SEARCH

SEARCH BY CITATION

Keywords:

  • Bronchiolitis obliterans;
  • cyclosporine A;
  • obliterative airway disease;
  • T cells;
  • transplantation and immunology

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. Disclosure
  9. References
  10. Supporting Information

Calcineurin-inhibitor refractory bronchiolitis obliterans (BO) represents the leading cause of late graft failure after lung transplantation. T helper (Th)2 and Th17 lymphocytes have been associated with BO development. Taking advantage of a fully allogeneic trachea transplantation model in mice, we addressed the pathogenicity of Th cells in obliterative airway disease (OAD) occurring in cyclosporine A (CsA)-treated recipients. We found that CsA prevented CD8+ T cell infiltration into the graft and downregulated the Th1 response but affected neither Th2 nor Th17 responses in vivo. In secondary mixed lymphocyte cultures, CsA dramatically decreased donor-specific IFN-γ production, enhanced IL-17 production and did not affect IL-13. As CD4+ depletion efficiently prevented OAD in CsA-treated recipients, we further explored the role of Th2 and Th17 immunity in vivo. Although IL-4 and IL-17 deficient untreated mice developed an OAD comparable to wild-type recipients, a single cytokine deficiency afforded significant protection in CsA-treated recipients. In conclusion, CsA treatment unbalances T helper alloreactivity and favors Th2 and Th17 as coexisting pathways mediating chronic rejection of heterotopic tracheal allografts.


Abbreviations
BO

bronchiolitis obliterans

CNI

calcineurin inhibitor

CsA

cyclosporine A

GIL

graft infiltrating lymphocyte

HTT

heterotopic trachea transplantation

NF-AT

nuclear factor of activated T cells

NF-κB

nuclear factor-kappa B

OAD

obliterative airway disease

Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. Disclosure
  9. References
  10. Supporting Information

Introduction of calcineurin inhibitors (CNIs) has significantly reduced acute rejection rates and was anticipated to have implications for long-term prognosis [1]. However, current data indicate that, contrary to expectations, long-term survival rates poorly reflect short-term improvements. Lung transplantation (LTx), which remains the only therapeutic approach for end-stage lung failure, is no exception. The 1-year survival rate for LTx is >80% whereas the 10-year survival rate does not exceed 23% [1]. Bronchiolitis obliterans (BO) is the leading cause of late failure after lung transplantation. Although immune mechanisms including T cell-mediated alloreactivity and autoimmunity appear to be central to the pathology of BO, detailed mechanisms remain poorly understood. Recent reports in rodents and in humans suggest a role for the involvement of Th2 [2] and Th17 [3, 4] in the pathogenesis of BO, although the latter may still be controversial [5]. Whereas the large majority of lung transplant recipients receive CNI-based immunosuppressive regimens, more than 50% develop BO [6]. This suggests that mechanisms underlying BO resist treatment by CNIs or could even be promoted by these drugs.

Cyclosporine A (CsA) represents the prototypic calcineurin inhibitor (CNI). When bound to the intracellular cyclophilin, CsA inhibits the enzymatic activity of calcineurin. As calcineurin permits the nuclear translocation of the nuclear factor of activated T cells (NFAT), CNIs are classically known to downregulate IL-2 synthesis, therefore ultimately preventing Th1, CD8 and NK cell functions and IFN-γ synthesis. However, IL-2−/− and IFN-γ−/− mice have conserved immune capacities and reject cardiac allografts at rates comparable to WT animals [7] and IL-2−/− or IL-2R−/− mice experience deregulated T cell activation and generalized autoimmune disease [8, 9]. In contrast, the suppressive impact of CNIs on Th2 and Th17 pathways is controversial [10-16]. Several studies have shown that CNIs affect pathways other than NFAT, such as nuclear factor-kappa B (NF-κB) or ETS-like transcription factor 1 (ELK-1) [17, 18]. The current view is that the immunosuppressive properties of CNIs result from the inhibition of calcineurin but downstream mechanisms are not known [19].

In the heterotopic trachea transplantation (HTT) model described by Hertz [20], fully allogeneic tracheas develop an obliterative airway disease (OAD) that is considered an experimental model of BO. In this setting, T cells have been shown to be essential, as attested by OAD prevention in lymphopenic recipients [21]. Among T cell subsets, CD4+ dominate CD8+ as evidenced by the fact that OAD is unaffected in CD8−/− recipients and CD4−/− recipients show a significant delay of rejection [22]. In this study, we used the HTT model to investigate the pathogenicity of T helper cells in experimental BO in the context of CsA treatment.

