SEARCH

SEARCH BY CITATION

Keywords:

  • anaerobic;
  • biodegradation;
  • Dehalococcodia ;
  • Dehalococcoidiales ;
  • Dehalococcoidaceae

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References
  9. Supporting Information

The genome sequence of the organohalide-respiring bacterium Dehalogenimonas lykanthroporepellensBL-DC-9T contains numerous loci annotated as reductive dehalogenase homologous (rdh) genes based on inferred protein sequence identity with functional dehalogenases of other bacterial species. Many of these genes are truncated, lack adjacent regulatory elements, or lack cognate genes coding for membrane-anchoring proteins typical of the functionally characterized active reductive dehalogenases of organohalide-respiring bacteria. To investigate the expression patterns of the rdh genes in D. lykanthroporepellensBL-DC-9T, oligonucleotide primers were designed to uniquely target 25 rdh genes present in the genome as well as four putative regulatory genes. RNA extracts from cultures of strain BL-DC-9T actively dechlorinating three different electron acceptors, 1,2-dichloroethane, 1,2-dichloropropane, and 1,2,3-trichloropropane were reverse-transcribed and subjected to PCR amplification using rdh-specific primers. Nineteen rdh gene transcripts, including 13 full-length rdhA genes, six truncated rdhA genes, and five rdhA genes having cognate rdhB genes were consistently detected during the dechlorination of all three of the polychlorinated alkanes tested. Transcripts from all four of the putative regulatory genes were also consistently detected. Results reported here expand the diversity of bacteria known to simultaneously transcribe multiple rdh genes and provide insights into the transcription factors associated with rdh gene expression.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References
  9. Supporting Information

The species Dehalogenimonas lykanthroporepellens has the unique ability to reductively dehalogenate a variety of vicinally chlorinated aliphatic alkanes including 1,2-dichloroethane (1,2-DCA), 1,2-dichloropropane (1,2-DCP), 1,1,2,2-tetrachloroethane (1,1,2,2-TeCA), 1,1,2-trichloroethane (1,1,2-TCA), and 1,2,3-trichloropropane (1,2,3-TCP) via dihaloelimination reactions (Moe et al., 2009; Yan et al., 2009). The genome sequence of D. lykanthroporepellens BL-DC-9T (GenBank accession no. CP002084) contains 25 loci having reductive dehalogenase homologous (rdh) genes scattered throughout the chromosome (Siddaramappa et al., 2012).

For genera other than Dehalogenimonas (for which only one functional enzyme has yet been characterized) (Padilla-Crespo et al., 2014), the genes encoding enzymes characterized to date that are involved in catalyzing the anaerobic reductive dehalogenation of chlorinated solvents are organized in rdhAB operons encoding two components: a 50–65 kDa protein (RdhA) that functions as a reductive dehalogenase and a c. 10 kDa hydrophobic protein with transmembrane helices (RdhB) that is thought to anchor the RdhA to the cytoplasmic membrane (Magnuson et al., 2000; Maillard et al., 2003; Smidt & de Vos, 2004; Futagami et al., 2008). Genera sharing this feature include Dehalobacter, Dehalococcoides, Desulfitobacterium, and Sulfurospirillum (Miller et al., 1998; Neumann et al., 1998; Magnuson et al., 2000; Suyama et al., 2002; Maillard et al., 2003; Krajmalnik-Brown et al., 2004; Müller et al., 2004; He et al., 2005). Previously characterized RdhA proteins also contain a twin-arginine motif near the N-terminus that is thought to be associated with the twin-arginine translocation (TAT) system, a specialized system involved in the secretion of folded proteins across the bacterial inner membrane into the periplasmic space (Stanley et al., 2000). Two conserved motifs each containing four cysteine residues, a feature associated with binding iron–sulfur clusters (Bruschi & Guerlesquin, 1988) have also been reported to occur near the C-terminus of previously characterized RdhA proteins (Magnuson et al., 2000; Maillard et al., 2003; Hug et al., 2013).

If a ‘full-length’ rdhA is predicted to encode a protein containing a twin-arginine sequence in the N-terminus, two iron–sulfur cluster binding motifs in the C-terminus, and an intervening sequence of c. 450–500 amino acids, then D. lykanthroporepellens BL-DC-9T contains 17 such genes (Siddaramappa et al., 2012). Eight other rdhA genes in the genome appear to be substantially truncated and are predicted to encode proteins lacking the N-terminus, C-terminus, or both (Supporting Information, Table S1). Only six of the rdhA open reading frames (ORFs) have a cognate rdhB, and an additional rdhB gene (Dehly_1504) appears to be an orphan with no cognate rdhA ORF nearby (Siddaramappa et al., 2012). All of the rdhB code for proteins predicted to contain two or three transmembrane helices (Table S2), consistent with observations for putative dehalogenase membrane-anchoring proteins in Dehalococcoides mccartyi strains (Kube et al., 2005; Seshadri et al., 2005; McMurdie et al., 2009; Padilla-Crespo et al., 2014).

