SEARCH

SEARCH BY CITATION

Keywords:

  • iNOS;
  • interferon-γ;
  • detoxifying enzyme;
  • bacterial defense

Abstract

  1. Top of page
  2. Abstract
  3. Acknowledgements
  4. References

Peroxiredoxins contribute to protection of some bacteria against reactive oxygen intermediates (ROIs) and reactive nitrogen intermediates (RNIs). Listeria monocytogenes, a facultative intracellular bacterial pathogen, interacts with ROIs and RNIs during infection. In this study, we investigated the involvement of the 2-Cys peroxiredoxin (Prx) homologue in L. monocytogenes in the protection against ROIs and RNIs and in virulence through the construction of an in-frame prx deletion mutant. The Δprx mutant had increased sensitivity to hydrogen peroxide and cumene hydroperoxide compared to the wild-type strain. The mutant also exhibited an increased susceptibility to the nitric oxide-generating compound S-nitroso-N-acetylpenicillamine (SNAP) and 3-morpholinosydnonimine hydrochloride (SIN-1), a peroxynitrite donor. Furthermore, a diminished virulence of the Δprx mutant relative to the wild-type was observed in C57BL/6 mice, but not in inducible nitric oxide synthase-deficient mice. The results suggest that Prx protects L. monocytogenes against oxidative and nitrosative stress in vitro and in vivo and that the prx-encoded polypeptide thereby is involved in L. monocytogenes virulence.

Listeria monocytogenes is a Gram-positive facultative intracellular bacterium that causes infections in humans and animals. Infections are often severe and include septicemia and meningoencephalitis as well as fetal and infant infections (Vázquez-Boland et al., 2001). Listeria is able to invade and multiply within host cells, including macrophages, hepatocytes, and neuronal cells. Entry into the host normally occurs by passing the gastrointestinal barrier through active invasion of epithelial cells or via M cells. They disseminate to the liver and spleen, may spread to the central nervous system, and in pregnant women cross placenta to the fetus (Vázquez-Boland et al., 2001; Pizarro-Cerdá & Cossart, 2009). Early resistance to infection is ascribed to the production of interferon-γ (IFN-γ) by natural killer cells and the resultant increase of bactericidal activities in macrophages (Tripp et al., 1993). Such activities include the expression of inducible nitric oxide synthase (iNOS; NOS2) that generates nitric oxide (NO) radicals and of NADPH phagocyte oxidase, generating superoxide (O2−) radicals (Bogdan et al., 2000; Decker et al., 2002). Combination of NO and superoxide can result in the highly reactive product peroxynitrite (ONOO). The reactive nitrogen intermediates (RNIs) such as NO and peroxynitrite as well as different reactive oxygen intermediates (ROIs) kill phagocytized pathogens (Nathan, 1997). There is a general agreement that ROIs such as superoxide radicals and hydrogen peroxide (H2O2) as well as RNIs are listericidal and contribute to elimination of L. monocytogenes (Beckerman et al., 1993; Boockvar et al., 1994; MacMicking et al., 1995; Ohya et al., 1998; Müller et al., 1999; Shiloh et al., 1999; Álvarez-Domínguez et al., 2000; Jin et al., 2001, 2004).

L. monocytogenes has developed strategies to resist macrophage killing. Peroxiredoxins (Prxs) are a large family of antioxidant enzymes, present in yeast, human cells, and also in different bacteria. The Prxs have been implicated in detoxifying ROIs and RNIs (Bryk et al., 2000; Wong et al., 2002; Abbas et al., 2008). Members of the 2-Cys Prx subfamily have two highly conserved cysteines, and this family includes bacterial AhpC (Hirotsu et al., 1999). The N-terminal cysteine, usually located in a Val-Cys-Pro motif, is essential for the Prx activity (Chae et al., 1994b). Several Prxs act as peroxidases that catalyze the reduction of hydrogen peroxide and organic hydroperoxides, where the thioredoxin reductase (TrxR) and thioredoxin (Trx) system participate in the recycling of the peroxiredoxin (Chae et al., 1994a). The prx homologue in L. monocytogenes (lmo1604) was identified from the sequencing of the genome of L. monocytogenes EGDe as a typical 2-Cys peroxiredoxin. In L. monocytogenes, also homologues to thioredoxin reductase and thioredoxin (trxB and trxA) have been identified (Glaser et al., 2001). We herein studied the role of the 2-Cys peroxiredoxin homologue in L. monocytogenes in the protection against oxidative and nitrosative stress and in virulence, by constructing and phenotypically characterizing an in-frame prx deletion mutant.

