SEARCH

SEARCH BY CITATION

Keywords:

  • APPswePS1dE9;
  • Alzheimer;
  • amyloid;
  • insulin-degrading enzyme;
  • 3xTg-AD

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgments
  8. Funding
  9. References
  10. Supporting Information

Alzheimer's disease (AD) is hallmarked by amyloid-β (Aβ) peptides accumulation and aggregation in extracellular plaques, preceded by intracellular accumulation. We examined whether intracellular Aβ can be cleared by cytosolic peptidases and whether this capacity is affected during progression of sporadic AD (sAD) in humans and in the commonly used APPswePS1dE9 and 3xTg-AD mouse models. A quenched Aβ peptide that becomes fluorescent upon degradation was used to screen for Aβ-degrading cytoplasmic peptidases cleaving the aggregation-prone KLVFF region of the peptide. In addition, this quenched peptide was used to analyze Aβ-degrading capacity in the hippocampus of sAD patients with different Braak stages as well as APPswePS1dE9 and 3xTg-AD mice. Insulin-degrading enzyme (IDE) was found to be the main peptidase that degrades cytoplasmic, monomeric Aβ. Oligomerization of Aβ prevents its clearance by IDE. Intriguingly, the Aβ-degrading capacity decreases already during the earliest Braak stages of sAD, and this decline correlates with IDE protein levels, but not with mRNA levels. This suggests that decreased IDE levels could contribute to early sAD. In contrast to the human data, the commonly used APPswePS1dE9 and 3xTg-AD mouse models do not show altered Aβ degradation and IDE levels with AD progression, raising doubts whether mouse models that overproduce Aβ peptides are representative for human sAD.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgments
  8. Funding
  9. References
  10. Supporting Information

Alzheimer's disease (AD) is hallmarked by extracellular deposits of amyloid-β (Aβ) peptides in plaques and intracellular neurofibrillary tangles containing hyperphosphorylated tau. According to the amyloid-cascade hypothesis, Aβ accumulation in the brain drives further AD pathogenesis, such as tau aggregation, synaptic dysfunction, and eventually neuronal death (Hardy & Allsop, 1991; Murrell et al., 1991; Hardy & Selkoe, 2002; Querfurth & LaFerla, 2010; Tam & Pasternak, 2012). The progression of AD is classified by different Braak stages and amyloid scores (Braak & Braak, 1991), reflecting the distribution of plaques and tangles in well-defined brain areas. Aβ peptides are generated from the transmembrane amyloid precursor protein (APP) by β-secretase and γ-secretase in organelles including the endoplasmic reticulum, Golgi apparatus, and the endosomal-lysosomal pathway (Selkoe, 2001; LaFerla et al., 2007). Predominantly, Aβ peptides of 40 (Aβ40) or 42 amino acids (Aβ42) are generated, with Aβ42 being more aggregation prone (Thinakaran & Koo, 2008). While extracellular Aβ aggregation has long been considered as the primary cause of AD, intracellular Aβ accumulation is detected in neurons prior to the appearance of extracellular deposits (Wirths et al., 2001; Youmans et al., 2012) and is associated with cytotoxicity, dysfunction of organelles, and neurodegeneration (Bayer & Wirths, 2010). Translocation of Aβ peptides into the cytoplasm could occur via various routes (Li et al., 2007), including transport of ER-generated Aβ peptides into the cytoplasm via systems related to ER-associated degradation (ERAD) (Bückig et al., 2002; Schmitz et al., 2004), passive leakage of Aβ along the secretory pathway, or by membrane permeability of lysosomes containing internalized Aβ (Yang et al., 1998).

While the rare autosomal dominant familial AD (fAD) is mostly due to overproduction of Aβ (Bertram et al., 2010; O'Brien & Wong, 2011) or enhancing Aβ protofibril formation (Nilsberth et al., 2001), far more common is late-onset sporadic AD (sAD), thought to be caused by decreased clearance of the Aβ peptide (Dorfman et al., 2010; Mawuenyega et al., 2010). Several proteases are able to degrade Aβ and especially insulin-degrading enzyme (IDE), also named insulysin, is extensively described for its role as an Aβ-degrading enzyme (Kurochkin & Goto, 1994; Qiu et al., 1998; Pérez et al., 2000; Vekrellis et al., 2000; Caccamo et al., 2005). IDE is mainly cytoplasmic (Kurochkin & Goto, 1994) but also has a neuronal transmembrane isoform (Vekrellis et al., 2000) is found in peroxisomes (Chesneau et al., 1997) and can be secreted via exosomes by microglia (Qiu et al., 1998) and astrocytes (Jiang et al., 2008). Knock down of IDE levels in HeLa cells was shown to result in accumulation of cytoplasmic Aβ peptides after they were transported to the cytoplasm via ERAD (Schmitz et al., 2004), subsequently capable of inducing cell death (Lee et al., 2006).

Our study aims at elucidating the role for peptidases in cytoplasmic Aβ clearance during different stages in the development of AD, in both human postmortem brains and brains of the commonly used APPswePS1dE9 and 3xTg-AD mouse models. Using a quenched Aβ peptide that becomes fluorescent upon cleavage inside the KLVFF region critical for Aβ peptide aggregation, we confirmed IDE to be the main peptidase that degrades cytoplasmic Aβ. More important, we found that the capacity to degrade Aβ is already dramatically decreased during the earliest stages of sAD in humans. This decline correlated with IDE protein levels but not RNA levels. Interestingly, these changes in IDE levels and Aβ degradation were not observed in the APPswePS1dE9 and 3xTg-AD mouse models, raising doubts whether mouse models that overproduce Aβ peptides mimic the alterations in Aβ clearance in human sAD.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgments
  8. Funding
  9. References
  10. Supporting Information

