SEARCH

SEARCH BY CITATION

Keywords:

  • 5XFAD mice;
  • γ-secretase;
  • Alzheimer's disease;
  • amyloid;
  • conditional knockout mice;
  • nicastrin

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgments
  8. Disclosure
  9. Author contributions
  10. References
  11. Supporting Information

Production of Aβ by γ-secretase is a key event in Alzheimer's disease (AD). The γ-secretase complex consists of presenilin (PS) 1 or 2, nicastrin (ncstn), Pen-2, and Aph-1 and cleaves type I transmembrane proteins, including the amyloid precursor protein (APP). Although ncstn is widely accepted as an essential component of the complex required for γ-secretase activity, recent in vitro studies have suggested that ncstn is dispensable for APP processing and Aβ production. The focus of this study was to answer this controversy and evaluate the role of ncstn in Aβ generation and the development of the amyloid-related phenotype in the mouse brain. To eliminate ncstn expression in the mouse brain, we used a ncstn conditional knockout mouse that we mated with an established AD transgenic mouse model (5XFAD) and a neuronal Cre-expressing transgenic mouse (CamKIIα-iCre), to generate AD mice (5XFAD/CamKIIα-iCre/ncstnf/f mice) where ncstn was conditionally inactivated in the brain. 5XFAD/CamKIIα-iCre/ncstnf/f mice at 10 week of age developed a neurodegenerative phenotype with a significant reduction in Aβ production and formation of Aβ aggregates and the absence of amyloid plaques. Inactivation of nctsn resulted in substantial accumulation of APP-CTFs and altered PS1 expression. These results reveal a key role for ncstn in modulating Aβ production and amyloid plaque formation in vivo and suggest ncstn as a target in AD therapeutics.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgments
  8. Disclosure
  9. Author contributions
  10. References
  11. Supporting Information

Alzheimer's disease (AD), the major cause of dementia, is a progressive neurodegenerative disease characterized by memory impairment, intellectual deterioration, and behavioral abnormalities (Selkoe et al., 2012). Identification of mutations in the amyloid precursor protein (APP) and the PS1 gene in AD helped to elucidate the mechanism of Aβ generation and established γ-secretase cleavage of APP as a key event in AD pathogenesis (De Strooper et al., 1998). These findings identified the γ-secretase complex as a major therapeutic target in AD, yet clinical trials that targeted PS1, the catalytic subunit of the complex, were not successful, suggesting that the pathogenetic mechanism of AD that involves the γ-secretase processing of APP might be more complex than anticipated (Wolfe, 2012).

The γ-secretase is an intramembrane protease that processes type I transmembrane proteins, including APP and Notch, and consists of PS (1 or 2), nicastrin (ncstn), presenilin, Pen-2, and Aph-1 (Murphy et al., 2003). Preliminary studies using ncstn-deficient embryonic fibroblasts showed that ncstn is essential for APP cleavage and Aβ production (Li et al., 2003a,b). Ncstn has been shown to function as a γ-secretase substrate receptor that forms with Aph-1 an initial scaffolding precomplex, upon which the active γ-secretase complex is formed with the addition of PS1 and PEN-2 (Yu et al., 2000; Shah et al., 2005; Takeo et al., 2012; Zhang et al., 2012). The contribution of ncstn in the activity of the complex has been disputed as a γ-secretase complex composed of PS1/Pen2/Aph1 was shown to cleave APP and produce Aβ (Futai et al., 2009; Ahn et al., 2010). Moreover, new evidence suggested that ncstn is dispensable for PS1 activity, and PS1 can be catalytically active by itself without requiring the other subunits (Zhao et al., 2010). Due to the embryonic lethality of the ncstn knockout mice (Li et al., 2003a; Nguyen et al., 2006), all these studies were performed using in vitro cell culture systems that were able to provide limited conclusions on the role of ncstn in APP cleavage and Aβ production in AD pathogenesis and could not present evidence on the role of ncstn in amyloid deposition and amyloid plaque formation in the mouse brain in vivo.

To answer this controversy and to evaluate the effects of inactivation of ncstn on Aβ production and AD pathogenesis in vivo, we inactivated the ncstn gene in the brain of 5XFAD transgenic mice, an established AD mouse model, that expresses mutant APP and PS1 and develops amyloid plaques and intraneuronal amyloid aggregates (Oakley et al., 2006). To produce a 5XFAD brain–specific ncstn knockout mouse (5XFAD/CamKIIα-iCre/ncstnf/f), we crossed previously generated floxed ncstn mice (ncstnf/f) (Klinakis et al., 2011) to a neuronal-specific Cre recombinase transgenic mouse line (CamKIIα-iCre) (Yu et al., 2001) and to 5XFAD mice. 5XFAD/CamKIIα-iCre/ncstnf/f as well as CamKIIα-iCre/ncstnf/f mice developed a severe neurodegenerative phenotype and did not survive more than 12 weeks. Analysis of the amyloid phenotype of the 5XFAD/CamKIIα-iCre/ncstnf/f mice at 10 weeks of age revealed a significant reduction in amyloid deposition with the formation of intraneuronal Aβ aggregates in the mouse brains, while dense-core plaques, typical of extracellular fibrillary amyloid deposits found in AD, were not detected. Inactivation of ncstn resulted in accumulation of APP-CTFs detected by Western blotting, altered PS1 and PS1-CTFs, and significantly reduced Aβ production as revealed by ELISA analysis. Our findings show that ncstn is essential in amyloid deposition and confirm that ncstn plays an important role in Aβ production and the development of the amyloid-related phenotype in this AD mouse model.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgments
  8. Disclosure
  9. Author contributions
  10. References
  11. Supporting Information

Generation of 5XFAD/CamKIIα-iCre/ncstnf/f mice

To study the effects of the ncstn inactivation on the amyloid phenotype of the 5XFAD mice, we used a previously generated conditional ncstn knockout mouse (ncstnf/f) (Klinakis et al., 2011). To produce a neuronal conditional knockout ncstn mouse, we crossed ncstnf/f with CamKIIα-iCre mice (Yu et al., 2001). PCR analysis revealed complete recombination of the floxed alleles (Fig. S1, Supporting information). To monitor expression of the Cre, we use Ai27; ChR2(H134R)-tdTomato mice (Madisen et al., 2012). CamKIIα-iCre/Ai27 mice showed Cre expression in the brain from E10.5 (Fig. S2, Supporting information) up to 10 weeks (Fig. S3, Supporting information). To produce 5XFAD/CamKIIα-iCre/ncstnf/f mice, 5XFAD mice were crossed with floxed ncstnf/f mice and CamKIIα-iCre mice. 5XFAD/CamKIIα-iCre/ncstnf/f as well as CamKIIα-iCre/ncstnf/f mice did not survive longer than 12 weeks and developed a neurodegenerative phenotype (Figs S4 and S5, Supporting information).