Materials and Methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. Disclosure
  9. References
  10. Supporting Information

Mice

Wild-type C57BL/6 (B6) and BALB/C (B/C) mice were purchased from Harlan, Netherlands. IL-17A−/− B6 mice were kindly provided by Dr Iwakura (University of Tokyo, Tokyo, Japan). IL-4−/− B6 and IFN-γ−/− B/C mice were purchased from the Jackson Laboratory (Bar Harbor, ME, USA). Eight- to 12-week old animals were used and animals were bred in the Institute for Medical Immunology pathogen-free animal facility. All animals received humane care in compliance with the Principles of Laboratory Animal Care formulated by the National Institute of Health (Guide for the Care and Use of Laboratory Animals, Eighth Edition, National Research Council, 2010) and protocols were approved by the local committee for animal welfare.

Heterotopic trachea transplantation

HTT was performed according to an adaptation of the method of Hertz [20]. Briefly, donor mice were euthanized in 100% CO2. Donor hearts and lungs were then exposed via a midline incision through the skin and peritoneum extending through the rib cage and sternal notch. Thymus tissue was dissected away. The trachea was separated from the esophagus by blunt dissection, excised from the first tracheal ring to the main bronchi and placed in 0.9% sodium chloride until transplantation. Recipient mice were anaesthetized with a mixture of xylazine (Rompun) 5% and ketamine 10% in phosphate-buffered saline (PBS). After shaving a surface of 0.5 cm × 0.5 cm over the left scapula, a 3 mm incision was made through the dermis and a 1.5 cm × 0.5 cm pouch was created by blunt dissection over the posterior upper back area. One trachea was placed in each pouch. Skin was then closed with 5/0 silk suture. The time between recovering and transplantation never exceeded 15 min. Recipient mice were monitored until full recovery and then every day until killed. At the time of recovering, recipient mice were killed by cervical dislocation and grafts were removed by blunt dissection.

In vivo treatments

When specified, animals were treated daily with 25 mg/kg CsA (Sandimmun, Novartis Pharma). Treatment always started on the day of transplantation. CsA trough levels at 24 and 48 h were 1185 ± 128 ng/mL and 645 ± 240 ng/mL, respectively (n = 5 mice/group). Analyses were performed using a liquid chromatography tandem-mass-spectrometry technique (LC-MS/MS) with the Mass Tox® ONE minute test (Chromsystems GMBH, Grafelfing, Germany). Chromatographic separation was carried out using a 1260 Infinity HPLC system, (Agilent Technologies, Diegem, Belgium). The MS/MS detection was performed using an Agilent Technologies 6460 Triple Quad LC-MS/MS with a Jet Stream electrospray source ionization.

When specified, 500 μg of a depleting anti-CD4 cocktail (YTS191 + YTA3.1.2) or isotype control (YCATE, both provided by Stephen Cobbold, Sir Dunn School of Pathology, Oxford University, UK) was intraperitoneally injected on days 0, 2, 4, 7, 14 and 21 after trachea transplantation. Depletion efficiency of >90% was measured by flow cytometry on draining lymph node cells at the time of recover.

Histopathology and CK14 immunostaining

For pathological assessment, grafts were recovered 28 days after transplantation. Cross-sectional specimens were fixed in 4% formaldehyde and embedded in paraffin. For pathological assessment, 5 μm sections were cut and stained with hematoxylin-eosin, Masson's trichrome and Periodic acid-Schiff (PAS). All specimens were examined in blind fashion and scored as previously described [23]. Briefly, all qualitative histological changes were noted, and four easily identifiable pathological items were scored: (a) airway lining epithelial loss, (b) luminal obliteration due to granulation tissue formation and/or fibrosis, (c) deposition of extracellular matrix (ECM) and (d) leukocyte infiltration. For (a) and (b), the score ranged from 0 to 4: 0 = no change, 1 = mild (<25%), 2 = moderate (25–50%), 3 = severe (50–75%) and 4 = very severe damage (>75%). For the ECM deposition, the score was 0 = no change, 1 = mild, 2 = moderate, 3 = dense and 4 = very dense collagen deposition evaluated after Masson's trichrome staining. For the leukocyte infiltration, the score was 0 = no change, 1 = mild perivascular infiltrates, 2 = moderate perivascular changes, 3 = severe diffuse infiltration and 4 = very severe diffuse infiltration with subepithelial and epithelial components.