IDE is the main cytoplasmic peptidase degrading the monomeric Aβ peptide

We developed a sensitive Aβ degradation assay by generating a quenched Aβ40 peptide containing a small fluorescein group and a quenching dabcyl group (Reits et al., 2004) flanking the KLVFF sequence present in the middle of the Aβ peptides that is a critical region for aggregation (Fig. 1A) (Tjernberg et al., 1996). The quenched Aβ40 peptide (qAβ40) only becomes fluorescent upon separation of quencher and fluorophore, hence after degradation of Aβ. The qAβ40 peptides were added to cytoplasmic fractions of mildly lysed HEK293 cells, thereby preventing contamination with extracellular membrane-bound or lysosomal proteases, resulting in an increase in fluorescent signal (Fig. 1B). To identify which proteases play a role in this Aβ clearance machinery, different protease inhibitors were added to the cytosolic fractions prior to adding the qAβ40. The proteasome inhibitor MG132 did not show any effect on Aβ degradation, nor did inhibition of cystein peptidases (E64), bestatin-sensitive aminopeptidases, serine proteases (PMSF), aspartyl proteases (pepstatin), puromycin-sensitive aminopeptidase (PAQ22), tripeptidyl-peptidase II (butabindide, AAF-CMK), thimet oligopeptidase (Cpp-AAF-pNa), or nardilysin (amasatin). However, inhibiting metalloproteases by adding phenanthroline significantly decreased the rate of qAβ40 degradation. Specific inhibition of the metallopeptidase IDE using bacitracin reduced qAβ40 degradation (Fig. 1C) and as no additional decrease was observed upon combining phenanthroline and bacitracin, this indicates that IDE is the main cytoplasmic protease responsible for efficient Aβ degradation.

image

Figure 1. Monomeric and oligomeric qAβ40 degradation (A) Fluorescence can only be detected upon degradation of the quenched amyloid-β40 (qAβ40) peptide when the fluorescein group (F) is separated from the quencher group (Q). (B) qAβ40 is degraded in HEK293 cytosolic fractions (dashed line) but not in KMH buffer (solid line). (C) qAβ40 degradation in HEK293 cytosolic fractions without inhibitor (solid line), preincubated with 100 μm phenanthroline (dashed line) and preincubated with 200 μm bacitracin (dotted line). (D) Degradation of qAβ40 that was preincubated at 37 °C for 0 h (dashed line), 2 h (upper dotted grey line), 4 h (solid black line), or 6 h (lower dotted line) in HEK293 cell lysates. (E) Oligomeric Aβ does not impair insulin-degrading enzyme, as monomeric qAβ40 is as efficiently degraded in HEK293 cell lysates preincubated with monomeric qAβ40 (solid line) and with 2 h preincubated qAβ40 (dotted line). The additional pool of monomeric qAβ40 was added when the fluorescence plateau level was reached (arrow). (F) Electron microscopy images showing increased oligomerization with time of qAβ40 and synthetic Aβ42 at 37 °C.

Download figure to PowerPoint

As most peptidases can only target monomeric Aβ, inhibition of IDE, and the resulting decrease in degradation rate of qAβ40, could accelerate aggregation of the nondegraded qAβ40. Therefore, the effect of Aβ oligomerization on degradation rates was investigated. The qAβ40 peptide was preincubated at 37 °C to allow oligomerization for 2–6 h before addition to the cytosolic fraction. Reduced fluorescent levels were found with preincubated qAβ40 peptides (Fig. 1D), suggesting that aggregation of qAβ40 peptides prevents its degradation. To exclude that this effect was due to impeding of IDE rather than an inability to degrade oligomeric forms of qAβ40, monomeric or 2 h preincubated oligomeric qAβ40 was added to cytosolic fractions. When no degradation occurred anymore, indicated by reaching the plateau level of fluorescence, a second pool of only monomeric qAβ40 peptides was added to the same lysates. These peptides were equally efficiently degraded (Fig. 1E), demonstrating that IDE did not become impede by oligomeric qAβ40. Aggregation of qAβ40 was confirmed by electron microscopy, showing increased oligomerization in time, comparable with unmodified Aβ42 (Fig. 1F).

Aβ peptides are less efficiently degraded by IDE with sAD development

As the hippocampus is highly susceptible to Aβ accumulation, we examined whether the ability to degrade Aβ is affected in sporadic (sAD) using human hippocampal tissue of postmortem brains with varying Braak stages. Included were Braak 0 (control, no AD) and Braak I–VI. Information regarding postmortem samples is listed in Table 1. When the ability to degrade qAβ40 was determined for each Braak stage (Fig. 2A, solid bars), a strong decrease in qAβ40 degradation rate was already observed in Braak stage I (two-tailed t-test, P = 0.03), which further decreased during the progression to Braak stage II (two-tailed t-test, P = 0.01). Intriguingly, in Braak stage III, the ability to degrade qAβ40 was partially restored, only to decrease again in Braak stage IV (two-tailed t-test, P = 0.02) and further decrease as a function of progression of Braak stage (Braak V: two-tailed t-test, P = 0.0005, Braak VI: two-tailed t-test, P = 0.000). In Braak VI, qAβ40 degradation rate decreased with more than 65% compared with Braak 0. When bacitracin was added to hippocampal lysates prior to addition of the qAβ40, the ability to degrade qAβ40 was strongly reduced in all Braak stages upon IDE inhibition (Fig. 2A, dotted bars). This indicates that IDE is also the main protease responsible for Aβ clearance in human hippocampal lysates and suggests that IDE is impaired in sAD. Also, oligomerized Aβ was less well degraded with increasing Braak stage (Fig. 2B). AD progression can also be classified by plaque distribution in well-defined brain areas giving a particular amyloid score, ranging from O (no plaques) to C. Similar to increasing Braak stages, the rate of qAβ40 degradation decreased with increasing amyloid score, being significant for hippocampal fractions of brains classified with amyloid score C (two-tailed t-test, P = 0.017) (Fig. 2C). Whereas qAβ40 degradation rate is significantly negatively correlated with amyloid score and Braak stages (respectively; Pearson's correlation coefficient r = −0.499, P = 0.000 and r = −0.469, P = 0.000), qAβ40 degradation rate was not significantly correlated with postmortem delay, sex, age, and ApoE genotype. When combining Braak stages and amyloid scores, the correlation with qAβ40 degradation was even stronger (Pearson's correlation coefficient r = −0.583, P = 0.000) (Table 2).

Table 1. Detailed donor information
 Amyloid scoreAgeSexPMDpHBW
  1. BW, brain weight (grams); NA, not available; PMD, Postmortem delay (hours).