Reduced amyloid deposition with the absence of amyloid plaques in the 5XFAD/CamKIIα-iCre/ncstnf/f mice

To determine the effects of ncstn inactivation on amyloid deposition, we analyzed 10-week-old female mice, as male 5XFAD mice show a significant delay in amyloid deposition, as we have previous reported (Fig. S7, Supporting information; Katsouri & Georgopoulos, 2011). A similar gender effect has also been reported on other AD mice (Kim et al., 2009).

Histological analysis with Thioflavine-S staining of sections of 5XFAD control brains confirmed the presence of dense-core plaques, typical of extracellular fibrillary amyloid deposits found in AD, in the subiculum of the hippocampus (Fig. 1A,C) and cortex (Fig. 1G). Analysis of 5XFAD/CamKIIα-iCre/ncstnf/f brain sections revealed the absence of dense-core amyloid plaques, in the hippocampus (Fig. 1B,D) and cortex (Fig. 1H). However, higher magnification confocal analysis of sections of 5XFAD/CamKIIα-iCre/ncstnf/f mice revealed the presence of small-size Thioflavine-S-positive aggregates with a distinctive punctate pattern in the subiculum of the hippocampus (Fig. 1F) as well as the cortex (Fig. 1J) in contrast to 5XFAD brains where dense-core plaques were detected both in the hippocampus (Fig. 1E) and in the cortex (Fig. 1I).

image

Figure 1. Lack of Thioflavine-S-positive amyloid plaques in 5XFAD/CamKIIα-iCre/ncstnf/f brains. (A, B) Sagittal sections of hippocampi of 5XFAD/CamKIIα-iCre/ncstnf/f (A) and control mice (B) with Thioflavine-S-positive deposits in the subiculum of the hippocampus of control brains only. (C, D) Thioflavine-S-positive amyloid plaques are present only in the subiculum of the hippocampus of control mice (C) as shown by confocal microscopy. (E, F) Higher magnification with confocal microscope reveals Thioflavine-S-positive amyloid plaques in the subiculum of control mice (E) and limited Thioflavine-S-positive smaller amyloid deposits in 5XFAD/CamKIIα-iCre/ncstnf/f mice (F). (G, H) Thioflavine-S-positive amyloid plaques are present only in the cortex of control mice (G) as shown by confocal microscopy and not in 5XFAD/CamKIIα-iCre/ncstnf/f mice (H). (I, J) Higher magnification with confocal microscope reveals Thioflavine-S-positive amyloid plaques in the cortex of control mice (I) and limited Thioflavine-S-positive small amyloid deposits in 5XFAD/CamKIIα-iCre/ncstnf/f mice (J). Scale bars: 500 μm (A, B), 150 μm (C, D, G, H), 50 μm (E, F, I, J).

Download figure to PowerPoint

To further characterize the amyloid deposits, we stained sections of 5XFAD/CamKIIα-iCre/ncstnf/f mice and control mice for Aβ using a fluorescent 6E10 antibody. Confocal microscopy of 5XFAD control brains confirmed the presence of amyloid plaques as well as of intraneuronal β-amyloid aggregates characteristic of the 5XFAD mice, as they have been described previously (Oakley et al., 2006). These amyloid deposits were detected both in the hippocampus (Fig. 2A,D,F) and in the cortex (Fig. 2H,J). The same analysis in the 5XFAD/CamKIIα-iCre/ncstnf/f brains revealed the presence of smaller size amyloid deposits both in the hippocampus (Fig. 2B,E,G) and in the cortex (Fig. 2I,K). Dense-core plaques like those observed in the hippocampus (Fig. 2F) and in the cortex (Fig. 2J) of control 5XFAD were not detected in the 5XFAD/CamKIIα-iCre/ncstnf/f brains (Fig. 2G,K). Quantification of amyloid deposition showed a reduction in the 5XFAD/CamKIIα-iCre/ncstnf/f brains both in the hippocampus and in the cortex, although this difference was statistically significant only in the hippocampus (= 0.0061; = 6) and not in the cortex (= 0.158; = 6; Fig. 2C).

image

Figure 2. Reduced amyloid deposits in 5XFAD/CamKIIα-iCre/ncstnf/f brains. (A, B) Immunofluorescence detection of Aβ, with confocal microscopy, reveals a significant reduction in amyloid deposits in the hippocampus of 5XFAD/CamKIIα-iCre/ncstnf/f mice (B) as opposed to controls (A). (C) Densitometric analysis showing a significant reduction in amyloid deposition in the hippocampus and the cortex of the 5XFAD/CamKIIα-iCre/ncstnf/f mice compared with controls (n = 6 per group, P = 0.0310) Values represent mean ± SEM of samples, ns=nonsignificant. (D–G) Immunofluorescence detection of Aβ, with confocal microscopy, reveals significant reduction in amyloid deposits and absence of dense-core plaques in the hippocampus of 5XFAD/CamKIIα-iCre/ncstnf/f mice (E) as opposed to controls (D). Higher magnification reveals a different pattern of amyloid deposits in control brains with amyloid plaques (F) compared with the 5XFAD/CamKIIα-iCre/ncstnf/f brains (G) where deposits are much smaller. (H–K) Immunofluorescence detection of Aβ, with confocal microscopy, reveals reduced amyloid deposition in the cortex of 5XFAD/CamKIIα-iCre/ncstnf/f mice (H) as opposed to controls (I). Higher magnification with confocal microscopy reveals the presence of amyloid in the control brains (F) compared with the 5XFAD/CamKIIα-iCre/ncstnf/f brains (G) where deposits are smaller. Scale bars: 150 μm (A, B), 100 μm (D, E, H, I), 50 μm (F, G, J, K).