For CK14 immunostaining, 5 μm paraffin sections were cut, deparaffinized and rehydrated. Endogenous peroxidase activity was first quenched by H2O2 peroxidase blocking reagent (DakoCytomation). Sections were then incubated with 1/100 diluted anti-CK14 antibody (clone LL002, Novocastra, UK) for 20 min at room temperature. Sections were then washed and incubated with 1/500 diluted biotinylated goat antirabbit antibody (Jackson Immunoresearch, West Grove, PA, USA) for 20 min at room temperature. Thereafter, streptavidin-HRP was added and coloration was revealed using diaminobenzidine (DAB) with the substrate chromogen system from DakoCytomation. The total number of positive cells was considered for each section.

Flow cytometry

To isolate graft infiltrating and draining lymph node (DLN) lymphocytes, trachea transplants and DLNs were minced and then incubated at 37°C for 2 h with type I collagenase at 2 mg/mL (Sigma) in a phosphate buffered solution. IFN-γ and IL-17A intracytoplasmic stainings were performed after cell incubation with 50 ng/mL PMA and 500 ng/mL ionomycin for 4 h with brefeldin A (10 μg/mL) in the last 2 h. For IL-5 staining, the cells were incubated in PMA/ionomycin with Golgi Plug (BD Biosciences) for 4 h. The cells were then washed with PBS with 0.1% Bovine Serum Albumin and 0.01% NaN3, incubated for 10 min with Fc block and then stained for surface markers for 20 min. After fixation and permeabilization with CytoFix/CytoPerm (BD Biosciences), cells were washed in PermWash buffer (BD Biosciences) and labeled with anticytokine antibodies. Cytometry analysis was performed on a CyAn-LX cytometer using Summit 4.1 software (DakoCytomation, Golstrup, Denmark). Pacific-Blue (PB) conjugated antimouse CD8 (clone 53–6.7) or antimouse CD3ε (clone 500A2), Phycoerythrin (PE) conjugated antimouse CD4 (clone RM4–5), antimouse IL5 (clone TRFK5) or antimouse H-2Kb (clone AF6-88.5), Fluorescein isothiocyanate (FITC) conjugated antimouse IFN-γ (clone XMG1.2), antimouse CD4 (clone RM4–5), peridinin-chlorophyll-protein complex (PerCP) conjugated antimouse CD3ε (clone 145–2C11) and antimouse CD16/CD32 (Fc block, clone 2.4G2) monoclonal antibodies and isotype controls were purchased from BD Pharmingen. APC conjugated antimouse IL-17A (clone eBio17B7) was purchased from eBiosciences.

RNA extraction and real-time RT-PCR

Total RNA was extracted from skin grafts using the MagnaPure LC RNA Isolation Kit III for tissue (Roche Diagnostics). Reverse transcription and real-time PCR were performed using LightCycler-RNA Master Hybridization Probes (one-step procedure) on a Lightcycler 480 apparatus (Roche Diagnostics). The number of mRNA copies was evaluated by using a standard curve for each gene of interest and was normalized to β-actin as the housekeeping gene. Primer and probe sequences were as follows: β-actin: forward CCGAAGCGGACTACTATGCTA, reverse TTTCTCATAGATGGCGTTGTTG, probe ATCGGTGGCTCCATCCTGGC; IFN-γ: forward GGATGCATTCATGAGTATTGC, reverse GCTTCCTGAGGCTGGATTC, probe TTTGAGGTCAACAACCCACAGGTCCA; IL-17A: forward GCTCCAGAAGGCCCTCAG, reverse CTTTCCCTCCGCATTGACA, probe ACCTCAACCGTTCCACGTCACCCTG; IL-13: forward GACCTGAGCAACATCACACAA, reverse GCCAGGTCCACACTCCATAC, probe CCCTGTGCAACGGCAGCATG.

MLC and cytokine production

Cells isolated from spleens of naive, control or CsA-treated transplanted mice were used as responders (8 × 106 cells/mL) and stimulated with 1 × 107 cells/mL syngeneic B6 or allogeneic B/C irradiated splenocytes (2000 rad) in 96-well U-bottom plates (Cellstar, Greiner Bio-One, Belgium). Cultures were incubated at 37°C in a 5% CO2 atmosphere in medium consisting of RPMI 1640 supplemented with 2mM L-glutamine, 1 mM nonessential amino acids, 5% heat-inactivated FCS and 1 mM sodium pyruvate. IFN-γ, IL-13 and IL-17A production were measured in culture supernatants after 96 h using commercially available ELISA kits (Duoset; R&D Systems, Minneapolis, MN, USA). The detection threshold was <20 pg/mL for all cytokines.