Br 0 (n = 9)6O-2A-1B60.1 ± 6.02F-7M7.2 ± 3.15.9 ± 2.21282 ± 177
Br I (n = 10)4O-3A-1B-1C-1NA81.8 ± 9.45F-5M6.7 ± 1.96.6 ± 0.31239 ± 144
Br II (n = 9)3O-2B-2C-2NA84.8 ± 6.86F-3M6.0 ± 0.96.5 ± 0.21213 ± 99
Br III (n = 10)1O-1A-2B-2C-4NA85.2 ± 6.66F-4M5.2 ± 2.16.5 ± 0.31235 ± 151
Br IV (n = 10)1B-7C-2NA85.2 ± 5.65F-5M5.5 ± 1.86.6 ± 0.21176 ± 163
Br V (n = 10)2B-7C-1NA81.2 ± 9.45F-5M5.8 ± 1.46.4 ± 0.21138 ± 95
Br VI (n = 10)1B-6C-3NA77.5 ± 11.45F-5M5.6 ± 1.76.5 ± 0.21072 ± 143
Table 2. Correlation patient variables and qAβ40 degradation
 Pearson's correlationP-value
  1. Pearson's correlation values and significance for correlation between qAβ40 degradation and Braak stage, Amyloid score, Braak stage × Amyloid score, postmortem delay, age at death, sex, and ApoE.

Braak stage−0.4690.000
Amyloid score−0.4990.000
Braak stage × Amyloid score−0.5830.000
Postmortem delay (h)0.0090.941
Age at death−0.1530.213
Sex−0.1330.281
ApoE−0.1510.243
image

Figure 2. qAβ40 degradation during the progression of sporadic AD (sAD). (A) qAβ40 degradation in human hippocampal lysates at different Braak stages, without inhibitor (solid bars), and with bacitracin (dotted bars). qAβ40 degradation is significantly decreased in Braak stage I, II, IV, V, and VI. Error bars represent standard error of the mean (SEM) (*P < 0.05; ***P < 0.001; ****P < 0.0001). (B) Degradation of differently preincubated, oligomeric qAβ40 in human hippocampal lysates at Braak stage 0, III, and VI. qAβ40 degradation is significantly decreased in Braak stage VI, at 0 h (P < 0.01), 2 h (P < 0.01), 4 h (P < 0.01), and 6 h (P < 0.01) of preincubation. Error bars represent SEM (**P < 0.01). (C) qAβ40 degradation in human hippocampal lysates at different amyloid scores. qAβ40 degradation is significantly decreased in amyloid score C (P < 0.05). Error bars represent SEM. (D) Upper panel: Western blot analysis of human hippocampal lysates at different Braak stages, showing a decrease of insulin-degrading enzyme (IDE) with increasing Braak stage in sAD. Lower panel: Western blot quantification of IDE protein levels in human hippocampal lysates at different Braak stages.

Download figure to PowerPoint

To examine the reduced qAβ40 degradation in sAD in more detail, we examined IDE protein and mRNA levels, because IDE was found to be the main peptidase degrading the qAβ40. Strikingly, a strong decrease in IDE protein levels was observed already in Braak stage I, which further decreased during the progression to Braak stage II, in parallel with the qAβ40 degradation rate. Similarly, IDE protein levels partially restored in Braak stage III, and decreased again as a function of progression of Braak stage from Braak stage IV onwards (Fig. 2D), indicating that decreased IDE protein levels were directly linked to impaired qAβ40 degradation and development of sAD. In contrast, IDE mRNA did not correlate with IDE proteins levels and qAβ40 degradation; mRNA levels did not change with Braak stage (Fig. S2A) and were even upregulated with amyloid score (Fig. S2B), being significant for amyloid score B (two-tailed t-test, P = 0.03).

Aβ peptides are efficiently degraded in all stages of AD in the APPswePS1dE9 mice

Several genetically modified mouse models have been generated that mimic human AD pathology, including the APPswePS1dE9 double transgenic mice which coexpress APP695 with the Swedish mutation (K594M/N595L) and the human exon-9-deleted variant of PS1 (PS1-dE9). The APPswe mutation is a favorable substrate for β-secretase, whereas the PS1dE9 mutation alters γ-secretase cleavage, thereby promoting overproduction of Aβ42. Consequentially, APPswePS1dE9 mice show increased Aβ42 production accompanied by plaque pathology in the brain, becoming evident at the age of 6 months (Jankowsky et al., 2004). APPswePS1dE9 mice are commonly used in AD research for behavioral tests and studying the molecular mechanisms in plaque progression (Oksman et al., 2006; Song et al., 2008; Yan et al., 2009). To examine whether the APPswePS1dE9 mice show a similar decrease in Aβ degradation rate with progression of AD, qAβ40 degradation was measured using hippocampal lysates of APPswePS1dE9 mice at the age of 3 months (no plaque pathology), 9 months (starting plaque pathology), and 18 months (severe plaque pathology) (Kamphuis et al., b) in parallel with wild-type age-matched controls (n = 3 per age group). Strikingly, hippocampal lysates of the APPswePS1dE9 mice at all stages of AD showed equal qAβ40 degradation rates as those of age-matched wild-type controls (Fig. 3A), which is in clear contrast with human sAD. As qAβ40 degradation was equally decreased in all lysates upon inhibition of IDE (Fig. 3A), this suggests that IDE is also the main peptidase responsible for Aβ degradation in APPswePS1dE9 mice. Just as for the human hippocampal lysates, we measured IDE protein levels in the hippocampal lysates of the APPswedE9 mice at all stages of AD. However, in clear contrast with the human data, neither IDE protein (Fig. 3B) nor mRNA levels (data not shown) change during AD progression in mice. Unaltered IDE protein levels could explain why APPswePS1dE9 mice do not show a decrease in Aβ-degrading abilities with AD development and indicates that in APPswePS1dE9 mice plaque formation is mainly the result of an increase in Aβ production.

image

Figure 3. qAβ40 degradation during the progression of Alzheimer's disease (AD) in the APPswePS1dE9 mice. (A) qAβ40 degradation in mouse hippocampal lysates of both wild-type (solid bars) and APPswePS1dE9 mice (dotted bars) at 3, 9, and 18 months of age. Error bars represent standard error of the mean (SEM). (B) Upper panel: Western blot analysis of APPswePS1dE9 mice hippocampal lysates at 3, 9, and 18 months of age, stained for insulin-degrading enzyme (IDE) and β-actin (loading control). Lower panel: Western blot quantification of IDE protein levels in APPswePS1dE9 mice hippocampal lysates at different ages.