Download figure to PowerPoint

To comprehend the different patterns of the amyloid deposits in the 5XFAD/CamKIIα-iCre/ncstnf/f brains, we performed higher magnification confocal analysis with triple labeling for Aβ, MAP2, which is a synaptic marker, and DAPI. In 5XFAD control mice, both amyloid deposits and intraneuronal β-amyloid aggregates were detected (Fig. 3A and Movie S1, Supporting information), in contrast to 5XFAD/CamKIIα-iCre/ncstnf/f mice where only intraneuronal β-amyloid aggregates were detected in the cell boundaries close to the nucleus (Fig. 2B and Movie S2, Supporting information). To detect amyloid deposits, we also used a biotin-labeled 6E10 antibody. DAB staining of amyloid deposits in 5XFAD control mice also confirmed the presence of amyloid plaques and β-amyloid aggregates (Fig. 3C), while 5XFAD/CamKIIα-iCre/ncstnf/f mice had only β-amyloid aggregates located in the cell boundaries (Fig. 3D). To evaluate production of Aβ in the 5XFAD/CamKIIα-iCre/ncstnf/f brains, we measured by ELISA Aβ40 and Aβ42 levels in brain protein extracts. Analysis for Aβ40/42 in the insoluble (guanidine fraction; P40 < 0.0001 and P42 = 0.0415) and soluble (lysis fraction; P40 = 0.0424 and P42 = 0.0043) fraction showed a statistically significant decrease in the 5XFAD/CamKIIα-iCre/ncstnf/f brains (Fig. 4A–D).

image

Figure 3. Intraneuronal Aβ aggregates in 5XFAD/CamKIIα-iCre/ncstnf/f brains. (A, B) Confocal microscope image analysis of brain sections of 5XFAD/CamKIIα-iCre/ncstnf/f mice and control mice stained with a fluorescent 6E10 antibody (green), MAP2 (red), and DAPI (blue) revealed the presence of intraneuronal Aβ aggregates (open arrows), which are characteristic in the 5XFAD mouse brains. However, in contrast to control 5XFAD mice where both intraneuronal Aβ aggregates (open arrows) and extracellular amyloid plaques (close arrows) were detected (A), 5XFAD/CamKIIα-iCre/ncstnf/f brains had only intraneuronal Aβ aggregates (B). (C, D) Microscope image analysis of DAB-stained sections of 5XFAD/CamKIIα-iCre/ncstnf/f and control brains with a biotinylated 6E10 antibody. 5XFAD control brains have both extracellular amyloid plaques (close arrows) and intraneuronal Aβ aggregates (open arrows), while 5XFAD/CamKIIα-iCre/ncstnf/f brains have only intraneuronal Aβ aggregates (open arrows). Scale bars: 12 μm (A, B), 10 μm (C, D). Additionally a three-dimensional reconstruction of the Z-stack sections of the amyloid plaques and the intraneuronal Aβ aggregates in the 5XFAD (Movie S1) and 5XFAD/CamKIIα-iCre/ncstnf/f mouse brains (Movie S2) can be seen in the Supplementary Material.

Download figure to PowerPoint

image

Figure 4. Reduced Aβ production with increased CTFs production and reduced PS1 levels in 5XFAD/CamKIIα-iCre/ncstnf/f brains. (A–D) Quantitation of Aβ40 (A and C) and Aβ42 (B and D) in the soluble (A and B) and insoluble (C and D) protein brain lysates by ELISA shows minimal production of Aβ42 and Aβ40 in the 5XFAD/CamKIIα-iCre/ncstnf/f mouse brains compared with control mice. Values represent mean ± SEM of samples, ns, nonsignificant. (E, F) Western blotting analysis (E) and densitometric (F) analysis of APP full-length (APP-fl) and CTFs in brain lysates reveal a massive increase in CTFs in the 5XFAD/CamKIIα-iCre/ncstnf/f mouse brains. Western blots show two representative samples per group. The experiment has been repeated three times (PCTFs = 0.0321). (G, H) Western blotting analysis (G) and densitometric (H) analysis of brain lysates of 5XFAD/CamKIIα-iCre/ncstnf/f and control mice reveal a significant decrease in nicastrin and PS1-CTFs levels, but no difference in Aph1 levels. Protein levels were standardized with tubulin. Western blots show two samples per group. The experiment has been repeated three times (Pncstn = 0.0269, PPS1 = 0.0091). Values represent mean ± SEM of samples, ns, nonsignificant.

Download figure to PowerPoint

These results clearly demonstrate that ncstn inactivation in the 5XFAD mouse brain has a major effect on the amyloid phenotype by reducing Aβ production and restricting amyloid plaques.

Accumulation of huAPP-CTFs and altered PS1 expression in the 5XFAD/CamKIIα-iCre/ncstnf/fmice

To evaluate the effect of inactivation of ncstn on APP processing, we used Western blotting analysis to detect APP-CTFs that are produced after the α- and β-cleavage. Immunoblotting analysis showed an extensive accumulation of APP-CTFs in the 5XFAD/CamKIIα-iCre/ncstnf/f brains compared with controls (= 0.0321; = 4) as a consequence of ncstn inactivation, suggesting that lack of ncstn has a major inhibitory effect on γ-secretase cleavage of APP. Full-length APP levels remained unchanged and showed no statistically significant differences (= 0.2621; = 4; Fig. 4E,F). Next, we analyzed 5XFAD/CamKIIα-iCre/ncstnf/f brain extracts by Western blotting for expression of ncstn, as well as for PS1 and Aph1. We detected low expression levels of ncstn compared with controls (= 0.0269; = 4), likely attributed to the production of ncstn by other cell types where Cre recombinase is not produced, such as astrocytes and microglia. PS1-CTFs expression was greatly reduced (= 0.0091; = 4; Fig. 4G,H), while PS1 holoprotein levels were increased possibly due to impaired PS1 endoproteolysis as a consequence of deletion of ncstn (Fig. S6, Supporting information). Finally, we detected no change in Aph-1 levels (= 0.8166; = 4; Fig. 4G,H). These data demonstrate that inactivation of ncstn has a major inhibitory effect on APP processing and affects PS1.

Increased astrocytosis and microgliosis in the 5XFAD/CamKIIα-iCre/ncstnf/fmice

Amyloid deposits in the 5XFAD mice are accompanied by increased gliosis. Analysis of 10-week-old 5XFAD mice showed increased astrocytosis and microgliosis surrounding amyloid deposits (Fig. 5A–H). To evaluate the effect of inactivation of ncstn in glial activation, we performed immunohistochemistry and Western blotting analysis of GFAP and Iba-1 markers for astrocytes and microglia, respectively. We found a significant increase for both GFAP and Iba-1 compared with controls that covered most of the hippocampus and cortex and was not restricted in the area where the amyloid deposits resided (Fig. 5B–F). Western blot analysis of total brain protein extracts confirmed this increase for both GFAP (= 0.0016; = 4; Fig. 5C,D) and Iba-1 (= 0.0098; = 4; Fig. 5G,H).

image

Figure 5. Increased glial response in 5XFAD/CamKIIα-iCre/ncstnf/f mice. (A, B) Immunofluorescence histochemistry for GFAP protein on 5XFAD/CamKIIα-iCre/ncstnf/f mouse brain sections (B) showing that ncstn deletion increases astrocytic response, compared with controls (A) (n = 4). (C, D) Western blotting analysis (C) and densitometric (D) analysis of brain lysates from 5X/CamKIIα-iCre/ncstnf/f and control mice. Protein levels were standardized with GAPDH. Quantification analysis shows significant increase in GFAP protein levels in 5X/CamKIIα-iCre/ncstnf/f (P = 0.0016).(E, F) Immunofluorescence histochemistry for Iba1 protein on 5XFAD/CamKIIα-iCre/ncstnf/f mouse brain sections (F) showing that ncstn deletion increases microglial response, compared with controls (E) (n = 4). (G, H) Western blotting analysis (G) and densitometric (H) analysis of brain lysates from 5X/CamKIIα-iCre/ncstnf/f and control mice for Iba1 protein. Protein levels were standardized with GAPDH. Quantification analysis shows significant increase in Iba1 protein levels in 5X/CamKIIα-iCre/ncstnf/f (P = 0.0098). Western blots show two samples per group, and the experiment has been repeated three times. Scale bars: 300 μm.

