then ligated into the cloning vector pGEM-T using T4 ligase (Fermentas, Lithuania) and a pGEM-T Cloning Kit (Transgen, China). The oxyR and dsbM-containing fragments were cleaved from pGEM-T using Nde I and EcoR I and then ligated into the vectors pGBKT7 (BD) and pGADT7 (AD), respectively. Recombinant plasmids were digested with the appropriate restriction enzymes for 1 h and then separated with agarose gel electrophoresis for size selection.

Transformation of yeast with plasmids

Plasmids were transformed into the competent Saccharomyces cerevisiae strain AH109 using an adapted lithium acetate (LiAc)/single-stranded DNA/polyethylene glycol (PEG) method (Philip et al., 2012). The transformed plasmids were in either Group 1 (pGBKT7-oxyR and pGADT7-dsbM) or Group 2 (pGBKT7-dsbM and pGADT7-oxyR). Cells were then incubated at 30 °C for 1 h with gentle shaking, and the strains carrying different plasmid combinations were grown on SD agar plates lacking Leu and Trp at 30 °C for 72 h. Healthy colonies were then transferred onto SD agar plates lacking Trp, Leu, His, and Ade and incubated at 30 °C for 2–3 days. These colonies were subjected to the LacZ freeze-fracture assay (Bai et al., 2008).

Yeast two-hybrid screens

A modified version of the LacZ freeze-fracture assay was used to detect β-galactosidase activity (Hou et al., 2009). Colonies were transferred to a 60 × 60 mm, pretreated Whatman filter, submerged in liquid nitrogen for 15 s and then incubated at room temperature for 10 min. This filter was placed on another clean 60 × 60 mm Whatman filter that was presoaked in Z buffer with 5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside (X-gal) solution. Then filters were incubated at 30 °C in the dark for 1–4 h until blue colonies appeared (Bai et al., 2008). A strain containing pGBKT7-53 (BD fusion of p53) and pGADT7-T (AD fusion of large T antigen) was used as the positive control, and a strain containing pGADT7-T and pGBKT7-lam (BD fusion of nuclear lamin) was used as the negative control (Matsuda et al., 2003).

β-galactosidase activity assay

Colonies from SD agar plates lacking Trp, Leu, His, and Ade were picked and cultured overnight in 5 mL of appropriate SD media at 30 °C with shaking at 230 r.p.m. Then 4 mL of subcultures were added to 16 mL of YPDA media, incubated for 3–5 h at 30 °C, and shaken at 230 r.p.m. When the OD600 nm value reached c. 0.6, cells were collected from 1.5 mL of media by centrifugation at 8000 g for 30 s, and the pellet was washed in 1.5 mL of Z buffer (60 mM Na2HPO4, 40 mM NaH2PO4, 10 mM KC1, and 1 mM MgSO4 pH 7.0) and resuspended in 300 μL of Z Buffer. The cell suspension (100 μL) was transferred to a 1.5-mL tube and freeze-thawed with liquid nitrogen three times. A fresh 1.5-mL tube with 100 μL Z buffer was used as a negative control. Seven hundred microliters of Z buffer with 0.27% (v/v) β-mercaptoethanol and 160 μL of 4 mg mL−1 o-nitrophenyl-β-D-galactopyranoside was added to each tube to initiate the reaction (Bai et al., 2008), which was then incubated in a 30 °C water bath. When the solution turned yellow, sodium carbonate (400 μL, 1 M) was added to stop the reaction. Both the starting and stopping times were recorded. The tubes were spun at 8000 g for 10 min, and the OD420 nm values of the supernatant were measured. Each sample was measured in triplicate, and the β-galactosidase activation units were calculated using the following equation:

display math

where t indicates the reaction time (min), and v indicates 0.1 mL × a concentration factor or 0.1 × 5 = 0.5

Construction of the pET28a-oxyR expression plasmid

The oxyR gene was amplified directly from the PAOI gene of P. aeruginosa using PCR and the following primers:

oxyREx-F (Nde I): 5′GGAATTCCATATGACCCTCACCGAACTGCG3′

oxyREx-R (EcoR I): 5′CCGGAATTCTCATGCTATTTGCGGTTGTT3′

PCR amplification was performed by incubation for 30 cycles at 95 °C for 15 s, 58 °C for 30 s, and 72 °C for 45 s. Purified products were processed (Perner et al., 2013) and ligated into the pET28a expression vector to create the recombinant plasmid pET28a-oxyR. This plasmid was then transformed into the Escherichia coli strain BL21 (DE3) for OxyR protein expression.