Statistical analyses

Statistical analyses of differences between groups were performed using the two-tailed Mann–Whitney nonparametric test except for differences between cell culture triplicates that were determined by an unpaired t-test. p < 0.05 was considered statistically significant.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. Disclosure
  9. References
  10. Supporting Information

Posttransplant obliterative airway disease develops under CsA treatment

HTT was performed as described by Hertz et al. [20]. In this context, we looked at the effect of CsA treatment on the development of posttransplant OAD. Syngeneic B6 or fully allogeneic B/C tracheas were grafted into B6 recipients treated, or not, with 25 mg/kg CsA, starting at day 0 and during the whole posttransplantation period. With this dosage, CsA trough levels were 1185 ± 128 ng/mL. Grafts were recovered at day 28 posttransplantation and pathologic scores were determined as described in materials and methods. OAD did not develop in the absence of alloantigens, as demonstrated by the presence of a normal pseudostratified epithelium without collagen deposition in both untreated and CsA-treated syngeneic groups (Figure 1A–C). In contrast, dense fibro-obliterative lesions developed in the allografts and these lesions were not controlled by CsA treatment. Indeed, both control and CsA-treated allografts showed a similar pathologic score (Figure 1D). The lesions comprised a complete destruction of the respiratory epithelium and included leukocyte infiltration. In addition, dense collagen deposits enlarged the lamina propria, thickened the basal membrane and obstructed the lumen (Figure 1E and F). A network of new vessels underlay these fibro-obliterative processes. Therefore, our data demonstrate that CsA treatment is ineffective in preventing chronic rejection of fully allogeneic trachea transplants.

image

Figure 1. Posttransplant obliterative airway disease develops under CsA treatment. Syngeneic B6 or fully allogeneic B/C tracheas were heterotopically grafted into B6 recipients treated or not with 25 mg/kg CsA and recovered after 28 days. Upper panel, syngeneic grafts. (A) Pathologic score. (B and C) Histologic analysis of one representative untreated and CsA-treated B6 trachea, respectively. Masson's trichrome staining of a whole section (magnification × 40 and × 200 for the inset). The empty arrow indicates the normal lamina propria, the empty arrowhead shows the normal pseudostratified respiratory epithelium and the empty star identifies the free lumen. Lower panel, allogeneic grafts. (D) Pathologic score. (E and F) Histologic analysis of one representative untreated and CsA-treated B/C trachea, respectively. Masson's trichrome staining of a whole section (magnification × 40 and × 200 for the inset). The black arrows indicate the enlarged lamina propria, the black arrowheads show the basal membrane thickening and adjacent epithelial loss and black stars identify the fibroproliferative process obstructing the tracheal lumen. The bars represent the mean ± SEM of n = 5 organs in syngeneic groups and 11–15 organs in allogeneic groups. Data are pooled from three independent experiments.

Download figure to PowerPoint

CsA counteracts CD8 but not CD4 T cell-mediated alloreactivity

To characterize the graft T cell infiltrate under CsA treatment, B/C trachea were grafted into B6 mice treated, or not, with 25 mg/kg CsA and recovered 8 days after transplantation. Graft infiltrating lymphocytes (GILs) were isolated after collagen digestion and analyzed by flow cytometry. B6 MHC-I H-2Kb-specific staining revealed that more than 95% of the graft-infiltrating cells derived from recipient origin (Supporting Figure S1).

CsA treatment significantly reduced the number of graft-infiltrating CD4+ and CD8+ T lymphocytes, although each population was not equally affected (Figure 2A, B, D and E). Indeed, CD4+ count was decreased by twofold whereas CD8+ numbers dropped by fivefold, resulting in a significant increase of the intragraft CD4+/CD8+ ratio, as plotted in Figure 2C. In contrast, this treatment did not affect the recruitment of macrophages to the grafts (data not shown).

image

Figure 2. CsA modulates graft-infiltrating T cells. Fully allogeneic B/C tracheas were heterotopically grafted into B6 recipients treated, or not (CTRL), with 25 mg/kg CsA and recovered after 8 days. GILs were extracted and analyzed by flow cytometry. (A) Absolute CD3+CD4+ T cell count per graft. (B) Absolute CD3+CD8+ T cell count per graft. (C) Ratio between CD4+ and CD8+ T cells among CD3+ GILs. (D and E) Representative plots of CD4+ and CD8+ cells among CD3+ GILs in control and CsA-treated groups. The bars represent the mean ± SEM of 14 and 12 individual grafts, respectively. Results are pooled from three independent experiments. **p < 0.005 and ***p = 0.0001.