A majority of rdh genes in Dehalococcoides strains are associated with MarR or two-component system transcriptional regulators. For example, Dehalococcoides mccartyi 195T has transcriptional regulators for 17 of the rdh genes present in its genome, while Dehalococcoides strain CBDB1 has transcriptional regulators for all 32 of its rdh genes (Kube et al., 2005; Seshadri et al., 2005). In contrast, in the genome sequence of D. lykanthroporepellens BL-DC-9T, such transcriptional regulators are associated with only a small minority of the 25 rdhA genes (Table S3).

The broad goal of experiments presented in this paper was to determine which of the rdh genes are expressed by D. lykanthroporepellens BL-DC-9T during the anaerobic reductive dechlorination of different compounds and investigate genes which may regulate their expression. Oligonucleotide primers were designed, and PCR protocols that allow PCR amplification of all 25 rdhA genes (Table S1) and four transcription factors (Table S3) were developed. Subsequently, the PCR primers and protocols were employed in conjunction with reverse transcriptase PCR (RT-PCR) to determine which genes were expressed during growth of BL-DC-9T with the chlorinated solvents 1,2-DCA, 1,2-DCP, and 1,2,3-TCP.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References
  9. Supporting Information

Primer design and PCR protocols

Oligonucleotide primers specific for the rdhA and rdhB genes of D. lykanthroporepellens BL-DC-9T were designed using a combination of the primer3 software package (Rozen & Skaletsky, 2000) and manual selection after alignment of all rdh genes in the genome using the bioedit 7.05.3 software package (Hall, 1999). The primer3 software enabled the screening of hairpin loops and primer dimers during primer design. For the six rdhA genes with cognate rdhB genes, primers were selected to span the two genes (i.e. forward primer targeting location in rdhA and reverse primer binding site in rdhB). Primers were likewise designed for the amplification of four regulatory genes.

Primers were tested using genomic DNA of D. lykanthroporepellens BL-DC-9T (= JCM 15061T = ATCC BAA-1523T), extracted using an UltraClean Microbial DNA isolation kit (MoBio Laboratories, CA), as template in PCRs. PCR was carried out in 25 μL reaction volumes using 10 ng of genomic DNA (as quantified by NanoDrop 2000 spectrophotometer, Thermo Fisher Scientific), 0.4 mM dNTPs, 1 U Platinum Taq polymerase (Invitrogen), and 0.4 μM of forward and reverse primers. Amplifications were carried out with initial denaturation at 95 °C for 2 min, thirty cycles consisting of 95 °C for 15 s, primer-specific annealing temperature for 30 s (Tables 1 and 2), and extension at 68 °C for 60 s. A final extension was carried out at 68 °C for 5 min.