For mutagenesis, an in-frame 465-bp deletion in prxprx) was generated from the parental L. monocytogenes wild-type (WT) strain EGDe (Glaser et al., 2001) using the temperature-sensitive shuttle vector pAUL-A (Chakraborty et al., 1992) coupled with splicing by overlap extension (SOE) (Horton et al., 1990). A 610-bp DNA fragment of the 5′ region of prx, encoding the first 12 N-terminal amino acid residues, was amplified using the primers P1604SOE1Bam-L (AAACCAAGTGGGATCCGATGATTATGCGCATCATCC) and P1604SOE2 (TCTTGGAGCTTGTGTGCC). Similarly, the primer pair P1604SOE3 (GGCACACAAGCTCCAAGACTATGCCCGATTAACTGGC) and P1604SOE4Sal-L (CAATTAAATGGTCGACCGAAATGAATATTCCAGACGG) served to amplify a 608-bp DNA fragment at the 3′ region encoding the last 14 C-terminal amino acids of Prx. The two PCR products were spliced in a second round of PCR to produce a PCR product containing an in-frame deletion of 465 bp of the prx gene. The PCR product was digested with BamHI and SalI and cloned into pAUL-A, yielding the pAUL-Δprx plasmid, which was verified by sequencing. The plasmid pAUL-Δprx was transformed into L. monocytogenes EGDe by electroporation, and erythromycin-resistant transformants were selected on brain heart infusion (BHI) agar containing erythromycin (5 μg mL−1). To obtain the chromosomal in-frame deletion, independent colonies were processed as previously described (Lingnau et al., 1995), generating independent Δprx isogenic deletion mutants. The deletion of the 465 bp was confirmed by PCR amplification and sequencing using primers P1604SOEup-L (TTGCGATTATGAAGGTCTACC) and P1604SOEdown-L (AGATAAAGTACACTTAGTTGGG).

The Δprx mutant and the WT had similar growth rates when grown in BHI at 37 °C (data not shown). Next, the Δprx mutant and the WT strain were assessed for resistance to the oxidative stress inducers such as hydrogen peroxide and cumene hydroperoxide (CHP) (a stable organic peroxide) with a disk inhibition assay. Bacteria were grown overnight in BHI broth. 100 μL of the overnight stationary-phase cultures was spread on BHI agar. Sterile 13-mm filter disks were placed in the center of agar plates, 10 μL of 10% H2O2 or 50 μL of 10% CHP was added to the disks, and the plates were incubated at 37 °C overnight. The diameter of the zone of growth inhibition was measured. Four replicate assays were performed for each strain, and the data were subjected to Student's t-test to evaluate their statistical significance.

The zones of inhibition with H2O2 observed for the Δprx mutant (25.3 ± 0.5 mm) were significantly larger (25.5%) than observed for the WT (20.1 ± 1.3 mm). Also, the zones of inhibition with CHP for the mutant (30.5 ± 1.8 mm) were significantly increased (21.4%) compared to the WT (25.1 ± 2.1 mm). Disruption of prx in two other EDGeΔprx mutants obtained in independent mutagenesis experiments also led to increases in sensitivity to H2O2 and CHP (data not shown), which ensured that results obtained were not due to accidental mutations generated in vitro.

To test whether the prx gene is of importance for the survival of L. monocytogenes treated with NO or peroxynitrite, bacteria were incubated with a NO donor (SNAP), a peroxynitrite donor (SIN-1), or buffer alone. Bacteria were cultivated in BHI at 37 °C with agitation to logarithmic growth phase (optical density at 600 nm, 0.5). Bacteria were harvested and diluted to a density of approximately 5 × 106 bacteria per mL in PBS with 20 mM HEPES buffer. The NO-donor S-nitroso-N-acetylpenicillamine (SNAP) (Sigma-Aldrich, St. Louis, MO) was added to a final concentration of 3 mM, and the reaction was allowed to proceed at 37 °C. Samples were collected after 3 h, and 10-fold dilutions were plated for determination of bacterial numbers (log CFU mL−1). For the analysis of sensitivity of bacteria to peroxynitrite, the procedure was as described above except that bacteria were diluted to 5 × 107 bacteria per mL in Krebs–Henseleit buffer, pH 7.4 (Lomonosova et al., 1998) before the peroxynitrite-releasing compound 3-morpholinosydnonimine hydrochloride (SIN-1) (Sigma-Aldrich) was added to a final concentration of 1 mM. Samples were assayed in triplicate. Each experiment was repeated twice. The data were analyzed statistically by Student's t-test.