Expression and purification of the OxyR and DsbM proteins

Expression strains were stored in LB media with 20% glycerin at −80 °C, cultured in 20 mL LB media containing 50 μg mL−1 kanamycin at 37 °C overnight, added to 1 L of LB medium and then cultured at 37 °C to an optical absorbance of 0.4–0.6 at 600 nm. Subsequently, protein expression was induced with 1 mM Isopropyl β-D-1-thiogalactopyranoside (IPTG) and incubation for 4 h. The cells were harvested by centrifugation at 4 °C and 5000 g for 10 min, and pellets were washed with binding buffer (50 mM imidazole, 500 mM NaCl and 50 mM Tris-HCl pH = 7.9). The cells were harvested again by centrifugation and resuspended in the same buffer, sonicated three times on ice for 10 min each, and spun down at 10 000 g for 20 min (Kurukawa et al., 2000). The supernatant was loaded onto equilibrated Ni-nitrilotriacetic acid resin and incubated at room temperature for 10 min. The protein-bound resin was washed twice with washing buffer (20 mM imidazole, 500 mM NaCl and 20 mM Tris-HCl pH = 7.9) and gravity flow until no protein could be detected in the flow through. The protein was eluted with 10 mL of elution buffer (200 mM imidazole, 500 mM NaCl and 20 mM Tris-HCl pH = 7.9), dialyzed against Milli-Q water, and freeze-dried.

The reduction of OxyR by DsbM

The reduction reaction was performed in a mixture of 2-nitro-5-thiobenzoic acid (DTNB) standard solution (1 mL DTNB, 19 mL Tris buffer) (Sun et al., 2001). Different concentrations of OxyR protein were incubated with 2.5 mM GSH and different concentrations of DsbM protein at room temperature for more than 30 min. DTNB standard solution was then added to the reaction. Changes in A412 nm were read and recorded. Every sample was measured in five parallel reactions, and the means were calculated.

Results and discussion

Some genes downstream of dsbM are contained in the same operon as dsbM, including osmC, various aminoglycoside-modifying enzyme genes and genes from the MexXY/OprM active efflux system (Shan et al., 2004). In our preliminary research, we found that expression changes in the genes downstream of dsbM did not affect the high aminoglycoside resistance of M122. In addition, a series of antioxidant defense genes were over expressed in M122, some of which are part of the oxyR regulon (Wang et al., 2012b). These results suggest that there may be an interaction between DsbM and OxyR. To probe the mechanism of interaction between DsbM and OxyR, we constructed four recombinant plasmids, pGADT7-dsbM, pGADT7-oxyR, pGBKT7-dsbM, and pGBKT7-oxyR. Our yeast two-hybrid experiments demonstrated that an interaction between DsbM and OxyR could occur in the cell. We transformed the plasmids pGADT7-dsbM and pGBKT7-oxyR separately into AH109 to confirm that neither the dsbM nor oxyR plasmid could activate the two-hybrid system by itself.

As is shown in Table 1, there was no auto-activation in yeast cells transformed with a plasmid carrying only the oxyR or dsbM genes. As a negative control, reporter genes were not expressed when the plasmids pGBKT7-lam+ and pGADT7-T were transformed into cells as these cells could neither grow on His+ plates nor form blue-pigmented colonies in the presence of X-gal. In the positive control group (pGBKT7-53/pGADT7-T), yeast cells containing both pGBKT7-dsbM and pGADT7-oxyR and cells containing both pGBKT7-oxyR and pGADT7-dsbM grew normally on SD/-Trp/-Leu/-His/-Ade plates and formed blue colonies on plates containing X-gal (Fig. 1), demonstrating a direct interaction between OxyR and DsbM.

Table 1. Test of transformed yeast for His+ phenotype and β-galactosidase activity
Transformation of yeast with plasmidsHis+ phenotypeβ-galactosidase activity assay
Color reactionβ-galactosidase activity unit n a
  1. +, grow nornally on SD/-Trp/-Leu/-His/-Ade plate; −, cannot grow on SD/-Trp/-Leu/-His/-Ade plate; blue, with β-galactosidase activity; white, without β-galactosidase activity; NT, not tested.

  2. a

    n, number of independent assays performed.

  3. b

    Standard deviations.

pGADT7-dsbMWhiteNT 
pGADT7-oxyRWhiteNT 
pGBKT7-dsbMWhiteNT 
pGBKT7-oxyRWhiteNT 
pGADT7-dsbM + pGBKT7-oxyR+Blue6.1 ± 0.12b5
pGADT7-oxyR + pGBKT7-dsbM+Blue6.3 ± 0.17b5
pGADT7-+ pGBKT7-53+Blue9.8 + 0.03b5
pGADT7-+ pGBKT7-lamWhite0.05 ± 0.03b5
Figure 1.

β-galactosidase activities detected by filter assay. (a) pGADT7-dsbM + pGBKT7-oxyR; (b) pGBKT7-dsbM + pGADT7-oxyR; (c) pGADT7-+ pGBKT7-53; (d) pGADT7-+ pGBKT7-lam.