Download figure to PowerPoint

To investigate the role of CD4+ T cells in obliterative disease, CsA-treated B6 recipients of B/C tracheas were injected with a depleting regimen of anti-CD4 mAbs during 28 days and analyzed as previously described. Depletion of CD4+ T cells abrogated graft lesions (Figure 3A), demonstrated by the normal pseudostratified ciliated columnar epithelium secreting mucus that accumulated in the lumen of anti-CD4-treated mice (Figure 3C). Notably, no sign of collagen deposits could be found in the lamina propria, basal membrane or lumen. Altogether, these experiments confirm that the development of obliterative lesions in the context of CsA treatment depends on CD4+ T cell alloreactivity.

image

Figure 3. Development of obliterative lesions under CsA treatment depends on CD4± T cell alloreactivity. Fully allogeneic B/C tracheas were grafted into either control or CD4+ T cell-depleted B6 recipients treated with CsA for 28 days. (A) Pathologic score is compared. (B and C) Histologic analysis of one representative control and CD4-depleted transplanted trachea, respectively. Periodic acid-Schiff staining of a whole section (magnification × 40 and × 200 for the inset). The black arrow indicates the enlarged lamina propria, the black arrowhead shows the basal membrane thickening and adjacent epithelial loss and the black star identifies the fibroproliferative process obstructing the lumen. The empty arrow indicates the normal lamina propria, the empty arrowhead shows the normal pseudostratified respiratory epithelium and the empty star indicates mucus accumulating in the lumen. The bars represent the mean ± SEM of 5 organs in each group. *p < 0.05.

Download figure to PowerPoint

IFN-γ producing CD8+ T cells and Th1 but neither Th2 nor Th17 alloreactivity is suppressed by CsA

To further characterize T cell reactivity associated with chronic trachea allograft rejection, we first analyzed intragraft cytokine mRNA profiles typically correlated with various T helper cell subsets. We compared syngeneic B6 and allogeneic B/C tracheas recovered from B6 recipients treated or not with CsA for 8 days. mRNA levels were almost undetectable in syngeneic transplants (Figure 4A, B and C), similar to native tracheas (data not shown). In contrast, significant amounts of IFN-γ and, to a lesser extent, IL-17 and IL-13 mRNAs were detected in allografts. CsA treatment dramatically reduced intragraft IFN-γ mRNA (Figure 4A). In contrast, IL-17 and IL-13 mRNA levels increased, although not reaching statistical significance (Figure 4B and C). To confirm these results at the single cell level, intracytoplasmic staining of GILs was performed at day 8 posttransplantation. CsA treatment decreased by one-third the number of IFN-γ-producing Th1 cells (Figure 4E, I and J), with no significant consequences on the accumulation of intragraft Th17 (Figure 4F, I and J) or Th2 cells (Figure 4G). Similarly, the percentage of foxp3-positive regulatory T cells was comparable in both groups (Figure 4H). Finally, the number of IFN-γ+ CD8+ T cells dramatically dropped under CsA treatment (Figure 4K, L and M). These results indicate that CsA treatment, although efficient in reducing IFN-γ, did not prevent Th2 and Th17 alloreactivity.

image

Figure 4. CsA inhibits CD8 and Th1 but not Th2 and Th17 alloreactivity. B6 (SYNG) or B/C (ALLO) tracheas were grafted into B6 recipients treated, or not (CTRL) with 25 mg/kg CsA for 8 days. Upper panel, intragraft mRNA levels. (A) IFN-γ mRNA. (B) IL-17A mRNA. (C) IL-13 mRNA. Results are expressed as mean ± SEM of cytokine copy numbers normalized on 107 copies of β-Actin, n = 9 organs pooled from three independent experiments. **p < 0.005 and ***p = 0.0001. Lower panels, GIL analysis after membranous and intracellular immunostaining. IFN-γ (D), IL-17A (E), IL-5 (F) and foxp3 (G) expression by CD3+ CD4+ cells in each group. (H and I) Plots represent the intracellular expression of IL-17A and IFN-γ among CD3+ CD4+ GILs in a control and CsA-treated graft, respectively. (J) IFN-γ expression in CD3+ CD8+ GILs. (K and L) Plots represent the intracellular expression of IL-17A and IFN-γ among CD3+ CD8+ GILs in a control and CsA-treated graft, respectively. The bars represent the mean ± SEM. n = 15 organs pooled from three independent experiments except for IL-5 and foxp3 expression in CD4+ cells: n = 5. ***p < 0.001.