Table 1. Primers and annealing temperatures used for the detection of rdh gene expression
Target locus tagTarget Gene IDPrimer IDPrimer sequence(5′–3′)Expected product size (bp)Annealing temperature (°C)
Dehly_00689389745Dehly_0068FTCATGAAAGTCCTCGGCCTG43455
Dehly_0068RCTCTTCCTTGGTACCTTCCC
Dehly_00699389746Dehly_0069RTAGCCGAGGGTGCGGACGAA36060
Dehly_0069FTATCCCCCGCTGGAACGGCA
Dehly_007575099Dehly_0075RGCGTAGTAGCCGAGGGAAGT27058
Dehly_0075FCCATGAGGACACCACCGTGAAG
Dehly_01219389797Dehly_0121FGACCGGCGCAGACAGTTGCT46260
Dehly_0121RGACGGCATCATACCGCCCGG
Dehly_0156-Dehly_01579389835, 9389836Dehly_0156FACTGTGCCGGTTGTCAGGCG50365
Dehly_0157RAGCCGAAGAGGCCCAGCAGA
Dehly_02749389954Dehly_0274FGGCCGAACGCTCCATGGGAT34563
Dehly_0274RCCATGCCGAAACCACCCGGA
Dehly_0275-Dehly_02769389955, 9389956Dehly_0275FTCCACATTGCCCGGTTTGCCA41960
Dehly_0275RAGTCCCGCCGTTGGCTCATA
Dehly_02839389963Dehly_0283RGTCGCACTCCACCTTGGTAA43860
Dehly_0283FACTTGGATTGTCTGGGGCAG
Dehly_0479447957Dehly_0479FTCGCCCAAGGGGGACTGGAA41055
Dehly_0479RACGCCTACGTCCCTGGCTCC
Dehly_08499390556Dehly_0849FATACCAGGCGGTCGGCCAGT37260
Dehly_0849RCCTGAGGTGCAGGCGTTGGG
Dehly_09109390618Dehly_0910RCGGCATCAAGCACTGGCCCA24463
Dehly_0910FATCCCGGTTCCACCAGGCCA
Dehly_1053-Dehly_10549390762, 9390763Dehly_1053FACGACCCCACCTGGGACACC60867
Dehly_1053RCCAACCGGAAACGGCCAGCA
Dehly_11489390857Dehly_1148FGGCACTTTGGCGGGTCGGAA55160
Dehly_1148RGGCGTCCTCGGTGCTGATCG
Dehly_1151-Dehly_11529390860, 9390861Dehly_1152FTTGCCCGCATTGTCCGCAGT34965
Dehly_1152RGGCGCCCATCAGCCATTCGT
Dehly_13289391042Dehly_1328FCCAACCACCGAAGTTGACTGG34760
Dehly_1328RGCCCCATAAAAGCGTGCGGC
Dehly_13559391069Dehly_1355FGGGATGGCAGTCAACCCGGC46460
Dehly_1355RAACGCCGCCCGAATCATCCG
Dehly_15149391237Dehly_1514FAGCCGGACTAGGTGCAGCCT31058
Dehly_1514RTGCGGTACGGCCGCCAAATT
Dehly_15209391243Dehly_1520FTGGACCAGATGTTGAGTGCATCGG21768
Dehly_1520RTGCAGAATGCCATTTGTTTCGCGG
Dehly_15239391246Dehly_1523FTGCCACGCTGGGAAGGCAAG89268
Dehly_152 RTCCGGCAGGTCGATGTCCCA
Dehly_1524-Dehly_15259391247, 9391248Dehly_1524FTGGCACCAGTACCTGCCCGCTAT16858
Dehly_1524RGACAACGCCAGGCTGAGATTCTGC
Dehly_15309391253Dehly_1530FAGTTGCCCAAGCGGCAAGGG19660
Dehly_1530RATCCACCGCTTCTGCGCCAC
Dehly_1533-Dehly_15349391256, 9391257Dehly_1533FATGGGGTGTTACCCCGCGT67765
Dehly_1533RGCCGATGGTGGTGGCGGCTGTTT
Dehly_15409391263Dehly_1540FTTGTGGGCGCTGGTAACGCT38750
Dehly_1540RCCACGCGGACGATAGTGCCG
Dehly_15419391264Dehly_1541FTTCATGAAAGGGCTTGGGCTTGCC11550
Dehly_1541RTCACACGGTAGTTCGTTTCCGG
Dehly_15829391305Dehly_1582RAGTTGACGTACCAGCCCTTG43755
Dehly_1582FGGATGACAGCTATCCCGGTG
Table 2. Primers and annealing temperature used for study of transcription factor gene expression
Target locus tagPrimer IDPrimer sequence(5′–3′)Expected product size (bp)Annealing temperature (°C)
Dehly_0120Dehly_0120FGTCATGCGGATGTTTCCGTG22559
Dehly_0120RAAGGGGTTTGTCAGCTCTCG
Dehly_0270Dehly_0270FAGCAGTTTCGCCTTCTCCAA14359
Dehly_0270RCGACTACCAGGATGTCAGGC
Dehly_1149Dehly_1149FCCGAGTCCGGAGACGTTATG62259
Dehly_1149RACGATCCCGGAGTAGTGGAA
Dehly_1531Dehly_1531FAATCCAGCACCTGCTTCTCC18559
Dehly_1531RCAAAAACACACCGCGCAAAC

Following PCR, amplification products were separated via electrophoresis in a 2% (m/v) agarose gel and visualized using ethidium bromide staining. A 100-bp ladder (Sigma-Aldrich) was used to estimate the sizes of PCR amplicons. Production of amplicons of the size expected based on the genome sequence was taken as an initial indication of success. PCR products were subsequently sequenced to verify that the primers and PCR protocols allowed unique detection of the intended gene targets. Sequencing was performed using the BigDye Terminator version 3.1 (Applied Biosystems) in conjunction with an abi prism 3130 sequencer.

To evaluate the detection limits for the PCR primers and thermal protocols (Tables 1 and 2), genomic DNA from D. lykanthroporepellens BL-DC-9T quantified using a Qubit dsDNA HS assay kit (Invitrogen) in conjunction with a Qubit2 fluorometer was serially diluted (10–0.00015 ng μL−1) and then used as PCR template (with 1 μL template DNA per reaction). This corresponds to 5.8 × 106–8.7 × 101 genome copies/PCR. PCR conditions and amplicon detection were as described above.