Download figure to PowerPoint

CamKIIα-iCre/ncstnf/f mice develop a severe neurodegenerative phenotype

CamKIIα-iCre/ncstnf/f mice similar to 5XFAD/CamKIIα-iCre/ncstnf/f mice did not survive longer than 12 weeks and exhibited a severe neurodegenerative phenotype with a clasping behavior with a hind leg clasping reflex (data not shown). We used the Ai27 mice (Madisen et al., 2012) to confirm the expression pattern of Cre by monitoring activation of tdTomato fluorescence. We detected embryonic expression of Cre recombinase in the CNS as early as E 10.5 and E 11.5 that was significantly increased at E 14.5 (Fig. S2, Supporting information) and persisted after birth until the age of 10 weeks when mice were sacrificed for analysis (Fig. S3, Supporting information). These results show a very early inactivation of the nctsn gene that is likely to be responsible for the lethality of the mice. To monitor the neurodegenerative phenotype, we analyzed CamKIIα-iCre/ncstnf/f mice at the age of 3 and 5 weeks. Three-week-old CamKIIα-iCre/ncstnf/f mice were normal similar to controls (Figs S4E–H and S5I–L, Supporting information). At 5 weeks, mice have started to develop neurodegeneration with reduced brain volume, increased ventricle size, and a reduction in synaptophysin and MAP2 (Figs S4C,D,G,H and S5E–H). Analysis of 10-week-old brain sections revealed a substantial reduction in cortical and hippocampal size with enlargement of lateral ventricles (Fig. S4A,B,G,H). Immunohistochemical analysis of synaptophysin and MAP-2 showed a significant reduction (Fig. S5A–D). These findings show that inactivation of ncstn triggers a progressive neurodegeneration that starts to develop around the 5th week.

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgments
  8. Disclosure
  9. Author contributions
  10. References
  11. Supporting Information

Accumulating evidence has established a central role for the γ-secretase complex in Aβ production and the pathogenesis of AD. PS (1 or 2), ncstn, Pen-2, and Aph-1 are the four components of the complex (Murphy et al., 2003), and with the exception of PS1, which is the catalytic subunit and has been shown to be essential for Aβ production (De Strooper et al., 1998) and amyloid plaque formation (Casanova et al., 2001; Saura et al., 2005), the role of the other members of the complex in the pathogenesis of AD is unclear (Steiner et al., 2008). The contribution of ncstn in γ-secretase cleavage of APP and Aβ production is ambiguous, and different functions have been attributed to ncstn. Ncstn has been implicated to be a substrate receptor, essential for APP and Notch cleavage (Kopan & Goate, 2002; Shah et al., 2005). A number of studies have suggested that ncstn forms with Aph-1, an initial scaffolding precomplex, upon which the active γ-secretase complex is formed (Yu et al., 2000), and ncstn has also been implicated in PS1 regulation and stability (Edbauer et al., 2002). Although it has been demonstrated in different studies that ncstn is essential in APP processing and Aβ production (Kimberly et al., 2003; Li et al., 2003a), recent reports have supported that ncstn might be dispensable for Aβ production (Futai et al., 2009; Ahn et al., 2010; Zhao et al., 2010). Most of these studies have been conducted using cell cultures or mouse embryonic fibroblasts from ncstn−/− embryos, as deletion of ncstn in mice is embryonic lethal (Li et al., 2003a; Nguyen et al., 2006), and subsequently, none of these studies has addressed the question whether ncstn is necessary for the development of the amyloid phenotype in vivo.

To elucidate the role of ncstn in the pathogenesis of the amyloid phenotype in an AD mouse model, we conditionally inactivated ncstn in the brain of the 5XFAD mice (Oakley et al., 2006), a transgenic mouse model that develops an aggressive amyloid phenotype, using a previously generated floxed ncstn mouse (Klinakis et al., 2011). To achieve inactivation of ncstn before the onset of the AD phenotype and formation of amyloid deposits, we chose a brain-specific Cre transgenic mouse that expresses Cre recombinase early (Yu et al., 2001).

Our first finding was that CamKIIα-iCre/ncstnf/f as well as 5XFAD/CamKIIα-iCre/ncstnf/f mice developed a progressive neurodegenerative phenotype starting at 5 weeks of age and resulted in early lethality at the age of 12 weeks. This phenotype is attributed to the deletion of ncstn and not related to the expression of the APP and PS1 transgenes in 5XFAD mice, as both CamKIIα-iCre/ncstnf/f and 5XFAD/CamKIIα-iCre/ncstnf/f mice develop the same neurodegenerative phenotype. Analysis of Cre recombinase expression showed an early embryonic expression starting at E 10.5 that causes a very early inactivation of ncstn in the CNS that is probably responsible for the early lethality of the mice. Also developmental abnormalities attributed to the irregular processing of other target genes of the γ-secretase, as APLP1 and APLP2, which is caused by the early inactivation of ncstn, could possibly contribute to the early lethality of the mice as neuronal migration and survival of Cajal–Retzius neurons could be affected (Herms et al., 2004). The neurodegenerative phenotype observed is consistent with a previous study by Tabuchi et al. (2009) where deletion of ncstn resulted in a similar neurodegenerative phenotype. This early expression of Cre recombinase recorded in this study explains the striking difference in the time of onset of the neurodegenerative phenotype observed between our mice and the Tabuchi et al.'s mice starting at the age of 6 months. In the Tabuchi et al.'s study, ncstn conditional knockout mice at the age of 2 months had still a 50% expression of ncstn in the brain compared with our CamKIIα-iCre/ncstnf/f mice where at 10 weeks of age, ncstn protein levels were a very small proportion of the wild-type ncstn levels. Beyond the age difference, as in the Tabuchi et al.'s study, our CamKIIα-iCre/ncstnf/f mice developed a similar progressive neurodegenerative phenotype with reduced brain volume and decreased levels of synaptic markers. Our data on the neurodegenerative phenotype of the CamKIIα-iCre/ncstnf/f mice clearly show the significant role of ncstn in the mouse brain and are consistent with this previous report (Tabuchi et al., 2009)