Download figure to PowerPoint

Aβ peptides are efficiently degraded in all stages of AD in the 3xTg-AD mice

The triple transgenic mouse model (3xTg-AD) is the first mouse model to develop both plaque and tangle pathology in AD-relevant brain regions (Oddo et al., 2003b) and is often used to study human AD pathology. The 3xTg-AD mice harbor three mutant genes; APP695 with the Swedish mutation (K670M/N671L), PS1M146V and tauP301L, together promoting the overproduction of Aβ42 and tau. Despite equivalent overexpression of human APP and tau, intraneuronal Aβ accumulation and Aβ deposition precede tangle pathology, and both pathologies develop in an age-dependent manner with a temporal- and regional-specific profile that closely mimics their development in human AD brain (Oddo et al., 2003a). To examine whether the 3xTg-AD mice mimic the decreased Aβ degradation rate with progression of AD as observed in the hippocampus of human sAD, we measured qAβ40 degradation rate in hippocampal lysates of 3xTg-AD mice at the age of 3 months (no AD pathology), 9 months (starting AD pathology), 15 months (severe AD pathology), in parallel with wild-type age-matched controls (n = 3 per group). Interestingly, just like we observed in the APPswePS1dE9 mouse model, and in clear contrast with the human data, also the 3xTg-AD mice do not show any change in Aβ degradation capabilities with AD progression; at all stages of AD, the 3xTg-AD mice show equal qAβ40 degradation rates as those of age-matched wild-type controls (Fig. 4A). Inhibition of IDE resulted in decreased qAβ40 degradation, again showing IDE as the main peptidase-degrading Aβ. As expected from these results, IDE protein levels were equal at all stages of AD (Fig. 4B).

image

Figure 4. qAβ40 degradation during the progression of Alzheimer's disease (AD) in the 3xTg-AD mice. (A) qAβ40 degradation in mouse hippocampal lysates of both wild-type (solid bars) and 3xTg-AD mice (dotted bars) at 3, 9, and 15 months of age. Error bars represent standard error of the mean (SEM). (B) Upper panel: Western blot analysis of 3xTg-AD mice hippocampal lysates at 3, 9, and 15 months of age, stained for insulin-degrading enzyme (IDE) and β-actin (loading control). Lower panel: Western blot quantification of IDE protein levels in 3xTg-AD mice hippocampal lysates at different ages.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgments
  8. Funding
  9. References
  10. Supporting Information

In the present study, a unique qAβ40 peptide was used to screen for Aβ-degrading cytoplasmic peptidases. In addition, this quenched peptide was used to analyze Aβ degrading capacity in the hippocampus of sAD patients with different Braak stages as well as APPswePS1dE9 and 3xTg-AD mice. Since specifically the KLVFF region in the Aβ peptide was shown to mediate binding during polymerization and to be essential and sufficient for aggregation (Tjernberg et al., 1996), the quencher and fluorophore were positioned such that they are flanking this important region. A similar approach to generate a quenched Aβ42 was unsuccessful due to its high aggregation-prone properties, making it impossible to efficiently solubilize and fluorescently label the synthesized qAβ42 peptides. Using the qAβ40 peptide, Aβ degrading peptidases could be identified that are specifically cleaving inside the KLVFF region, which is of interest when studying changes in Aβ degradation underlying the development of AD and consequent plaque pathology. The present study shows IDE as the main peptidase that degrades cytoplasmic monomeric Aβ, cleaving inside the critical, aggregation-prone KLVFF sequence as previously suggested by HPLC and mass spectrometry analysis of Aβ fragments generated by IDE (Chesneau et al., 2000; Guo et al., 2010). Also, neprilysin is described to be able to cleave inside the KLVFF region; however, in the present study, cytoplasmic peptidases were examined, excluding the plasma membrane glycoprotein neprilysin. In addition, we provide evidence that IDE less efficiently degrades oligomeric Aβ and deficiencies in IDE activity might therefore lead to less Aβ degradation and subsequent Aβ oligomerization and accumulation. The present study is the first showing that the capacity to degrade Aβ is already decreased dramatically in Braak stage I and II of sAD, in contrast to nondemented controls that are efficiently degrading Aβ. Interestingly, degradation of Aβ is partly restored in stage III and then again decreased until stage VI. This decrease in Aβ degradation is in parallel with IDE protein levels, including the temporal revival in stage III. It is tempting to speculate that IDE levels are increased as a rescue mechanism to cope with AD pathology, but might also result from changes in IDE secretion. This pattern has not been described before, probably because previous studies were grouping different-staged AD patients together (Pérez et al., 2000; Zhao et al., 2007; Wang et al., 2010) and because peptidase activities were never investigated for the separate Braak stages. However, our study includes a relatively high number of individuals covering all stages of AD. It seems that the decrease in IDE activity is not the result of a general decrease in peptidase activities, because other peptidases did not show the same pattern of decreasing activity across the Braak stages (data not shown) (Reits et al., 2004). Also, it is unlikely that the observed pattern was caused by competition of the qAβ40 with increased endogenous Aβ for degradation by IDE, as endogenous Aβ levels were are a 10 000-fold lower than the added qAβ40 levels (Roher et al., 2009). In addition, increased endogenous Aβ levels are found in both hippocampal tissue of AD patients (Matsui et al., 2007), as well as in the APPswePS1dE9 and 3xTg-AD mouse models (Oddo et al., 2003a; Kamphuis et al., b). Together, these observations exclude a significant effect of competition or accelerated aggregation of endogenous Aβ levels as an alternative explanation for the correlation of IDE levels and Aβ degradation in sAD.