Cell culture

Cultures for transcription experiments were grown in 25-mL glass serum bottles (Wheaton) sealed with butyl rubber stoppers and aluminum crimp caps. Each serum bottle contained 15 mL of defined, bicarbonate-buffered, anaerobic liquid medium with titanium citrate and cysteine as reducing agents prepared as described by Maness et al. (2012) with 0.05 mM each acetate, lactate, and pyruvate. Each serum bottle also contained 10 mL gas headspace comprised of 10% CO2, 80% N2, and 10% H2 (v/v). Triplicate bottles spiked with 1,2-DCP, 1,2-DCA, or 1,2,3-TCP (added as neat, filter-sterilized compounds) to reach an aqueous phase concentration of 2 mM following dissolution and equilibration were inoculated (6% v/v) with D. lykanthroporepellens BL-DC-9T. Incubation was in the dark at 30 °C without mixing. Triplicate bottles prepared, inoculated, and incubated in identical fashion but without addition of chlorinated solvents were prepared at the same time as controls. Cultures used for inoculation of bottles used in transcription experiments were grown on the same solvent prior to use as inoculum (e.g. the D. lykanthroporepellens BL-DC-9T culture inoculated into bottles containing 2 mM 1,2-DCA was grown on 2 mM 1,2-DCA) and were sparged with a gas mixture comprised of 10% CO2, 80% N2, and 10% H2 (v/v) to remove residual chlorinated compounds prior to use as an inoculum. Dechlorination was monitored by gas chromatography as described previously (Yan et al., 2009). Bottles were incubated until 25–65% of the parent chlorinated solvent was dechlorinated (see Table 3) prior to harvesting biomass.

Table 3. Summary of results from RT-PCR experiments for rdh genes with BL-DC-9T grown with 1,2-DCA, 1,2-DCP, and 1,2,3-TCP
 1,2-DCA1,2-DCP1,2,3-TCP
  1. Yes, PCR amplicon of appropriate size was observed in electrophoresis gels after PCR using primers and annealing temperatures for various locus tag targets as summarized in Table 1. No, PCR amplicons of appropriate size were not detected.

Incubation time (days)82124
% Dechlorination31–53%25–65%41–49%
RIN Number8.5–9.28.4–9.68.4–9.4
RNA concentration (ng μL−1)11.2–17.23.5–4.67.4–17.5
Dehly_0068NoNoNo
Dehly_0069YesYesYes
Dehly_0075NoNoNo
Dehly_0121YesYesYes
Dehly_0156- Dehly_0157YesYesYes
Dehly_0274YesYesYes
Dehly_0275- Dehly_0276YesYesYes
Dehly_0283NoNoNo
Dehly_0479YesYesYes
Dehly_0849YesYesYes
Dehly_0910YesYesYes
Dehly_1053-Dehly_1054YesYesYes
Dehly_1148YesYesYes
Dehly_1151-Dehly_1152YesYesYes
Dehly_1328YesYesYes
Dehly_1355NoNoNo
Dehly_1514YesYesYes
Dehly_1520YesYesYes
Dehly_1523YesYesYes
Dehly_1524-Dehly_1525YesYesYes
Dehly_1530YesYesYes
Dehly_1533-Dehly_1534NoNoNo
Dehly_1540NoNoNo
Dehly_1541YesYesYes
Dehly_1582YesYesYes

RNA extraction and purification

Cells for RNA extraction were collected by centrifugation. Serum bottles were opened inside an anaerobic chamber (Coy) supplied with gas headspace comprised of 10% CO2, 80% N2, and 10% H2 (v/v), and 15 mL culture volumes were transferred into plug-sealed centrifugation tubes (Corning). The centrifuge tubes were removed from the anaerobic chamber and centrifuged at 5900 g for 30 min at 4 °C. After briefly opening tubes to decant supernatant (< 1 min), the remaining cell pellets were immediately frozen by submerging tubes in liquid N2. Frozen cells were resuspended in 1 mL of TRI reagent (Molecular Research Center), and RNA was extracted using the modified guanidinium thiocyanate–phenol–chloroform RNA extraction method of Chomczynski and Sacchi (2006). Extraction was with 200 μL chloroform, and precipitation was with 500 μL isopropanol. For purification, the RNA pellet was washed with two rounds of 70% ethanol, and RNA was eluted in 30 μL of nuclease-free water. The extracted RNA was subjected to two rounds of DNase treatment using an RQ1 RNase-free DNase kit (Promega) before aliquots of RNA extract from each sample were analyzed using an RNA 6000 Pico kit (Agilent) in conjunction with an Agilent 2100 Bioanalyzer to assess RNA quality, quantify concentrations, and calculate the RNA integrity number (RIN, Schroeder et al., 2006).

Reverse transcription experiments

End-point RT-PCR was carried out using the rdh-specific primers (Table 1) and primers targeting the four regulatory genes (Table 2) the same day that RNA was extracted. In the RT-PCR, cDNA synthesis and PCR were carried out in the same tube using the SuperScript III one step RT-PCR system with Platinum Taq DNA polymerase kit (Invitrogen). 0.5 μL of DNase treated RNA extract was used as template for each reaction. The RT-PCR thermal program was 55 °C for 30 min for reverse transcription followed by initial denaturation at 95 °C for 2 min and then thirty cycles of 95 °C for 15 s, primer-specific annealing temperature for 30 s (see Table 1 and 2), and extension at 68 °C for 60 s. A final extension was carried out at 68 °C for 5 min. To check for the presence of genomic DNA contamination and as a negative control, in parallel, PCRs were carried out with 0.5 μL RNA extract serving as template in PCR using Platinum Taq DNA polymerase in the absence of reverse transcriptase enzyme.