The second and major finding of this study was that inactivation of ncstn in the 5XFAD/CamKIIα-iCre/ncstnf/f mice did not abolish completely Aβ production and amyloid deposition; however, it restricted formation of extracellular amyloid plaques. ELISA analysis showed the presence of reduced yet detectable amounts of Aβ40 and Aβ42 peptides in the 5XFAD/CamKIIα-iCre/ncstnf/f brains. Histological analysis with Thioflavine-S, which stains fibrillary Aβ, or a 6E10-labeled antibody confirmed the presence of dense-core amyloid plaques and intraneuronal Aβ aggregates in the 5xFAD control brains, as previously described (Oakley et al., 2006). In the 5XFAD/CamKIIα-iCre/ncstnf/f brains, although we detected amyloid aggregates, with Thioflavine-S or a 6E10-labeled antibody, we did not detect dense-core plaques, typical of extracellular fibrillary amyloid deposits found in the 5XFAD brains. High-magnification confocal imaging analysis revealed in both 5xFAD and in 5XFAD/CamKIIα-iCre/ncstnf/f brains the presence of intraneuronal Aβ aggregates inside neuronal cell boundaries, but only the presence of dense-core amyloid plaques in the 5XFAD brains. These results suggest that although inactivation of ncstn does not block completely Aβ production, it has a major impact in amyloid plaque formation, restricting extracellular amyloid plaque formation. Because of the premature death of the 5XFAD/CamKIIα-iCre/ncstnf/f mice, we do not know whether amyloid plaques would have developed if mice could have lived longer; therefore, we cannot definitely conclude whether deletion of ncstn inhibits or delays formation of amyloid plaques using this experimental system. Nevertheless, our data clearly demonstrate that deletion of ncstn has a major impact on amyloid deposition in the mouse brain.

As previous studies have suggested, ncstn together with PS1 is responsible for the transportation and localization of the γ-secretase complex to the plasma membrane (Chung & Struhl, 2001; Kaether et al., 2002). Deletion of ncstn could possibly inhibit transportation of the complex to the plasma membrane, consequently limiting and restricting APP processing and Aβ production in the ER only and not in the plasma membrane, thus allowing only the formation of intraneuronal Aβ aggregates and inhibiting extracellular amyloid plaque formation. This could have been a possible explanation for the absence of extracellular amyloid plaques and the formation of intraneuronal Aβ aggregates in the 5XFAD/CamKIIα-iCre/ncstnf/f brains.

Although we detected low levels of ncstn protein in the 5XFAD/CamKIIα-iCre/ncstnf/f brains, we think that this is produced from astrocytes and microglia, cell types where Cre recombinase is not expressed and inactivation of ncstn gene does not take place. As expression of the APP and PS1 transgenes in the 5XFAD mice is restricted in neuronal cells only and not in astrocytes and microglia, it is very unlikely that the Aβ we detect is produced by astrocytes and microglia, where ncstn has not been deleted. In a similar study, where PS1 was conditionally inactivated in an AD mouse model upon mating with a CamKIIα-iCre transgenic mice, Aβ production in neuronal cells was completely abolished despite residual expression of PS1 by astrocytes and microglia in the AD mouse brains (Saura et al., 2005). Inactivation of ncstn markedly increased accumulation of huAPP-CTFs in the 5XFAD mouse brains, confirming the essential role of ncstn in APP processing in vivo. Deletion of ncstn had no effect on the expression levels of Aph1, confirming previous studies that had suggested that Aph1 expression is less dependent, compared with the other subunits of the γ-secretase complex, on changes in expression of the other members of the complex (De Strooper, 2003; Gu et al., 2003). Interestingly, deletion of ncstn had a major impact on PS1, and although PS1-CTFs were significantly reduced, PS1 holoprotein levels were increased. These data suggest a role for ncstn in PS1 endoproteolysis and maturation in vivo that is important for γ-secretase catalytic activity as it has been previously suggested (Edbauer et al., 2002).

In conclusion, our study provides evidence that ncstn modifies the amyloid-related phenotype of the 5XFAD mice. Production of Aβ is significantly reduced, but not completely abolished. More interestingly, dense-core plaques, typical of extracellular fibrillary amyloid deposits found in AD, are absent in the 5XFAD/CamKIIα-iCre/ncstnf/f mouse brains despite the residual presence of Aβ. Our study demonstrates that inactivation of ncstn has a protective effect on the amyloid-related phenotype in the 5XFAD Alzheimer's mouse model by restricting amyloid deposition and suggests ncstn as a target for the development of novel therapeutic strategies in AD.

Experimental procedures

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgments
  8. Disclosure
  9. Author contributions
  10. References
  11. Supporting Information

Generation of transgenic mice

5XFAD transgenic mice were obtained from The Jackson Laboratory (Bar Harbor, ME, USA), and CamKIIα-iCre mice, from Prof. Dr. Gunther Schutz (dkfz). Ai27; ChR2(H134R)-tdTomato mice were kindly provided by Dr. L. Zagoraiou (Biomedical Research Foundation, Academy of Athens). All mice used for the amyloid analysis were 10 weeks old. CamKIIα-iCre/Ai27-tdTomato mice were E 10.5, E 11.5, E 14.5, 0.5 days and 10 weeks old. Mouse genotyping was performed with PCR. Mice were housed in the SPF facility of the Biomedical Research Foundation and maintained on a standard chow diet containing 5% fat (Teklad; Harlan, Oxon, UK). All animal procedures were approved by the Bioethical Committee of the Biomedical Research Foundation and were in agreement with ethical recommendations of the European Communities Council Directive (86/609/EEC).

PCR analysis

Genomic DNA from tail biopsies was extracted with standard methods and was amplified by PCR using the following primers: F6 GTCCCTCTGCAGCATACTTTAGGTATC and R4 AGCTGGAACAG CAGAAGATAGGAAAG. Genomic DNA from hippocampus and cortex was amplified by PCR to evaluate the extent of recombination in the ncstn floxed allele mediated by the Cre recombinase using the following primers: F7 GACTAATCGTTACTCCAGGGGCAG and R4.

Tissue collection

Mice were anesthetized and brains were removed; left hemibrains were snap-frozen for protein analysis. Right hemibrains were fixed in 4% PFA in PBS for 48 h and cryoprotected in 20% sucrose in PBS for histology.