As intracellular Aβ accumulation is already occurring prior to plaque formation (Wirths et al., 2001; Youmans et al., 2012) and is described to be associated with cytotoxicity and neurodegeneration (Bayer & Wirths, 2010), this study was mainly interested in identifying cytoplasmic peptidases that are responsible for degrading intracellular Aβ and may cause Aβ accumulation when their activity is decreasing. Cytoplasmic IDE was shown to be such a peptidase degrading intracellular Aβ. However, in addition to its cytoplasmic form, IDE also has a neuronal transmembrane isoform, which is suggested to face the extracellular environment (Vekrellis et al., 2000), is present in peroxisomes (Chesneau et al., 1997), and can be secreted in exosomes by microglia (Qiu et al., 1998) and astrocytes (Jiang et al., 2008). In future studies, it would be interesting to investigate the role of these IDE isoforms and other peptidases present in specific organelles in degrading Aβ and whether these enzymes show altered levels during the progression to AD.

In addition, the mechanisms underlying the partial recovery of IDE protein levels and Aβ degradation at Braak stage III remain to be established. It should be noted that stage III is also the stage at which large transcriptional changes occur in human AD brain (Bossers et al., 2010). IDE mRNA levels were not changed with increasing Braak stage and thus did not correspond to altered protein levels of IDE. This suggests that changes in IDE protein levels that were observed in AD brain are caused by changes in IDE half-life or secretion. Interestingly, a similar decrease and temporal increase were observed when measuring qAβ40 degradation in the cerebrospinal fluid of sAD patients at different stages (manuscript in preparation), indicating that the ability to degrade Aβ may be globally affected in the central nervous system. Because changes in Aβ degradation can already be monitored during the earliest stages of the disease, this would provide possibilities to diagnose AD before the appearance of symptoms and the development of plaque pathology.

The present study also provides evidence that the commonly used mouse models APPswePS1dE9 and the 3xTg-AD mice, both showing increased Aβ42 production accompanied by dense-core plaque pathology in the brain (Jankowsky et al., 2004), do not mimic the alterations in Aβ clearance observed in human sAD. Neither changes in Aβ degradation with AD development nor changes in IDE levels were observed in these mice. A possible explanation for the observed difference between mice and men could be differences in neuronal loss, as APPswePS1dE9 mice do not show significant neuronal loss (Kamphuis et al., a), although this remains a point of debate (Wirths & Bayer, 2010). The level of neuronal loss in the 3xTg-Ad mouse models is also not yet established (LaFerla & Oddo, 2005). In contrast, significant neurodegeneration is thought to occur in the human brain; however, the extent to which neuronal loss occurs in the human hippocampal area in sAD is contradictory (Rossler et al., 2004). Because decreased IDE levels are already observed in Braak stage I and II in which there is not yet any significant neuronal cell loss, a more likely explanation would be the genetic background of the transgenic mice. Here, overproduction of the Aβ peptide is the primary cause for AD, in contrast to human sAD where decreased clearance of Aβ seems to be the primary mechanism underlying the development of the disease, also confirming previous data (Dorfman et al., 2010; Mawuenyega et al., 2010). Also, the present study is supporting this view by showing altered levels of IDE in human hippocampal tissue, but not in APPswePS1dE9 and 3xTg-AD mouse hippocampi. Furthermore, these data show that aging per se does not affect the IDE activity and IDE levels, because aging wild-type mice did also not show decreased Aβ degradation. The comparison of our results from mice and human show that mice data should be considered with caution, as they seem to be not representative for human sAD.

Materials and methods

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgments
  8. Funding
  9. References
  10. Supporting Information

Human subjects

Human postmortem tissue was obtained from the Netherlands Brain Bank (NBB; Amsterdam, the Netherlands). The brain donors have given informed consent for using the tissue and for accessing the extensive neuropathological and clinical information for scientific research, in compliance with ethical and legal guidelines (Huitinga et al., 2008). Included in this study were Braak stage 0 (n = 9) and I (n = 10), II (n = 9), III (n = 10), IV (n = 10), V (n = 10), and VI (n = 10). Samples were matched as closely as possible for age, sex, postmortem interval, pH-CSF and ApoE genotype. More detailed donor information is presented in Table 1.

Animals

Double APPswePS1dE9 transgenic mice expressed chimeric mouse/human APP containing the K595N/M596L Swedish mutation and human PS1 variant carrying the exon 9 deletion both driven by mouse prion promoter elements, directing the expression to neurons (Jankowsky et al., 2004). For details, see The Jackson Laboratory [strain B6C3-Tg(APPswe, PSEN1-dE9)85Dbo/J; stock number 004462; http://jaxmice.jax.org/]. AD mice were maintained as hemizygous and crossed with wild-type C57BL/6. Genotyping was performed by real-time PCR assays specific for the two transgenes and the prion promoter. The 3xTg-AD line was originally generated by comicroinjection of human APP (K670M/N671L) and tau (P301L) transgenes under the control of the Thy 1.2 promoter into mutant PS-1 (M146V) knock-in mice (Oddo et al., 2003b). For details, see The Jackson Laboratory [strain B6;129-Psen1tm1MpmTg(APPswe, tauP301L)1Lfa/Mmjax; stock number 004807; http://jaxmice.jax.org/]. Wild-type littermates served as controls for the AD animals. All animals were housed under standard conditions with access to water and food ad libitum. Animal handling and experimental procedures were reviewed and approved by the ethical committee for animal care and use of experimental animals of the Royal Netherlands Academy for Arts and Sciences, acting in accordance with the European Community Council directive of November 24, 1986 (86/609/EEC). All efforts were made to minimize suffering and number of animals used for the study presented here. Nine APPswePS1dE9 mice and nine wild-type mice were used, each divided in age groups 3 months (n = 3), 6 months (n = 3), and 18 months (n = 3). Also, nine 3xTg-Ad mice and again nine wild-type mice were used, each divided in age groups 3 months (n = 3), 6 months (n = 3), and 15 months (n = 3).

Protein isolation

HEK cells were lysed in 25 μm digitonin (Sigma-Aldrich, St. Louis, MO, USA) in KMH buffer (110 mm KAc, 2 mm MgAc and 20 mm Hepes-KOH, pH 7.2). Human and mouse brain hippocampal tissue was lysed in ± 400 μL (adjusted to the amount of tissue) of homogenization buffer [50 mm Tris/HCl pH 7.5, 250 mm sucrose, 5 mm MgCl2 and freshly added 2 mm ATP, 1 mm DTT, and 0.025% digitonin (Sigma)]. Tissue was homogenized on ice in homogenization buffer using a homogenizer. Cell lysates were incubated for 30 min on ice and centrifuged for 15 min at 20 800 g at 4 °C.