The end-point RT-PCR products and samples from control PCR reactions were analyzed by agarose gel electrophoresis. The detection of amplicons of the correct size based on the genome sequence in reverse-transcribed but not direct PCR (i.e. lacking reverse transcription) was used as an indicator of gene expression. To verify amplicon identity, RT-PCR amplicons were excised from the electrophoresis gels, eluted using a MinElute gel extraction kit (Qiagen), and sequenced. The RT-PCRs were carried out in triplicate for each of the primer sets using cells harvested from triplicate bottles.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References
  9. Supporting Information

Primer design and detection limits

Using genomic DNA as template, PCR products of the correct size, as predicted from the genome sequence, were observed at template DNA concentrations of 0.001 ng μL−1 and higher (Figs S1 and S2) but not at 0.00075 ng μL−1 and lower for all of the PCR primer combinations and thermal protocols (Tables 1 and 2). This corresponds to a detection limit of 5.8 × 102 genome copies per PCR. Sequencing of expected sized PCR products showed that the amplicons were exact copies of target loci present in the chromosome of D. lykanthroporepellens BL-DC-9T.

Expression of rdhA genes during dechlorination of different substrates

Reductive dechlorination was observed in the bottles inoculated with strain BL-DC-9T and spiked with all three of the chlorinated compounds provided as electron acceptors following pathways described previously (i.e. 1,2-DCA transformed to ethene, 1,2-DCP transformed to propene, and 1,2,3-TCP transformed to allyl chloride, Moe et al., 2009; Yan et al., 2009). The amount of dechlorination observed at the time when bottles were sacrificed is provided in Table 3. The extracted RNA was of high quality, with RIN ranging from 7.5 to 9.6 (Table 3).

For BL-DC-9T cells harvested from all replicates of cultures that were actively dechlorinating each of the three chlorinated alkanes (1,2-DCA, 1,2-DCP, and 1,2,3-TCP), amplicons were detected in RT-PCR with 19 of the 25 rdh-specific primer sets (Table 3). No amplicons were detected following RT-PCR with RNA extracted from triplicate bottles prepared at the same time and incubated under identical conditions but without the presence of a halogenated electron acceptor. No PCR amplicons were observed in any of the tests when RNA extract was used as template in PCR without reverse transcription (conducted to detect the presence of genomic DNA contamination in the RNA extracts).

Expression of the transcription factors during dechlorination of different substrates

All four transcription factors (Dehly_0120, Dehly_0270, Dehly_1149, and Dehly_1531) were detected in the reverse transcriptase experiments from BL-DC-9T cells that were actively dechlorinating 1,2-DCA, 1,2-DCP, and 1,2,3-TCP. No amplicons were detected following RT-PCR with RNA extracted from triplicate bottles prepared at the same time and incubated under identical conditions but without the presence of halogenated electron acceptors. No PCR amplicons were detected in any of the tests when RNA extract was used as template in PCR without reverse transcription.

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References
  9. Supporting Information

It is clear from the RT-PCR results presented here that D. lykanthroporepellens BL-DC-9T simultaneously transcribes many rdh genes during the reductive dehalogenation of all three chlorinated alkanes tested. Simultaneous transcription of multiple rdhA genes in response to a single chlorinated compound has been reported previously for strains of the related genus Dehalococcoides (Waller et al., 2005; Fung et al., 2007; Johnson et al., 2008; Rahm & Richardson, 2008; Rowe et al., 2008; Wagner et al., 2009, 2013). Simultaneous transcription of multiple rdhA genes has also been reported for mixed cultures that reductively dehalogenate chlorinated alkanes or alkenes (Tang & Edwards, 2013; Tang et al., 2013). The results reported here for D. lykanthroporepellens further expand the diversity of bacteria known to simultaneously transcribe multiple rdh genes to include additional dehalorespiring species in the phylum Chloroflexi.

The expression pattern for rdh and regulatory genes was identical for BL-DC-9T during dechlorination of all three chlorinated compounds, with transcripts detected for all replicates with primers targeting 19 of the rdh loci and transcripts not detected for any replicates using primers targeting six of the rdh loci (Table 3). This latter result suggests that genes with locus tags Dehly_0068, Dehly_0075, Dehly_0283, Dehly_1355, Dehly_1533/Dehly_1534, and Dehly_1540 are likely not directly involved in the dechlorination process. It is also possible that these genes may have been transcribed but at levels below detection.

Of the 17 ‘full-length’ rdhA genes, 13 were transcribed during dechlorination of all three halogenated solvents (Dehly_0121, Dehly_0156/Dehly_0157, Dehly_0274, Dehly_0275/Dehly_0276, Dehly_0849, Dehly_0910, Dehly_1053/Dehly_1054, Dehly_1148, Dehly_1152, Dehly_1328, Dehly_1514, Dehly_1524/Dehly_1525, and Dehly_1530). The remaining four full-length rdhA genes (Dehly_0068, Dehly_0283, Dehly_1355, Dehly_1540) were not detected.