Protein extraction from brain tissue

Protein extraction from brains was carried out in three consecutive steps. Tissues were homogenized in ice-cold PBS, containing protease inhibitors (Complete Mini Protease Inhibitor Cocktail Tablets; Roche Applied Science, Indianapolis, IN, USA) with a Tissue homogenizer (Wheaton, Swedesboro, NJ, USA). The homogenate was centrifuged at 4 °C for 45 min. The pellets were resuspended in ice-cold lysis buffer (containing 10% glycerol, 1% Triton X-100 in PBS) and centrifuged. The supernatant (lysis fraction) was removed and used to evaluate soluble Aβ, ncstn, PS1-CTF, Aph1, GFAP, Iba1, APP, and CTFs. The pellet from the insoluble fraction was solubilized in 5 m Guanidine–HCl at room temperature for 3 h.

Western blot analysis

Equal amounts of total protein from hemibrains were resolved on SDS-PAGE, electrophoretically transferred to PVDF (Millipore, Billerica, MA, USA) or nitrocellulose membranes (Schleicher and Schuell, Dassel, Germany), and immunoblotted using either an anti-ncstn (1/1000; Santa Cruz Biotechnology, Santa Cruz, CA, USA), anti-PS1 terminal (PS1-CTF, 1:500; Millipore), anti-Aph1 (1:300; Millipore), anti-APP/CTF [1:2500; R1(57), a kind gift by Dr. P. Mehta (Anderson et al., 1989), Institute for Basic Research in Developmental Disabilities, Staten Island, NY, USA], anti-GFAP (1:3000; Sigma Aldrich, Steinheim, Germany), anti-Iba1 (1:300; Wako, Neuss, Germany), anti-GAPDH (1:400; Santa Cruz Biotechnology), or anti-tubulin (1:500; Sigma Aldrich) antibody. Blots were developed using enhanced chemiluminescence (Amersham Biosciences, Buckinghanshire, UK). Densitometric analysis was performed using the nih imagej. Protein concentration was determined by BCA protein assay (Pierce, Rockford, lL, USA).

40 and Aβ42 ELISAs

For Aβ ELISAs (Wako), lysis and guanidine homogenates were diluted with the ELISA sample buffer. Sample duplicates were then run on Aβ40- and Aβ42-specific sandwich colorimetric ELISAs following the protocol of the manufacturer. Optical densities at 450 nm of each well were read on a SpectraMax 190 (Molecular Devices, Sunnyvale, CA, USA) microplate reader, and sample Aβ40 and Aβ42 concentrations were determined by comparison with the Aβ40 and Aβ42 standard curves using the softmax pro 4.7.1 (Molecular Devices). Sample Aβ40 and Aβ42 concentration values were normalized to total brain protein concentrations. The average of the duplicates was determined, and then, the mean and SEM for each genotype were calculated.

Thioflavine-S staining

Six, 40-μm sagittal floating sections, 240 μm apart, were chosen for staining. Sections were immersed for 9 min in 1% Thioflavine-S aqueous solution (Sigma Aldrich), followed by washing in 80% ethanol and then in 95% ethanol, followed by three washes with ddH2O. Sections were mounted on Superfrost Plus slides (Fisher, Loughborough, UK) and coated with Vectashield (Vector Laboratories, Burlingame, CA, USA). Images were analyzed with the nih imagej. Imaging for immunofluorescence was performed on a Leica DMRA 2 microscope or with a Leica TCS SP5 confocal microscope, and image capture was performed using the leica application suite (version V3.6; Leica Microsystems GmbH, Wetzlar, Germany).

Nissl staining

20-μm sagittal floating sections were mounted on microscope slides (Thermo Scientific, Loughborough, UK) and were allowed to air-dry for 24 h. On the next day, sections were rehydrated in PBS for 10 min with continuous rotation. Following rehydration, slides were dyed with cresyl violet 0.5% in ddH2Ο for 8 min and promptly washed 1–2 times with excess ddH2Ο. For dye differentiation, the slides were immersed 1–2 times in diluted acetic acid [2–3 drops acetic acid (Fluka, Steinheim, Germany) in 100 mL ddH2Ο]. The sections were then dehydrated in 50–100% ethanols followed by xylene and coverslipped with dibutyl phthalate xylene mounting medium (BDH, Radnor, PA, USA). Imaging was performed with a DM LS2 Leica microscope, and image capture was carried out using the leica application suite (version V3.6) software. Images were analyzed with the NIH image j software.

DAB staining

For Aβ immunohistochemistry with the biotinylated 6E10 antibody, sections were incubated in 88% formic acid for 5 min, incubated for 30 min with 0.3% H2O2 in PBS-T (0.01 m PBS, pH 7.4), transferred into blocking solution containing 15% normal horse serum (Vector Laboratories) in PBS-T (0.01 m PBS, pH 7.4) for 60 min, and incubated overnight at 4 °C in blocking solution containing the biotinylated 6E10 primary antibody (1:1000; Covance, Emeryville, CA, USA). Sections were washed with PBS-T and incubated in avidin-biotinylated horseradish peroxidase complex (ABC Elite; Vector Laboratories) followed for 45 min at room temperature. Peroxidase labeling was visualized using 3, 3-diaminobenzidine/nickel (DAB/Ni; Vector Laboratories). After a 1-min incubation, sections were washed, dehydrated in 50–100% ethanol followed by xylene, and coverslipped with dibutyl phthalate xylene mounting medium (VWR). Imaging was performed with a DM LS2 Leica microscope, and image capture was carried out using the leica application suite (version V3.6). Images were analyzed with the NIH image j.

Immunofluorescence

For Iba-1, MAP-2, and synaptophysin labeling, 40-μm floating sections were blocked for 1–3 h in 10% FCS, 1% BSA, 0.01% Triton X-100 in PBS and incubated overnight at 4 °C with anti-Iba1 (1:250; Wako), anti-MAP-2 (1:200; Santa Cruz), and anti-synaptophysin (1:200; Santa Cruz) antibody in 1% FCS, 1% BSA, 0.01% Triton X-100 in PBS. Sections were washed with PBS and developed with an anti-rabbit secondary antibody (1:300; The Jackson Laboratory, Bar Harbor, ME, USA). For glial GFAP labeling, 40-μm sagittal floating sections were blocked for 1 h in TBS, 0.4% Triton X-100, supplemented with 5% goat serum, and then incubated for 1 h with an anti-GFAP (1:1000; Sigma) in the blocking solution. Sections were then washed with TBS and developed with an anti-rabbit antibody (1:300; The Jackson Laboratory, UK), all at room temperature. For Aβ labeling, 40-μm floating sections were washed three times, 5 min with TBS, and then permeabilized for 30 min in TBS-T (0.01 m TBS, pH 7.4, 0.1% Triton X-100). Sections were incubated in 98% formic acid for 5 min, washed with TBS and transferred to blocking solution with 15% normal horse serum (Vector Laboratories) in TBS-T for 60 min, and incubated overnight at 4 °C in blocking solution containing the Alexa Fluor 488 6E10 antibody (1:500; Covance). Sections were washed with TBS-T. Floating sections were mounted on slides coverslipped with Vectashield, with or without DAPI (Vector Laboratories). Forty-micro metre floating sections of CamKIIα-iCre/Ai27-tdTomato brains were stained with DAPI mounted on slides and coverslipped with Vectashield. Fluorescent photomicrographs were captured using a leica dmra 2 microscope or a Leica TCS SP5 confocal microscope and exported to leica application suite (version V3.6). Images were analyzed with the nih imagej. The Aβ load was defined as the percent area covered by Aβ immunoreactivity (% Aβ load).