Quenched Aβ peptide degradation assays

Peptide synthesis

An Aβ40 peptide DAEFRHDSGYE(q)HHQKLVFFA(f)DVGSNKGAIIGLMVGGVV containing a fluorophore and quencher was synthesized as described before (Reits et al., 2004), introducing a fluorescein (f) at the cysteine (position 22) and a quenching dabcyl group (q) at position 12.

Quenched Aβ peptide degradation assay

HFIP-treated aliquots of Aβ40 were resuspended in DMSO followed by sonication for 10 min, immediately before use. 75 ng (340 nm) of quenched Aβ40 was added to 5 μg protein from the cell lysates in KMH buffer (110 mm KAc, 2 mm MgAc, and 20 mm Hepes-KOH, pH 7.2) to a total volume of 50 μL. Protease inhibitors [100 μm 1,10-phenanthroline, 200 μm bacitracin, 100 μm E64, 20 μm MG-132, 100 μm puromycin, 100 μm PMSF, 200 μm pepstatin A (all Sigma), 100 μm AAF-CMK, 100 μm amastatin or 50 μm bestatin (Enzo life sciences AG, Lausen, Switzerland), 50 μm PAQ-22 (Wako Chemicals, Osaka, Japan), 100 μm Cpp-AAF-pNa (InstruChem, Manila, Philippines), 50 μm PAQ-22 (SopaChem, Nieuwegein, The Netherlands), and 100 μm butabindide (Tocris Bioscience, Ellisville, MO, USA)] were added to the cell lysates and incubated for 30 min at 4 °C. Degradation of the peptide was analyzed at 37 °C using the FLUOstar OPTIMA (BMG Labtec., Jena, Germany).

Electron microscopy

Aβ peptide preparations were adsorbed on 300-mesh formar/copper grids for 2 min, and excess fluid was filtered off. Upon staining with 2.5% uranyl acetate for 2 min, grids were analyzed with a Fei technai-12 G2 transmission electron microscope.

RNA isolation and quantitative PCR

RNA from human and mouse hippocampal tissue was isolated using Trizol (Invitrogen, Carlsbad, CA, USA) and an overnight precipitation in isopropanol. Total RNA (1.0 μg) was DNAse I treated and used to generate cDNA (QuantiTect Reverse Transcription Kit; Qiagen, Hilden, Germany) using oligo-dT and random hexamer primers. The reverse transcriptase reaction was incubated at 42 °C for 30 min. The resulting cDNA was diluted 1:20 and served as a template in real-time qPCR assays. Real-time qPCR (SYBR® Green PCR Master Mix; Applied Biosystems, Nieuwerkerk, The Netherlands) for IDE was performed using forward primer GGACAGGTTTGCGCAGTTTT and reverse primer ACAGCGTTCACCTCTCTGTCTTT. Expression levels of human AD samples were normalized against a selection of 10 reference genes (GAPDH, ACTB, PPIA, UBE2D2, EEF1A, RPS27A, AARS, XPNPEP1, RPLP0, and IPO8) based on a geNorm analysis. The normalization factor was the geomean of the 10 reference genes. Samples with a RIN value below 5.0 were excluded from analysis based on a poor correlation with the normalization factor. Expression levels of mouse AD samples were normalized against a selection of four reference genes (GAPDH, HPRT, ACTB, and 18S rRNA). The geomean of the reference gene levels was used to normalize the assessed transcript levels of IDE.

Western blotting

Equal protein amounts obtained from the hippocampal cell lysates were separated on 7.5% SDS-PAGE gels. After electrophoresis, proteins were transferred either onto a 0.45-μm pore size PVDF membrane filter (Schleicher & Schuell, Dassel, Germany). Blots were blocked in 5% dry milk in TBS and incubated with the primary antibodies against IDE (1:500; Abcam, Cambridge, UK) and β-actin (1:500; Abcam) and subsequently with secondary antibodies IRDye 680 or IRDye 800 (1:15.000; LI-COR Biosciences, Lincoln, NE, USA). Signal was detected using the Odyssey imaging system (LI-COR Biosciences).

Acknowledgments

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgments
  8. Funding
  9. References
  10. Supporting Information

We would like to thank Klazien Bosch, Thanh Lee, Marius Liesdek, Marianne Spoolder, and Femke de Vrij for their experimental contributions. We thank Frank M. LaFerla for the 3xTgAD mice and David Borchelt for the APPswePS1dE9 mice. Postmortem human brain material was obtained from the Netherlands Brain Bank (www.brainbank.nl).

Funding

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgments
  8. Funding
  9. References
  10. Supporting Information

This work was supported by ISAO grant #08504 (WK and EMH), NWO-ALW-VICI grant # 865.09.003 (EMH and LK), HFSPO grant # RG0148/1999B (EMH), NWO-VENI grant #91646038 (JG and ER), and NWO-VIDI grant #91796315 (AS and ER).