Of the truncated rdhA genes, transcripts were detected for those lacking a predicted twin-arginine sequence in the N-terminus (Dehly_0069, Dehly_1523, Dehly_1582), those lacking predicted iron-sulfur cluster binding motifs in the C-terminus (Dehly_0479), and one that lacked both a predicted twin-arginine sequence in the N-terminus and iron–sulfur cluster binding motifs in the C-terminus (Dehly_1520).

Of the six loci where rdhA genes are accompanied by cognate rdhB genes, amplicons were detected using five primer sets that targeted regions spanning the rdhAB genes (Dehly_0156/Dehly_0157, Dehly_0275/Dehly_0276, Dehly_1053/Dehly_1054, Dehly_1151/Dehly_1152, Dehly_1524/Dehly_1525), indicating that the rdhAB genes are co-transcribed by BL-DC-9T. The detected transcripts included the low mol% G + C rdhB gene predicted to code for a putative membrane-anchoring protein containing two as opposed to three transmembrane helices (Dehly_1524). Amplification products were not detected following RT-PCR with primers targeting the other rdhAB gene combination (Dehly_1533/Dehly_1534), indicating that this locus was not highly expressed or that the genes are not co-transcribed.

The gene with locus tag Dehly_1524 has been recently identified as encoding a 1,2-DCP reductive dehalogenase (dcpA) based on a combination of blue native polyacrylamide gel electrophoresis and enzyme assays (Padilla-Crespo et al., 2014). Homologues of this gene (92% amino acid identity) have also been found in 1,2-DCP dechlorinating Dehalococcoides mccartyi cultures RC and KS (Padilla-Crespo et al., 2014). In experiments reported here, the Dehly_1524 gene transcript was detected using RT-PCR with BL-DC-9T cultures actively dechlorinating not only 1,2-DCP but also 1,2-DCA and 1,2,3-TCP. This leaves open the possibility that the same enzyme was responsible for transformation of all three halogenated alkanes.

Two types of transcriptional regulators, MarR and two-component system transcriptional regulators, were found to be associated with rdh genes in the genomes of Dehalococcoides mccartyii strains (Kube et al., 2005; Seshadri et al., 2005). MarR mediates bacterial response to changes in environmental stress and metabolic conditions by functioning as a repressor protein (Wilkinson & Grove, 2006). The binding of a substrate to the MarR protein results in its release from the promoter, thereby initiating transcription (Providenti & Wyndham, 2001; Wagner et al., 2013). The two-component system transcriptional regulators, on the other hand, contain a histidine kinase which is phosphorylated on signal recognition. The phosphorylated signal is subsequently transferred to a response regulator containing a C-terminal DNA-binding domain that can initiate transcription on DNA binding (Galperin, 2006).

In the RT-PCR experiments reported here, transcripts from the MarR homologue Dehly_0120 (located in the conventional opposite orientation of the rdhA gene Dehly_0121) were detected along with transcripts from the associated rdhA (Dehly_0121) for all of the BL-DC-9T cultures growing with halogenated solvents. Transcripts from Dehly_0270 (a LuxR family two-component system transcriptional regulator located upstream of the rdhA genes Dehly_0274 and Dehly_0275, albeit with an interspersing segment), Dehly_1149 (a winged helix family two-component system transcriptional regulator located immediately upstream from the rdhA gene Dehly_1148), and Dehly_1531 (a LuxR family two-component system transcriptional regulator located immediately upstream from the rdhA gene Dehly_1530) were also detected along with transcripts from their putatively associated rdhA genes (Dehly_0274, Dehly_1148, and Dehly_1530) for all of the BL-DC-9T cultures growing with halogenated solvents. Each of the three two-component system transcriptional regulators has a cognate signal transduction histidine kinase, and there were no other ORFs encoding putative transcriptional regulators immediately up- or downstream in the genome sequence. The detection of transcripts from both MarR and two-component system transcriptional regulator amplicons in RT-PCR along with their cognate rdhA genes suggests that rdhA gene regulation is mediated by both types of transcription factors in D. lykanthroporepellens BL-DC-9T.

The simultaneous transcription of many rdhA genes and the expression of the same genes during the dechlorination of 1,2-DCA, 1,2-DCP, and 1,2,3-TCP prevent the direct implication of any one gene or group of genes with a set function. As with other genome sequences, the rdhA genes of D. lykanthroporepellens BL-DC-9T were annotated on the basis of sequence identity with previously annotated genes, and their actual functionality remains to be elucidated. As noted previously, whether many of the rdhA genes are even involved with reductive dechlorination remains tenuous (Hug et al., 2013). Nevertheless, identification of rdhA genes and transcription regulators expressed during the dechlorination of 1,2-DCA, 1,2-DCP, and 1,2,3-TCP sets the stage for future investigations into gene function and cell response to differing environmental conditions.