Download figure to PowerPoint

CsA differentially affects T cell alloreactivity

We next assessed whether CsA could modulate T cell priming. For this purpose, we performed mixed lymphocyte cultures (MLC) with transplanted animals. Eight days after transplantation, spleen cells from either control or CsA-treated recipients were stimulated with syngeneic B6 or donor-specific B/C stimulators. Spleen cells from naive animals served as controls. Syngeneic stimulation did not induce detectable cytokine levels (data not shown). B/C stimulation-induced high amounts of IFN-γ in untreated recipients that was prevented by in vivo CsA treatment (Figure 5A). As we saw with qPCR experiments, CsA treatment strongly induced IL-17 production and did not affect IL-13 secretion (Figure 5B and C). The downregulation of IFN-γ producing T cells was confirmed by a concomitant intracytoplasmic staining of CD4+ and CD8+ T cells from draining lymph nodes (Figure 5D).

image

Figure 5. CsA differentially affects T cell alloreactivity. Upper panel, spleen cells from naïve, control or CsA-treated HTT recipients (8 × 106 cells/mL) were stimulated with irradiated donor-type B/C spleen cells for 90 h and cytokine levels were measured in culture supernatants by ELISA. (A) IFN-γ. (B) IL-17. C, IL-13. The bars represent the mean ± SEM. The values shown were measured in triplicate and are representative of two independent experiments. *p < 0.05 and **p < 0.005. Lower panel, DLN lymphocyte analysis after membranous and intracellular immunostaining at day 8 posttransplantation. (A) % IFN-γ+ CD3+ CD8+ lymphocytes. (B) % IFN-γ+ CD3+ CD4+ lymphocytes. The bars represent the mean ± SEM. n = 10 per group pooled from two independent experiments. *p < 0.05 and ***p < 0.001.

Download figure to PowerPoint

IFN-γ regulates OAD

Because CsA potently controls IFN-γ secretion by T cells, we next addressed its role in OAD in the absence of CsA treatment. For this purpose, B6 tracheas were transplanted into WT or IFN-γ−/− B/C recipients. Preliminary experiments have shown comparable OAD in either B/C into B6 or B6 into B/C combinations (Supporting Figure S2). Grafts recovered from IFN-γ−/− recipients exhibited an increased pathologic score compared to WT recipients (Figure 6A). Indeed, fibro-obliteration of the lumen was increased in IFN-γ−/− recipients (Figure 6B and C). These results support regulatory functions of IFN-γ in OAD development.

image

Figure 6. IFN-γ deficiency enhances OAD. Fully allogeneic B6 tracheas were heterotopically grafted into WT or IFN-γ−/− B/C recipients and recovered after 21 days. (A) Pathologic score. (B and C) Histologic analysis of one representative allogeneic trachea in each group. Masson's trichrome staining of a whole section (magnification × 40 and inset × 200). The empty arrowhead shows the basement membrane and adjacent epithelial loss and the empty star identifies the free lumen. The black arrow identifies the enlarged lamina propria, the black arrowhead shows the basal membrane thickening and adjacent epithelial loss and black stars identify the fibroproliferative process obstructing the tracheal lumen. The bars represent the mean ± SEM of 3–6 organs in each group. *p < 0.05.

Download figure to PowerPoint

IL-4 and IL-17 deficiency independently improve posttransplant obliterative airway disease

As Th17 and Th2 cells were not inhibited by CsA treatment, we assessed their pathogenic role in OAD development. We first transplanted B/C tracheas into IL-17A−/− B6 animals treated or not with CsA for 28 days. While disease development in untreated IL-17A−/− recipients was similar to the pathology that occurred in WT recipients, IL-17 deficiency in the context of CsA treatment led to a significant improvement of the pathologic score (Figure 7A). Indeed, tracheas from CsA-treated IL-17−/− recipients showed almost no luminal fibro-obliteration and fewer collagen deposits (Figure 7B and C). In addition, CK14 immunostaining was performed based on the important role of these stem cells in epithelium regeneration [24]. CK14+ basal epithelial stem cells were preserved in CsA-treated IL-17−/− recipients (Figure 7D). In parallel, we evaluated the impact of IL-4 deficiency in IL-4−/− B6 recipients treated or not with CsA. Similar to IL-17 deficiency, OAD fully developed in IL-4−/− recipients but was significantly prevented in CsA-treated animals (Figure 7E). We found epithelial protection and CK14+ stem cell preservation, fewer collagen deposits, and complete lumen patency in these organs (Figure 7F–H). Together, these experiments reveal IL-17 and IL-4 as independent pathogenic cytokines in OAD development under CsA treatment.