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgments
  8. Funding
  9. References
  10. Supporting Information
  • Bayer TA, Wirths O (2010) Intracellular accumulation of amyloid-beta–a predictor for synaptic dysfunction and neuron loss in Alzheimer's disease. Front. Aging. Neurosci., Frontiers Research Foundation 2, 8.
  • Bertram L, Lill CM, Tanzi RE (2010) The genetics of Alzheimer disease: back to the future. Neuron 68, 270281.
  • Bossers K, Wirz KT, Meerhoff GF, Essing AH, van Dongen JW, Houba P, Kruse CG, Verhaagen J, Swaab DF (2010) Concerted changes in transcripts in the prefrontal cortex precede neuropathology in Alzheimer's disease. Brain 133, 36993723.
  • Braak H, Braak E (1991) Neuropathological stageing of Alzheimer-related changes. Acta Neuropathol. 82, 239259.
  • Bückig A, Tikkanen R, Herzog V, Schmitz A (2002) Cytosolic and nuclear aggregation of the amyloid ß-peptide following its expression in the endoplasmic reticulum. Histochem. Cell Biol., Springer 118, 353360.
  • Caccamo A, Oddo S, Sugarman MC, Akbari Y, LaFerla FM (2005) Age-and region-dependent alterations in Aβ-degrading enzymes: implications for Aβ-induced disorders. Neurobiol. Aging, Elsevier 26, 645654.
  • Chesneau V, Perlman RK, Li W, Keller GA, Rosner MR (1997) Insulin-degrading enzyme does not require peroxisomal localization for insulin degradation. Endocrinology 138, 34443451.
  • Chesneau V, Vekrellis K, Rosner M, Selkoe D (2000) Purified recombinant insulin-degrading enzyme degrades amyloid beta-protein but does not promote its oligomerization. Biochem. J., Portland Press Ltd 351, 509.
  • Dorfman VB, Pasquini L, Riudavets M, López-Costa JJ, Villegas A, Troncoso JC, Lopera F, Castaño EM, Morelli L (2010) Differential cerebral deposition of IDE and NEP in sporadic and familial Alzheimer's disease. Neurobiol. Aging 31, 17431757.
  • Guo Q, Manolopoulou M, Bian Y, Schilling AB, Tang W (2010) Molecular basis for the recognition and cleavages of IGF-II, TGF-α, and amylin by human insulin-degrading enzyme. Trends Pharmacol. Sci., Elsevier 395, 430443.
  • Hardy J, Allsop D (1991) Amyloid deposition as the central event in the aetiology of Alzheimer's disease. Science 12, 383.
  • Hardy J, Selkoe DJ (2002) The amyloid hypothesis of Alzheimer's disease: progress and problems on the road to therapeutics. Science, American Association for the Advancement of Science 297, 353356.
  • Huitinga I, Rademaker M, Klioueva N (2008) The art of brain banking in Europe: ethical, legal and practical guidelines for donor recruitment, tissue handling and tissue distribution. J. Neural Transm. 115, 1715.
  • Jankowsky JL, Fadale DJ, Anderson J, Xu GM, Gonzales V, Jenkins NA, Copeland NG, Lee MK, Younkin LH, Wagner SL (2004) Mutant presenilins specifically elevate the levels of the 42 residue β-amyloid peptide in vivo: evidence for augmentation of a 42-specific γ secretase. Hum. Mol. Genet., Oxford Univ Press 13, 159170.
  • Jiang Q, Lee CYD, Mandrekar S, Wilkinson B, Cramer P, Zelcer N, Mann K, Lamb B, Willson TM, Collins JL, Richardson JC, Smith JD, Comery TA, Riddell D, Holtzman DM, Tontonoz P, Landreth GE (2008) ApoE promotes the proteolytic degradation of Aβ. Neuron 58, 681693.
  • Kamphuis W, Mamber C, Moeton M, Kooijman L, Sluijs JA, Jansen AHP, Verveer M, de Groot LR, Smith BD, Rangarajan S, Rodríguez JJ, Orre M, Hol EM (2012) GFAP isoforms in adult mouse brain with a focus on neurogenic astrocytes and reactive astrogliosis in mouse models of Alzheimer disease. PLoS One 7, e42823.
  • Kamphuis W, Orre AM, Kooijman L, Dahmen M, Hol EM (2012) Differential cell proliferation in the cortex of the APPswePS1dE9 Alzheimer's disease mouse model. Glia 60, 615629.
  • Kurochkin IV, Goto S (1994) Alzheimer's β-amyloid peptide specifically interacts with and is degraded by insulin degrading enzyme. FEBS Lett. 345, 3337.
  • LaFerla FM, Oddo S (2005) Alzheimer's disease: Aβ, tau and synaptic dysfunction. Trends Mol. Med. 11, 170176.
  • LaFerla FM, Green KN, Oddo S (2007) Intracellular amyloid-beta in Alzheimer's disease. Nat. Rev. Neurosci. 8, 499509.
  • Lee EK, Park YW, Shin DY, Mook-Jung I, Yoo YJ (2006) Cytosolic amyloid-β peptide 42 escaping from degradation induces cell death. Biochem. Biophys. Res. Commun., Elsevier 344, 471477.
  • Li M, Chen L, Lee DHS, Yu LC, Zhang Y (2007) The role of intracellular amyloid [beta] in Alzheimer's disease. Prog. Neurobiol., Elsevier 83, 131139.
  • Matsui T, Ingelsson M, Fukumoto H, Ramasamy K, Kowa H, Frosch MP, Irizarry MC, Hyman BT (2007) Expression of APP pathway mRNAs and proteins in Alzheimer's disease. Brain Res., Elsevier 1161, 116123.
  • Mawuenyega KG, Sigurdson W, Ovod V, Munsell L, Kasten T, Morris JC, Yarasheski KE, Bateman RJ (2010) Decreased clearance of CNS beta-amyloid in Alzheimer's disease. Science 330, 1774.
  • Murrell J, Farlow M, Ghetti B, Benson MD (1991) A mutation in the amyloid precursor protein associated with hereditary Alzheimer's disease. Science, American Association for the Advancement of Science 254, 9799.
  • Nilsberth C, Westlind-Danielsson A, Eckman CB, Condron MM, Axelman K, Forsell C, Stenh C, Luthman J, Teplow DB, Younkin SG (2001) The'Arctic'APP mutation (E693G) causes Alzheimer's disease by enhanced Aβ protofibril formation. Nat. Neurosci., Nature Publishing Group 4, 887893.