Acknowledgement

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References
  9. Supporting Information

This research was funded by the Governor's Biotechnology Initiative of the Louisiana Board of Regents Grant BOR#015 and NPC Services, Inc.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References
  9. Supporting Information
  • Bruschi M & Guerlesquin F (1988) Structure function and evolution of bacterial ferredoxins. FEMS Microbiol Rev 4: 155175.
  • Chomczynski P & Sacchi N (2006) The single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction: twenty-something years on. Nat Protoc 1: 581585.
  • Fung JM, Morris RM, Adrian L & Zinder SH (2007) Expression of reductive dehalogenase genes in Dehalococcoides ethenogenes strain 195 growing on tetrachloroethene, trichloroethene, or 2,3-dichlorophenol. Appl Environ Microbiol 73: 44394445.
  • Futagami T, Goto M & Furukawa K (2008) Biochemical and genetic basis of dehalorespiration. Chem Rec 8: 112.
  • Galperin MY (2006) Structural classification of bacterial response regulators: diversity of output domains and domain and domain combinations. J Bacteriol 188: 41694182.
  • Hall TA (1999) bioedit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser (Oxf) 41: 9598.
  • He J, Sung Y, Krajmalnik-Brown R, Ritalahti KM & Löffler FE (2005) Isolation and characterization of Dehalococcoides sp. strain FL2, a trichloroethene (TCE)- and 1,2-dichloroethene-respiring anaerobe. Environ Microbiol 7: 14421450.
  • Hug LA, Maphosa F, Leys D, Löffler FE, Smidt H, Edwards EA & Adrian L (2013) Overview of organohalide-respiring bacteria and a proposal for a classification system for reductive dehalogenases. Philos Trans R Soc Lond B Biol Sci 368: 20120322.
  • Johnson DR, Brodie EL, Hubbard AE, Andersen GL, Zinder SH & Alvarez-Cohen L (2008) Temporal transcriptomic microarray analysis of “Dehalococcoides ethenogenes” strain 195 during the transition into stationary phase. Appl Environ Microbiol 74: 28642872.
  • Krajmalnik-Brown R, Hölscher T, Thomson IN, Saunders FM, Ritalahti KM & Löffler FE (2004) Genetic identification of a putative vinyl chloride reductase in Dehalococcoides sp. strain BAV1. Appl Environ Microbiol 70: 63476351.
  • Kube M, Beck A, Zinder SH, Kuhl H, Reinhardt R & Adrian L (2005) Genome sequence of the chlorinated compound-respiring bacterium Dehalococcoides species strain CBDB1. Nat Biotechnol 23: 12691273.
  • Magnuson JK, Romnie MF, Burris DR & Kingsley MT (2000) Trichloroethene reductive dehalogenase from Dehalococcoides ethenogenes: sequence of tceA and substrate range characterization. Appl Environ Microbiol 66: 15415147.
  • Maillard J, Schumacher W, Vazquez F, Regeard C, Hagen WR & Holliger C (2003) Characterization of the corrinoid iron-sulfur protein tetrachloroethene reductive dehalogenase of Dehalobacter restrictus. Appl Environ Microbiol 69: 46284638.
  • Maness AD, Bowman KS, Yan KS, Rainey FA & Moe WM (2012) Dehalogenimonas spp. can reductively dehalogenate high concentrations of 1,2-dichloroethane, 1,2-dichloropropane, and 1,1,2-trichloroethane. AMB Express 2: 54.
  • McMurdie PJ, Behrens SF, Müller JA et al. (2009) Localized plasticity in the streamlined genomes of vinyl chloride respiring Dehalococcoides. PLoS Genet 5: e1000714.
  • Miller E, Wohlfarth G & Diekert G (1998) Purification and characterization of the tetrachloroethene reductive dehalogenase of strain PCE-S. Arch Microbiol 169: 497502.
  • Moe WM, Yan J, Nobre MF, da Costa MS & Rainey FA (2009) Dehalogenimonas lykanthroporepellens gen. nov., sp. nov., a reductively dehalogenating bacterium isolated from chlorinated solvent-contaminated groundwater. Int J Syst Evol Microbiol 59: 26922697.
  • Müller JA, Rosner BM, Von Abendroth G, Meshulam-Simon G, McCarty PL & Spormann AM (2004) Molecular identification of the catabolic vinyl chloride reductase from Dehalococcoides sp. strain VS and its environmental distribution. Appl Environ Microbiol 70: 48804888.
  • Neumann A, Wohlfarth G & Diekert G (1998) Tetrachloroethene dehalogenase from Dehalospirillum multivorans: cloning, sequencing of the encoding genes, and expression of the pceA gene in Escherichia coli. J Bacteriol 180: 41404145.
  • Padilla-Crespo E, Yan J, Swift C, Wagner DD, Chourey K, Hettich RL, Ritalahti KM & Löffler FE (2014) Identification and environmental distribution of dcpA, which encodes the reductive dehalogenase catalyzing the dichloroelimination 1,2-dichloropropane to propene in organohalide-respiring Chloroflexi. Appl Environ Microbiol 80: 808818.