image

Figure 7. IL-4 and IL-17 deficiency independently prevent posttransplant OAD. B/C tracheas were heterotopically grafted into either IL-17A−/− or IL-4−/− B6 recipients treated, or not (CTRL), with 25 mg/kg CsA and recovered after 28 days. (A and E) Pathologic scores of grafts recovered from IL-17A−/− or IL-4−/− recipients, respectively. (B, C and F, G) Histologic analysis of one representative allogeneic trachea in each group. Masson's trichrome staining of a whole section (magnification × 40 and inset × 200). The black arrows identify the enlarged lamina propria, the black arrowheads show the basal membrane thickening and adjacent epithelial loss and black stars indicate the fibroproliferative process obstructing the lumen. The empty arrows identify the normal lamina propria, the empty arrowheads show the normal pseudostratified respiratory epithelium and the empty stars indicate mucus accumulating in the free lumen. (D and H) Absolute CK14+ basal cell count per section after specific immunostaining of grafts recovered from IL-17A−/− or IL-4−/− recipients, respectively. The bars represent the mean ± SEM of 5–15 organs in each group. Data for IL-17−/− recipients are pooled from three independent experiments. *p < 0.05 and ***p < 0.001.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. Disclosure
  9. References
  10. Supporting Information

Bronchiolitis obliterans represents the leading cause of chronic allograft failure and late death after lung transplantation despite the use of potent immunosuppressive drugs including CNIs. Herein, we focused on the link between CNIs, Th cells and chronic allograft rejection. For that purpose we used a model of posttransplant obliterative airway disease (OAD) appearing under a dosage of CsA with high trough levels. Although King et al. found that this dosage reduced lumenal fibrosis after 28 days [25], we did not observe a protection by CsA. This apparent discrepancy might be related to the different allogeneic strain combination used. Although inefficient in preventing OAD after 28 days, we found that CsA treatment significantly decreased pathologic score 14 days after transplantation, which is in agreement with other observations [1] (Supporting Figure S3). Altogether, the experimental equivalent of BO in our model gave us the opportunity to study the mechanisms underlying disease development in the context of CNI treatment.

Quantitative analysis of graft infiltrating lymphocyte subsets showed a dramatic impact of CsA on CD8+ T cells, leaving CD4+ T cells as the main effectors since OAD was completely prevented by CD4+ depletion at day 28. Others have reported an increased calcineurin requirement of CD8+ T cells compared to CD4+ cells [26]. CD8+ T cells could be perceived as potentially damaging anti-MHC I alloreactive T cells [27]. Nevertheless, they also behave as important IFN-γ providers [28, 29] and IFN-γ has known antifibrotic properties. Specifically, IFN-γ suppresses collagen synthesis in fibroblasts and promotes the activation of inflammatory macrophages that favor the degradation of extracellular matrix components (ECM) [30]. Based on the powerful antifibrotic effects of IFN-γ and our data with IFN-γ−/− recipients, the net effect of CD8+ T cell inhibition by CsA could be equivalent to the deprivation of antifibrotic regulatory mechanisms [31]. In addition, CD8-derived IFN-γ may directly affect Th2 and Th17 differentiation as observed in other settings [29, 32]. Furthermore, other studies have reported a regulatory role for IFN-γ in rejection processes [33, 34] consistent with the results reported in our study.

Our results provide evidence for the causal relationship between either IL-17 or IL-4 and the OAD process. CsA treatment failed to control Th17 and Th2 alloreactivity, as attested by IL-17 and IL-13 mRNAs in rejected allografts and IL-17 and IL-5 expressing CD4+ T cells in GILs. Interestingly, these results mirror others obtained from bronchoalveolar lavage fluid analyses in lung transplant recipients in which increased levels of IL-17 or IL-13 mRNA were observed in BO patients compared to stable recipients, the large majority of both receiving CNI treatment [2, 4]. Indeed, although we cannot exclude the possibility that other IL-4- or IL-17-producing cells are involved, we provide compelling evidence that both Th2 and Th17 alloreactive cells constitute independent and codominant pathways of chronic allograft rejection developing during CsA treatment. Apparently contrasting with these findings, Snell's study did not associate IL-17 and early BO syndrome [5]. Even, they found increased IL-17 amounts in endobronchial biopsies when CsA levels were at their highest. In addition to early time points, this study was based on a relatively small number of patients, as mentioned by the authors.