  • O'Brien RJ, Wong PC (2011) Amyloid precursor protein processing and Alzheimer's disease. Annu. Rev. Neurosci. 34, 185204.
  • Oddo S, Caccamo A, Kitazawa M, Tseng BP, LaFerla FM (2003a) Amyloid deposition precedes tangle formation in a triple transgenic model of Alzheimer's disease. Neurobiol. Aging, Elsevier 24, 10631070.
  • Oddo S, Caccamo A, Shepherd JD, Murphy MP, Golde TE, Kayed R, Metherate R, Mattson MP, Akbari Y, LaFerla FM (2003b) Triple-transgenic model of Alzheimer's disease with plaques and tangles: intracellular Aβ and synaptic dysfunction. Neuron, Elsevier 39, 409421.
  • Oksman M, Iivonen H, Hogyes E, Amtul Z, Penke B, Leenders I, Broersen L, Lütjohann D, Hartmann T, Tanila H (2006) Impact of different saturated fatty acid, polyunsaturated fatty acid and cholesterol containing diets on beta-amyloid accumulation in APP/PS1 transgenic mice. Neurobiol. Dis., Elsevier 23, 563572.
  • Pérez A, Morelli L, Cresto JC, Castaño EM (2000) Degradation of soluble amyloid β-peptides 1–40, 1–42, and the Dutch variant 1–40Q by insulin degrading enzyme from Alzheimer disease and control brains. Neurochem. Res., Springer 25, 247255.
  • Qiu WQ, Walsh DM, Ye Z, Vekrellis K, Zhang J, Podlisny MB, Rosner MR, Safavi A, Hersh LB, Selkoe DJ (1998) Insulin-degrading enzyme regulates extracellular levels of amyloid beta-protein by degradation. J. Biol. Chem. 273, 3273032738.
  • Querfurth HW, LaFerla FM (2010) Alzheimer's disease. N. Engl. J. Med. 362, 329344.
  • Reits E, Neijssen J, Herberts C, Benckhuijsen W, Janssen L, Drijfhout JW, Neefjes J (2004) A major role for TPPII in trimming proteasomal degradation products for MHC class I antigen presentation. Immunity, Elsevier 20, 495506.
  • Roher AE, Esh CL, Kokjohn TA, Castaño EM, Van Vickle GD, Kalback WM, Patton RL, Luehrs DC, Daugs ID, Kuo Y, Emmerling MR, Soares H, Quinn JF, Kaye J, Connor DJ, Silverberg NB, Adler CH, Seward JD, Beach TG, Sabbagh MN (2009) Amyloid beta peptides in human plasma and tissues and their significance for Alzheimer's disease. Alzheimers. Dement. 5, 1829.
  • Rossler M, Zarski R, Bohl J, Ohm TG (2004) Stage-dependent and sector-specific neuronal loss in hippocampus during Alzheimer's disease. Acta Neuropathol. 103, 363369.
  • Schmitz A, Schneider A, Kummer MP, Herzog V (2004) Endoplasmic reticulum-localized amyloid β-peptide is degraded in the cytosol by two distinct degradation pathways. Traffic, Wiley Online Library 5, 89101.
  • Selkoe DJ (2001) Alzheimer's disease: genes, proteins, and therapy. Physiol. Rev. 81, 741766.
  • Song S, Lee H, Kam TI, Tai ML, Lee JY, Noh JY, Shim SM, Seo SJ, Kong YY, Nakagawa T (2008) E2–25K/Hip-2 regulates caspase-12 in ER stress–mediated Aβ neurotoxicity. J. Cell. Biol., Rockefeller Univ Press 182, 675684.
  • Tam JH, Pasternak SH (2012) Amyloid and Alzheimer's disease: inside and out. Can. J. Neurol. Sci. 39, 286298.
  • Thinakaran G, Koo EH (2008) Amyloid precursor protein trafficking, processing, and function. J. Biol. Chem. 283, 2961529619.
  • Tjernberg LO, Naslund J, Lindqvist F, Johansson J, Karlstrom AR, Thyberg J, Terenius L, Nordstedt C (1996) Arrest of beta-amyloid fibril formation by a pentapeptide ligand. J. Biol. Chem. 271, 85458548.
  • Vekrellis K, Ye Z, Qiu WQ, Walsh D, Hartley D, Chesneau V, Rosner MR, Selkoe DJ (2000) Neurons regulate extracellular levels of amyloid beta-protein via proteolysis by insulin-degrading enzyme. J. Neurosci. 20, 16571665.
  • Wang S, Wang R, Chen L, Bennett DA, Dickson DW, Wang DS (2010) Expression and functional profiling of neprilysin, insulin-degrading enzyme, and endothelin-converting enzyme in prospectively studied elderly and Alzheimer's brain. J. Neurochem., Wiley Online Library 115, 4757.
  • Wirths O, Bayer TA (2010) Neuron loss in transgenic mouse models of Alzheimer's disease. Int. J. Alzheimers Dis. 2010, 723782.
  • Wirths O, Multhaup G, Czech C, Blanchard V, Moussaoui S, Tremp G, Pradier L, Beyreuther K, Bayer TA (2001) Intraneuronal Aβ accumulation precedes plaque formation in β-amyloid precursor protein and presenilin-1 double-transgenic mice. Neurosci. Lett., 306, 116120.
  • Yan P, Bero AW, Cirrito JR, Xiao Q, Hu X, Wang Y, Gonzales E, Holtzman DM, Lee JM (2009) Characterizing the appearance and growth of amyloid plaques in APP/PS1 mice. J. Neurosci. 29, 1070610714.
  • Yang AJ, Chandswangbhuvana D, Margol L, Glabe CG (1998) Loss of endosomal/lysosomal membrane impermeability is an early event in amyloid Aβ1-42 pathogenesis. J. Neurosci. Res., Wiley Online Library 52, 691698.
  • Youmans KL, Tai LM, Kanekiyo T, Stine WB Jr, Michon SC, Nwabuisi-Heath E, Manelli A, Fu Y, Riordan S, Eimer WA (2012) Intraneuronal Abeta detection in 5xFAD mice by a new Abeta-specific antibody. Mol. Neurodegener., BioMed Central Ltd 7, 8.
  • Zhao Z, Xiang Z, Haroutunian V, Buxbaum JD, Stetka B, Pasinetti GM (2007) Insulin degrading enzyme activity selectively decreases in the hippocampal formation of cases at high risk to develop Alzheimer's disease. Neurobiol. Aging, Elsevier 28, 824830.

Supporting Information

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgments
  8. Funding
  9. References
  10. Supporting Information
FilenameFormatSizeDescription
acel12074-sup-0001-FigS1-S2.docWord document519K

Fig. S1 Peptidases degrading qAβ40.

Fig. S2 IDE mRNA levels with sAD progression.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.