When exposed to 3 mM SNAP, the log CFU mL−1 value for the Δprx mutant was approximately 10-fold lower after 3 h (4.8 ± 0.3) than for the WT strain (5.7 ± 0.2). When the Δprx mutant and the WT strain were exposed to 1 mM SIN-1 for 3 h, all Δprx were effectively killed, whereas the toxic effect of SIN-1 on the WT strain was partial, as the log CFU mL−1 value was 2.7 ± 0.3. No differences in survival between the Δprx mutant and the WT strain were observed when the strains were incubated in buffer alone. Other Δprx mutants obtained in independent mutagenesis experiments also showed decreased viability when exposed to SNAP or SIN-1 (data not shown). The results indicate that the prx-encoded polypeptide is of importance for the bacterial defense against NO and peroxynitrite.

To test the effect of deleting the prx gene on the virulence of L. monocytogenes, C57BL/6 mice were employed. Bacteria were grown in BHI broth to late exponential phase (optical density at 600 nm, 0.8), washed once with PBS. Six-week-old C57BL/6 mice (WT) (n = 6 per group) were infected intraperitoneally (i.p.) with 105 L. monocytogenes. Five days after infection, mice were sacrificed, and the spleens and livers were homogenized in PBS containing 0.1% Triton X-100. Tenfold serial dilutions of the lysates in PBS were plated on BHI agar plates. Colonies were counted after overnight incubation at 37 °C. The data were analyzed statistically by Student's t-test.

Bacterial levels in mice injected i.p. with the Δprx mutant were compared to those infected with the WT strain. We observed that livers and spleens of C57BL/6 mice 5 days after i.p. infection with Δprx showed more than a 15-fold reduction in L. monocytogenes numbers compared to the organs of mice infected with the WT strain (Fig. 1), indicating that the Prx is involved in the ability of L. monocytogenes to tolerate the toxic inflammatory responses of the host.

image

Figure 1. CFU after intraperitoneal (i.p.) infection of inducible nitric oxide synthase-deficient (iNOS−/−) and wild-type (WT) mice. Listeria monocytogenes WT and the Δprx mutant were inoculated i.p. into WT or iNOS−/− mice (six mice per group). Five days after infection, the mice were sacrificed, and bacterial loads (CFU) in their spleens and livers were measured. The means and standard errors of the mean are shown. The asterisk indicates a significant difference in the log CFU of the Δprx mutant relative to the WT (P < 0.05 as determined by Student's t-test). Two asterisks indicate a significant difference between two groups of mice infected with the same bacterial strain (P < 0.05 as determined by Student's t-test).

Download figure to PowerPoint

To address whether iNOS-mediated protective immune responses are involved in the outcome of infection with the Δprx mutant, the bacterial load in iNOS−/− mice was measured as described above. iNOS−/− mice have been previously shown to possess increased susceptibility to L. monocytogenes (Shiloh et al., 1999). The susceptibility of iNOS−/− mice to WT L. monocytogenes and to the Δprx mutant was compared. The livers from iNOS−/− mice showed an increased number of WT L. monocytogenes compared to the same organs of C57BL/6 control mice (Fig. 1). On the other hand, bacterial numbers of the Δprx and WT strain recovered from organs of iNOS−/− mice were similar (Fig. 1), indicating that the peroxiredoxin homologue is involved in the protection of L. monocytogenes against NO.

In the present work, we characterized the prx gene of L. monocytogenes putatively encoding a 2-Cys peroxiredoxin through the construction of an in-frame deletion mutant and showed that it contributed to resistance of the bacteria to nitrosative stress. Further, our data indicate that the Prx homologue in L. monocytogenes is involved in survival under oxidative stress conditions, confirming a previous report (Kim et al., 2007). It has been suggested that other members of the AhpC family are involved in the protection of prokaryotes and eukaryotes against RNI. For example, in Salmonella enterica serovar Typhimurium, ONOO can be detoxified to inline image by the peroxiredoxin AhpC (Chen et al., 1998).

To exclude an effect on downstream genes, an in-frame deletion mutant was constructed. To ensure that results obtained were not due to accidental mutations generated in vitro, three independent mutants were obtained and all of these showed the same increased sensitivity to H2O2 and CHP as well as to SNAP and SIN-1. Further, we also constructed an insertion mutant in the prx gene using the pAUL-A plasmid, which also showed the same increased sensitivity to H2O2, CHP, SNAP, and SIN-1 (data not shown). This strongly indicates that no secondary mutation has occurred during the generation of the deletion mutants.