Stereology

A series of 5–8 Nissl-stained vibratome sagittal brain sections (40 μm) of 3-, 5-, and 10-week-old mice were analyzed with a Leica DM RA2 microscope (n = 3). Brain volume and ventricle size were measured and analyzed using Stereo Investigator (MBF Bioscience, Williston, VT, USA).

Statistical analysis

Two-tailed unpaired Student's t-tests were used for statistical analysis, assuming equal sample variance. All data are expressed as mean ± SEM. Probability values P < 0.05 were considered significant. All statistical analyses were performed using graphpad prism (version 4.0; GraphPad Software, La Jolla, CA, USA).

Acknowledgments

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgments
  8. Disclosure
  9. Author contributions
  10. References
  11. Supporting Information

We thank Dr. A. Efstratiadis, Biomedical Research Foundation of the Academy of Athens (BRFAA), for generously providing the ncstnf/f mice, Dr. L. Zagoraiou (BRFAA) for the Ai27;ChR2(H134R)-tdTomato mice, and Dr. S. Pagakis and Dr. E. Rigana (BRFAA) for excellent support in confocal imaging. This study was supported entirely by BRFAA internal funding. K.T. was supported by Krauss Maffei Wegmann within the framework of Offset Benefits program No. 18A and Contract 13/2003, and K.S. was supported by the A. Onassis foundation.

Author contributions

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgments
  8. Disclosure
  9. Author contributions
  10. References
  11. Supporting Information