  • Providenti MA & Wyndham C (2001) Identification and functional characterization of CbaR, a MarR-like modulator of the cbaABC-encoded chlorobenzoate catabolism pathway. Appl Environ Microbiol 67: 35303541.
  • Rahm BG & Richardson RE (2008) Correlation of respiratory gene expression levels and pseudo-steady state PCE respiration rates in Dehalococcoides ethenogenes. Environ Sci Technol 42: 416421.
  • Rowe AR, Lazar BJ, Morris RM & Richardson RE (2008) Characterization of a dechlorinating mixed culture: community structure and comparisons of gene expression in planktonic and biofloc-associated Dehalococcoides and Methanospirillum. Appl Environ Microbiol 74: 67096719.
  • Rozen S & Skaletsky H (2000) primer3 on the WWW for general users and for biologist programmers. Bioinformatics Methods and Protocols: Methods in Molecular Biology (Krawetz S & Misener S, eds), pp. 365386. Humana Press, Totowa, NJ.
  • Schroeder A, Mueller O, Stocker S, Salowsky R, Leiber M, Gassmann M, Lightfoot S, Menzel W, Granzow M & Ragg T (2006) The RIN: an RNA integrity number for assigning integrity values to RNA measurements. BMC Mol Biol 7: 3.
  • Seshadri R, Adrian L, Fouts DE et al. (2005) Genome sequence of the PCE-dechlorinating bacterium Dehalococcoides ethenogenes. Science 307: 105108.
  • Siddaramappa S, Challacombe JF, Delano SF et al. (2012) Complete genome sequence of Dehalogenimonas lykanthroporepellens type strain (BL-DC-9T) and comparison to “Dehalococcoides” strains. Stand Genomic Sci 6: 251264.
  • Smidt H & de Vos WM (2004) Anaerobic microbial dehalogenation. Annu Rev Microbiol 58: 4373.
  • Stanley NR, Palmer T & Berks BC (2000) The twin arginine consensus motif of Tat signal peptides is involved in Sec-independent protein targeting in Escherichia coli. J Biol Chem 275: 1159111596.
  • Suyama A, Yamashita M, Yoshino S & Furukawa K (2002) Molecular characterization of the pceA reductive dehalogenase of Desulfitobacterium sp. strain Y51. J Bacteriol 184: 34193425.
  • Tang S & Edwards EA (2013) Identification of Dehalobacter reductive dehalogenases that catalyse dechlorination of chloroform, 1,1,1-trichloroethane and 1,1-dichloroethane. Philos Trans R Soc Lond B Biol Sci 368: 20120318.
  • Tang S, Chan WWM, Fletcher KE, Seifert J, Liang X, Löffler FE, Edwards EA & Adrian L (2013) Functional characterization of reductive dehalogenases by using blue native polyacrylamide gel electrophoresis. Appl Environ Microbiol 79: 974981.
  • Wagner A, Adrian L, Kleinsteuber S, Andreesen JR & Lechner U (2009) Transcription analysis of genes encoding homologues of reductive dehalogenases in “Dehalococcoides” sp. strain CBDB1 by using terminal restriction fragment length polymorphism and quantitative PCR. Appl Environ Microbiol 75: 18761884.
  • Wagner A, Segler L, Kleinsteuber S, Sawers G, Smidt H & Lechner U (2013) Regulation of reductive dehalogenase gene transcription in Dehalococcoides mccartyi. Philos Trans R Soc Lond B Biol Sci 368: 20120317.
  • Waller AS, Krajmalnik-Brown R, Löffler FE & Edwards EA (2005) Multiple reductive-dehalogenase-homologous genes are simultaneously transcribed during dechlorination by Dehalococcoides-containing cultures. Appl Environ Microbiol 71: 82578264.
  • Wilkinson SP & Grove A (2006) Ligand-responsive transcriptional regulation by members of the MarR family of winged helix proteins. Curr Issues Mol Biol 8: 5162.
  • Yan J, Rash BA, Rainey FA & Moe WM (2009) Isolation of novel bacteria within the Chloroflexi capable of reductive dechlorination of 1,2,3-trichloropropane. Environ Microbiol 11: 833843.

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References
  9. Supporting Information
FilenameFormatSizeDescription
fml12434-sup-0001-TableS1-S3-FigureS1-S2.docWord document408K

Table S1. Characteristics of putative reductive dehalogenases (rdhA) of Dehalogenimonas lykanthroporepellens BL-DC-9T.

Table S2. Characteristics of putative reductive dehalogenase membrane-anchoring proteins (rdhB) of Dehalogenimonas lykanthroporepellens BL-DC-9T.

Table S3. Characteristics of putative transcriptional regulators associated with the rdhA genes.

Fig S1. Agarose gel image showing detection of expected sized amplicons produced using rdh-specific primers with genomic DNA template concentration of 0.001 ng µL−1.

Fig S2. Agarose gel image showing detection of expected sized amplicons produced using primers for transcription factors using genomic DNA template concentration of 0.001 ng µL−1.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.