Livers and spleens from i.p. infected C57BL/6 mice contained significantly less numbers of the Δprx mutant than of the WT strain, indicating that the prx-encoded polypeptide is involved in the fitness of L. monocytogenes in the C57BL/6 mice. Contrary to our findings, Kim et al.(2007) reported similar bacterial loads in BALB/c mice infected with either a prx-deficient mutant or a WT L. monocytogenes strain. The conflicting results could be explained by differences in the experiments. In the study by Kim et al., mice were infected with a fivefold higher bacterial inoculum, and bacterial loads in their organs were measured 4 days after infection, whereas in the present study, bacterial loads were measured on day 5. It seems reasonably to assume that the mice in Fig. 1 are in the process of clearing the bacterial infection and that the Δprx mutant is cleared more readily by the host immune system than the WT strain is. Using the same bacterial inoculum and time course of infection as in the present study, similar results would likely have been observed for the experiments reported by Kim et al.(2007). Our data correspond to previous reports from studies of other bacteria that peroxiredoxin can confer protection of bacteria against nitrosative and oxidative stress produced by the host. For example, it has been shown that ahpC in Helicobacter cinaedi provides protection from organic hydroperoxide and from macrophage killing (Charoenlap et al., 2012). In M. tuberculosis, it was shown that expression of ahpC increased the resistance to the NO-donor S-nitrosogluthathione (GSNO), nitrite, and products of iNOS and protected transfected human cells from iNOS-generated RNI (Chen et al., 1998). Indeed, the in vivo data in which iNOS−/− mice were infected with the Δprx and WT strain showed that prx can participate in the protection of L. monocytogenes against activity of iNOS-generated NO.

The results of this study suggest that the peroxiredoxin gene of L. monocytogenes is playing a role during infection of C57BL/6 mice and that prx is involved in protection of L. monocytogenes against activity of iNOS. The results are relevant for the understanding of the interactions of L. monocytogenes with the innate immune system.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Acknowledgements
  4. References

This work was supported by a Grant (09-059588) from the Danish Agricultural and Veterinary Research Council and the Swedish Research Council (04480). We thank Gitte Petersen for excellent technical assistance.