To further assess the interaction strength between OxyR and DsbM, we performed liquid culture assays to measure β-galactosidase activity. As shown in Table 1, yeast cells containing both pGBKT7-dsbM and pGADT7-oxyR and those with both pGBKT7-oxyR and pGADT7-dsbM produced the level of β- galactosidase activity similar to the positive control. This level was c. 3.5 units lower than in the positive control group.

Oxidized OxyR was reduced by a reaction with glutathione (GSH). This reaction is catalyzed by glutaredoxin 1 and can stop the antioxidant stress response (Tao, 1997; Hoshino et al., 2002). Due to a similar reaction that occurs between DsbM and OxyR, we assumed that DsbM reduces OxyR in P. aeruginosa in a fashion similar to the action of glutaredoxin 1 in E. coli (Fig. 2). As has been reported previously, P. aeruginosa does not grow normally with a deletion of the oxyR gene. Therefore, we designed a redox experiment in vitro with DsbM and OxyR protein expressed in E. coli and purified using Ni-NTA resin (Fig. 3).

Figure 2.

Model for OxyR activation and deactivation. Upon exposure to hydrogen peroxide, the Cys199 residue of OxyR is first oxidized to a sulfenic acid. This intermediate then reacts with Cys208 to form a stable disulfide bond that locks OxyR into an activated form. Oxidized OxyR is then subjected to disulfide bond reduction by DsbM. In Pseudomonas aeruginosa, oxidized OxyR activates the transcription of katB-ankB, ahpB, and ahpC-ahpF, while reduced OxyR deactivates the transcription of these genes. This response is autoregulated.

Figure 3.

The result of expression and purification.(a) Expression and purification of OxyR protein, 1, supernatant; 2, inclusion body; 3, binding buffer, 4–6. OxyR protein (34 KDa); (b) purification of DsbM protein, 1–2. DsbM protein (26 KDa).

GSH also acts on 2-nitro-5-thiobenzoic acid (DTNB) in a reaction that produced a yellow substance called 2-nitro-5-thiobenzoic acid, which absorbs at 412 nm (Rahman et al., 2007). We used the following reaction to confirm the reductive effect of DsbM on oxidized OxyR:

display math(1)
display math(2)

The results from this experiment are shown in Table 2. Changes in A412 nm with different concentrations of DsbM and consistent concentrations of GSH and OxyR are shown in Table 3. Table 3 indicated that the level of DTNB decreased with increasing levels of DsbM. We concluded that OxyR is converted into a reduced form when properly regulated by DsbM. Therefore, the OxyR protein remains oxidized in the absence of DsbM, which causes overexpression of the antioxidant genes regulated by OxyR and thus a high level of aminoglycoside resistance in M122.

Table 2. The OD412 nm values of different reaction systems
The reaction systemsOD412 nm after adding DTNB n a
  1. a

    n, number of independent assays performed.

  2. b

    Standard deviations.

GSH(2.5 mM) + OxyR(0) + DsbM(0)0.942 ± 0.014b5
GSH(2.5 mM) + OxyR(0) + DsbM(5 μM)0.925 ± 0.020b5
GSH(2.5 mM) + OxyR(5 μM) + DsbM (0)0.882 ± 0.018b5
GSH(2.5 mM) + OxyR(5 μM) + DsbM (5 μM)0.418 ± 0.037b5
Table 3. A412 nm alter in different DsbM concentration
DsbM protein concentrationA412 nm n a
  1. a

    n, number of independent assays performed.

5 μM0.418 ± 0.0375
4 μM0.493 ± 0.0255
2 μM0.657 ± 0.0215
1 μM0.742 ± 0.0185
0.5 μM0.811 ± 0.0245
00.876 ± 0.0225
Deactivated protein0.887 ± 0.0295

Notably, resistance to streptomycin, neomycin, spectinomycin, and gentamicin in M122 was 16, 2, 168, and 4 times higher, respectively, than has been observed for the strain PA68. Resistance to streptomycin in the dsbM gene knockout strain ΔdsbM -PAK was 4 times higher than in the standard PAK strain (Wang et al., 2012a). Microarray analysis has shown that the expression levels of several oxidative stress defense genes regulated by OxyR, including katB, ahpB and ahpCF, were remarkably upregulated in the strain M122 (Wang et al., 2012b). These data suggest that different types of aminoglycoside resistance might be affected by different oxidative stress defense genes, which are regulated by OxyR in P. aeruginosa. In conclusion, our findings have an important implication for our understanding of the aminoglycoside resistance mechanism in clinical strains of P. aeruginosa, and these observations may merit further study in the future.

Acknowledgement

This work was supported in part by The National Natural Science Foundation of China (No. 30570089).

Ancillary