A possible synergy of the Th2 and Th17 pathways may contribute to the results seen in our study, as demonstrated in other experimental models [35]. Importantly, recent reports have implicated Th17 autoreactive cells directed against type-V collagen in the pathogenesis of both human and rodent lung obliterative diseases [3, 36, 37]. Although syngeneic transplants did not develop OAD [21], the respective role of alloantigen-reactive versus self-reactive T cells has not been investigated in our model. Mirroring the difference between healed syngeneic and rejected allogeneic grafts (Supporting Figure S3), the persistence of CK14+ basal epithelial stem cells confirmed the protection afforded in IL-17−/− and IL-4−/− recipients. Indeed, epithelial stem cells have shown potent regenerative capacities after injury [24] and the epithelium is known to be the primary target in posttransplant OAD [38]. In addition, Th2 cytokines [39] and IL-17 [40] have been causally linked to the development of fibrosis in a variety of chronic inflammatory diseases. Accordingly, IL-4 and IL-13 have been shown to induce the proliferation and differentiation of fibroblasts [41] while IL-17, either directly or through the induction of IL-6, may promote collagen production by fibroblasts [42].

Previous studies addressing the impact of CNIs on T cell responses have reported conflicting results. Although CsA was shown to inhibit IL-17 and Th2 cytokine production by in vitro stimulated human peripheral blood mononuclear cells (PBMCs) [13, 15, 16], these observations have not been confirmed by others [10]. In our hands, in vivo CsA treatment significantly inhibited IFN-γ producing CD4+ and CD8+ T cells, but was inefficient in controlling IL-17- and IL-5-producing GILs. This was also observed by others in a cardiac allograft model [43]. Another study, using a rat HTT model in the omentum, concluded that CsA treatment inhibited both Th1 and Th17 pathways [44]. This apparent discordance might be related to the model and methodology. In addition, the roles of IL-17 and IFN-γ were not addressed specifically. The paradigm of a downregulation of IFN-γ by CsA, biasing the T cell response toward Th2 and Th17 is largely supported by our MLC results. In addition, a different impact of CsA on naive and memory CD4+ cells could underlay these mechanisms as a previous report showed that memory PBMCs were less sensitive than naive cells to CsA-mediated inhibition [45].

In conclusion, our animal studies highlight a potential role for CsA in promoting Th2 and/or Th17-mediated OAD, possibly through the inhibition of CD4+ and CD8+ T cell-derived IFN-γ production. Targeting IL-4 and/or IL-17 in addition to current protocols may represent a valuable strategy in clinical transplantation.

Acknowledgments

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. Disclosure
  9. References
  10. Supporting Information

Financial support: the Institute for Medical Immunology is funded by research grants of the Walloon Region, the FNRS-Belgium and GlaxoSmithKline Biologicals. P.H.L. is a doctoral researcher funded by the FNRS (Fonds National de la Recherche Scientifique, Belgium) and the Fonds Erasme (Université Libre de Bruxelles, Brussels, Belgium).

The authors would like to thank Dr. P. Horlait, Laurent Depret, Christophe Notte, Gregory Watherlot and Samuel Vanderbist for outstanding animal care; Frédéric Paulart, Nicolas Passon and Frédéric Cotton for technical assistance; Angélique François, Morgane Delanoy and Dr. M. Pétein for histopathology processing and Pr. S. Cobbold for the kind donation of the anti-CD4+ and the control antibodies.

Disclosure

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. Disclosure
  9. References
  10. Supporting Information

The authors of this manuscript have no conflicts of interest to disclose as described by the American Journal of Transplantation.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. Disclosure
  9. References
  10. Supporting Information

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. Disclosure
  9. References
  10. Supporting Information

Disclaimer: Supplementary materials have been peer-reviewed but not copyedited.

FilenameFormatSizeDescription
ajt12067-sup-0001-FigureS1.pdf468K

Figure S1: Graft-infiltrating CD4± T cells are recipient derived.

Figure S2: B/C into B6 and B6 into B/C OAD are comparable.

Figure S3: CsA treatment prevents acute lesions of tracheal allografts at day 14.

Figure S4: CK14 counts in natives, syngeneic grafts and allografts.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.