K.S., K.T., E.P., and E.T. performed the experiments and analyzed data. A.K. generated the ncstnf/f mice. S.G. conceived and designed the research and wrote the manuscript.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgments
  8. Disclosure
  9. Author contributions
  10. References
  11. Supporting Information
  • Ahn K, Shelton CC, Tian Y, Zhang X, Gilchrist ML, Sisodia SS, Li YM (2010) Activation and intrinsic gamma-secretase activity of presenilin 1. Proc. Natl. Acad. Sci. U.S.A. 107, 2143521440.
  • Anderson JP, Refolo LM, Wallace W, Mehta P, Krishnamurthi M, Gotlib J, Bierer L, Haroutunian V, Perl D, Robakis NK (1989) Differential brain expression of the Alzheimer's amyloid precursor protein. EMBO J. 8, 36273632.
  • Casanova E, Fehsenfeld S, Mantamadiotis T, Lemberger T, Greiner E, Stewart AF, Schutz G (2001) A CamKIIalpha iCre BAC allows brain-specific gene inactivation. Genesis 31, 3742.
  • Chung HM, Struhl G (2001) Nicastrin is required for Presenilin-mediated transmembrane cleavage in Drosophila. Nat. Cell Biol. 3, 11291132.
  • De Strooper B (2003) Aph-1, Pen-2, and Nicastrin with Presenilin generate an active gamma-Secretase complex. Neuron 38, 912.
  • De Strooper B, Saftig P, Craessaerts K, Vanderstichele H, Guhde G, Annaert W, Von Figura K, Van Leuven F (1998) Deficiency of presenilin-1 inhibits the normal cleavage of amyloid precursor protein. Nature 391, 387390.
  • Edbauer D, Winkler E, Haass C, Steiner H (2002) Presenilin and nicastrin regulate each other and determine amyloid beta-peptide production via complex formation. Proc. Natl. Acad. Sci. U.S.A. 99, 86668671.
  • Futai E, Yagishita S, Ishiura S (2009) Nicastrin is dispensable for gamma-secretase protease activity in the presence of specific presenilin mutations. J. Biol. Chem. 284, 1301313022.
  • Gu Y, Chen F, Sanjo N, Kawarai T, Hasegawa H, Duthie M, Li W, Ruan X, Luthra A, Mount HT, Tandon A, Fraser PE, St George-Hyslop P (2003) APH-1 interacts with mature and immature forms of presenilins and nicastrin and may play a role in maturation of presenilin nicastrin complexes. J. Biol. Chem. 278, 73747380.
  • Herms J, Anliker B, Heber S, Ring S, Fuhrmann M, Kretzschmar H, Sisodia S, Muller U (2004) Cortical dysplasia resembling human type 2 lissencephaly in mice lacking all three APP family members. EMBO J. 23, 41064115.
  • Kaether C, Lammich S, Edbauer D, Ertl M, Rietdorf J, Capell A, Steiner H, Haass C (2002) Presenilin-1 affects trafficking and processing of betaAPP and is targeted in a complex with nicastrin to the plasma membrane. J. Cell Biol. 158, 551561.
  • Katsouri L, Georgopoulos S (2011) Lack of LDL receptor enhances amyloid deposition and decreases glial response in an Alzheimer's disease mouse model. PLoS One 6, e21880.
  • Kim J, Castellano JM, Jiang H, Basak JM, Parsadanian M, Pham V, Mason SM, Paul SM, Holtzman DM (2009) Overexpression of low-density lipoprotein receptor in the brain markedly inhibits amyloid deposition and increases extracellular A beta clearance. Neuron 64, 632644.
  • Kimberly WT, LaVoie MJ, Ostaszewski BL, Ye W, Wolfe MS, Selkoe DJ (2003) Gamma-secretase is a membrane protein complex comprised of presenilin, nicastrin, Aph-1, and Pen-2. Proc. Natl. Acad. Sci. U.S.A. 100, 63826387.
  • Klinakis A, Lobry C, Abdel-Wahab O, Oh P, Haeno H, Buonamici S, van De Walle I, Cathelin S, Trimarchi T, Araldi E, Liu C, Ibrahim S, Beran M, Zavadil J, Efstratiadis A, Taghon T, Michor F, Levine RL, Aifantis I (2011) A novel tumour-suppressor function for the Notch pathway in myeloid leukaemia. Nature 473, 230233.
  • Kopan R, Goate A (2002) Aph-2/Nicastrin: an essential component of gamma-secretase and regulator of Notch signaling and Presenilin localization. Neuron 33, 321324.
  • Li J, Fici GJ, Mao CA, Myers RL, Shuang R, Donoho GP, Pauley AM, Himes CS, Qin W, Kola I, Merchant KM, Nye JS (2003a) Positive and negative regulation of the gamma-secretase activity by nicastrin in a murine model. J. Biol. Chem. 278, 3344533449.
  • Li T, Ma G, Cai H, Price DL, Wong PC (2003b) Nicastrin is required for assembly of presenilin/gamma-secretase complexes to mediate Notch signaling and for processing and trafficking of beta-amyloid precursor protein in mammals. J. Neurosci. 23, 32723277.
  • Madisen L, Mao T, Koch H, Zhuo JM, Berenyi A, Fujisawa S, Hsu YW, Garcia AJ III, Gu X, Zanella S, Kidney J, Gu H, Mao Y, Hooks BM, Boyden ES, Buzsaki G, Ramirez JM, Jones AR, Svoboda K, Han X, Turner EE, Zeng H (2012) A toolbox of Cre-dependent optogenetic transgenic mice for light-induced activation and silencing. Nat. Neurosci. 15, 793802.
  • Murphy MP, Das P, Nyborg AC, Rochette MJ, Dodson MW, Loosbrock NM, Souder TM, McLendon C, Merit SL, Piper SC, Jansen KR, Golde TE (2003) Overexpression of nicastrin increases Abeta production. FASEB J. 17, 11381140.
  • Nguyen V, Hawkins C, Bergeron C, Supala A, Huang J, Westaway D, St George-Hyslop P, Rozmahel R (2006) Loss of nicastrin elicits an apoptotic phenotype in mouse embryos. Brain Res. 1086, 7684.
  • Oakley H, Cole SL, Logan S, Maus E, Shao P, Craft J, Guillozet-Bongaarts A, Ohno M, Disterhoft J, Van Eldik L, Berry R, Vassar R (2006) Intraneuronal beta-amyloid aggregates, neurodegeneration, and neuron loss in transgenic mice with five familial Alzheimer's disease mutations: potential factors in amyloid plaque formation. J. Neurosci. 26, 1012910140.
  • Saura CA, Chen G, Malkani S, Choi SY, Takahashi RH, Zhang D, Gouras GK, Kirkwood A, Morris RG, Shen J (2005) Conditional inactivation of presenilin 1 prevents amyloid accumulation and temporarily rescues contextual and spatial working memory impairments in amyloid precursor protein transgenic mice. J. Neurosci. 25, 67556764.
  • Selkoe D, Mandelkow E, Holtzman D (2012) Deciphering Alzheimer disease. Cold Spring Harb. Perspect. Med. 2, a011460.
  • Shah S, Lee SF, Tabuchi K, Hao YH, Yu C, LaPlant Q, Ball H, Dann CE III, Sudhof T, Yu G (2005) Nicastrin functions as a gamma-secretase-substrate receptor. Cell 122, 435447.
  • Steiner H, Fluhrer R, Haass C (2008) Intramembrane proteolysis by gamma-secretase. J. Biol. Chem. 283, 2962729631.
  • Tabuchi K, Chen G, Sudhof TC, Shen J (2009) Conditional forebrain inactivation of nicastrin causes progressive memory impairment and age-related neurodegeneration. J. Neurosci. 29, 72907301.
  • Takeo K, Watanabe N, Tomita T, Iwatsubo T (2012) Contribution of the gamma-secretase subunits to the formation of catalytic pore of presenilin 1 protein. J. Biol. Chem. 287, 2583425843.
  • Wolfe MS (2012) Gamma-Secretase inhibitors and modulators for Alzheimer's disease. J. Neurochem. 120(Suppl 1), 8998.
  • Yu G, Nishimura M, Arawaka S, Levitan D, Zhang L, Tandon A, Song YQ, Rogaeva E, Chen F, Kawarai T, Supala A, Levesque L, Yu H, Yang DS, Holmes E, Milman P, Liang Y, Zhang DM, Xu DH, Sato C, Rogaev E, Smith M, Janus C, Zhang Y, Aebersold R, Farrer LS, Sorbi S, Bruni A, Fraser P, St George-Hyslop P (2000) Nicastrin modulates presenilin-mediated notch/glp-1 signal transduction and betaAPP processing. Nature 407, 4854.
  • Yu H, Saura CA, Choi SY, Sun LD, Yang X, Handler M, Kawarabayashi T, Younkin L, Fedeles B, Wilson MA, Younkin S, Kandel ER, Kirkwood A, Shen J (2001) APP processing and synaptic plasticity in presenilin-1 conditional knockout mice. Neuron 31, 713726.
  • Zhang X, Hoey RJ, Lin G, Koide A, Leung B, Ahn K, Dolios G, Paduch M, Ikeuchi T, Wang R, Li YM, Koide S, Sisodia SS (2012) Identification of a tetratricopeptide repeat-like domain in the nicastrin subunit of gamma-secretase using synthetic antibodies. Proc. Natl. Acad. Sci. U.S.A. 109, 85348539.
  • Zhao G, Liu Z, Ilagan MX, Kopan R (2010) Gamma-secretase composed of PS1/Pen2/Aph1a can cleave notch and amyloid precursor protein in the absence of nicastrin. J. Neurosci. 30, 16481656.

Supporting Information

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgments
  8. Disclosure
  9. Author contributions
  10. References
  11. Supporting Information
FilenameFormatSizeDescription
acel12131-sup-0001-FigS1.tifimage/tif1006KFig. S1 Analysis of Cre induced recombination of the ncstn floxed allele in 5XFAD/CamKIIα-iCre/ncstnf/f and control mice.
acel12131-sup-0002-FigS2.tifimage/tif1309KFig. S2 Characterization of embryonic Cre expression at E 10.5, E 11.5 and E 14.5 CamKIIα-iCre/Ai27-tdTomato embryos.
acel12131-sup-0003-FigS3.tifimage/tif9345KFig. S3 Characterization of Cre expression of 0.5 day and 10 week old CamKIIα-iCre/Ai27-tdTomato mice.
acel12131-sup-0004-FigS4.tifimage/tif3150KFig. S4 CamKIIα-iCre/ncstnf/f mice develop a neurodegenerative phenotype with reduced brain volume and enlarged brain ventricles.
acel12131-sup-0005-FigS5.tifimage/tif4986KFig. S5 CamKIIα-iCre/ncstnf/f mice develop a neurodegenerative phenotype with reduced MAP-2 and synaptophysin.
acel12131-sup-0006-FigS6.tifimage/tif147KFig. S6 PS1 holoprotein levels are increased in 5XFAD/CamKIIα-iCre/ncstnf/f mouse brains.
acel12131-sup-0007-FigS7.tifimage/tif444KFig. S7 Increased amyloid deposition in 5XFAD female mice compared with males.
acel12131-sup-0008-MovieS1.avivideo/avi23985K 
acel12131-sup-0009-MovieS2.avivideo/avi23701K 

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.