References

  1. Top of page
  2. Abstract
  3. Acknowledgements
  4. References
  • Abbas K, Breton J & Drapier JC (2008) The interplay between nitric oxide and peroxiredoxins. Immunobiology 213: 815822.
  • Álvarez-Domínguez C, Carrasco-Marín E, López-Mato P & Leyva-Cobián F (2000) The contribution of both oxygen and nitrogen intermediates to the intracellular killing mechanisms of C1q-opsonized Listeria monocytogenes by the macrophage-like IC-21 cell line. Immunology 101: 8389.
  • Beckerman KP, Rogers HW, Corbett JA, Schreiber RD, McDaniel ML & Unanue ER (1993) Release of nitric oxide during the T cell-independent pathway of macrophage activation. Its role in resistance to Listeria monocytogenes. J Immunol 150: 888895.
  • Bogdan C, Röllinghoff M & Diefenbach A (2000) The role of nitric oxide in innate immunity. Immunol Rev 173: 1726.
  • Boockvar KS, Granger DL, Poston RM, Maybodi M, Washington MK, Hibbs JB Jr & Kurlander RL (1994) Nitric oxide produced during murine listeriosis is protective. Infect Immun 62: 10891100.
  • Bryk R, Griffin P & Nathan C (2000) Peroxynitrite reductase activity of bacterial peroxiredoxins. Nature 407: 211215.
  • Chae HZ, Chung SJ & Rhee SG (1994a) Thioredoxin-dependent peroxide reductase from yeast. J Biol Chem 269: 2767027678.
  • Chae HZ, Uhm TB & Rhee SG (1994b) Dimerization of thiol-specific antioxidant and the essential role of cysteine 47. P Natl Acad Sci USA 91: 70227026.
  • Chakraborty T, Leimeister-Wächter M, Domann E, Hartl M, Goebel W, Nichterlein T & Notermans S (1992) Coordinate regulation of virulence genes in Listeria monocytogenes requires the product of the prfA gene. J Bacteriol 174: 568574.
  • Charoenlap N, Shen Z, McBee ME, Muthupalani S, Wogan GN, Fox JG & Schauer DB (2012) Alkyl hydroperoxide reductase is required for Helicobacter cinaedi intestinal colonization and survival under oxidative stress in BALB/c and BALB/c interleukin-10−/− mice. Infect Immun 80: 921928.
  • Chen L, Xie QW & Nathan C (1998) Alkyl hydroperoxide reductase subunit C (AhpC) protects bacterial and human cells against reactive nitrogen intermediates. Mol Cell 1: 795805.
  • Decker T, Stockinger S, Karaghiosoff M, Müller M & Kovarik P (2002) IFNs and STATs in innate immunity to microorganisms. J Clin Invest 109: 12711277.
  • Glaser P, Frangeul L, Buchrieser C et al. (2001) Comparative genomics of Listeria species. Science 294: 849852.
  • Hirotsu S, Abe Y, Okada K, Nagahara N, Hori H, Nishino T & Hakoshima T (1999) Crystal structure of a multifunctional 2-Cys peroxiredoxin heme-binding protein 23 kDa/proliferation-associated gene product. P Natl Acad Sci USA 96: 1233312338.
  • Horton RM, Cai ZL, Ho SN & Pease LR (1990) Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction. Biotechniques 8: 528535.
  • Jin Y, Dons L, Kristensson K & Rottenberg ME (2001) Neural route of cerebral Listeria monocytogenes murine infection: role of immune response mechanisms in controlling bacterial neuroinvasion. Infect Immun 69: 10931100.
  • Jin Y, Lundkvist G, Dons L, Kristensson K & Rottenberg ME (2004) Interferon-gamma mediates neuronal killing of intracellular bacteria. Scand J Immunol 60: 437448.
  • Kim KP, Hahm BK & Bhunia AK (2007) The 2-cys peroxiredoxin-deficient Listeria monocytogenes displays impaired growth and survival in the presence of hydrogen peroxide in vitro but not in mouse organs. Curr Microbiol 54: 382387.
  • Lingnau A, Domann E, Hudel M, Bock M, Nichterlein T, Wehland J & Chakraborty T (1995) Expression of the Listeria monocytogenes EGD inlA and inlB genes, whose products mediate bacterial entry into tissue culture cell lines, by PrfA-dependent and -independent mechanisms. Infect Immun 63: 38963903.
  • Lomonosova EE, Kirsch M, Rauen U & de Groot H (1998) The critical role of Hepes in SIN-1 cytotoxicity, peroxynitrite versus hydrogen peroxide. Free Radic Biol Med 24: 522528.
  • MacMicking JD, Nathan C, Hom G et al. (1995) Altered responses to bacterial infection and endotoxic shock in mice lacking inducible nitric oxide synthase. Cell 81: 641650.
  • Müller M, Althaus R, Fröhlich D, Frei K & Eugster HP (1999) Reduced antilisterial activity of TNF-deficient bone marrow-derived macrophages is due to impaired superoxide production. Eur J Immunol 29: 30893097.
  • Nathan C (1997) Inducible nitric oxide synthase: what difference does it make? J Clin Invest 100: 24172423.
  • Ohya S, Tanabe Y, Makino M, Nomura T, Xiong H, Arakawa M & Mitsuyama M (1998) The contributions of reactive oxygen intermediates and reactive nitrogen intermediates to listericidal mechanisms differ in macrophages activated pre- and postinfection. Infect Immun 66: 40434049.
  • Pizarro-Cerdá J & Cossart P (2009) Listeria monocytogenes membrane trafficking and lifestyle: the exception or the rule? Annu Rev Cell Dev Biol 25: 649670.
  • Shiloh MU, MacMicking JD, Nicholson S, Brause JE, Potter S, Marino M, Fang F, Dinauer M & Nathan C (1999) Phenotype of mice and macrophages deficient in both phagocyte oxidase and inducible nitric oxide synthase. Immunity 10: 2938.
  • Tripp CS, Wolf SF & Unanue ER (1993) Interleukin 12 and tumor necrosis factor alpha are costimulators of interferon gamma production by natural killer cells in severe combined immunodeficiency mice with listeriosis, and interleukin 10 is a physiologic antagonist. P Natl Acad Sci USA 90: 37253729.
  • Vázquez-Boland JA, Kuhn M, Berche P, Chakraborty T, Domínguez-Bernal G, Goebel W, González-Zorn B, Wehland J & Kreft J (2001) Listeria pathogenesis and molecular virulence determinants. Clin Microbiol Rev 14: 584640.
  • Wong CM, Zhou Y, Ng RW, Kung Hf HF & Jin DY (2002) Cooperation of yeast peroxiredoxins Tsa1p and Tsa2p in the cellular defense against oxidative and nitrosative stress. J Biol Chem 277: 53855394.