Galectin-1 Prolongs Survival of Mouse Liver Allografts From Flt3L-Pretreated Donors

Authors

  • Y. Ye,

    1. Key Laboratory of Combined Multi-organ Transplantation, Ministry of Public Health, Department of Hepatobiliary and Pancreatic Surgery, First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, China
    Search for more papers by this author
    • Both authors contributed equally to this work.

  • S. Yan,

    1. Key Laboratory of Combined Multi-organ Transplantation, Ministry of Public Health, Department of Hepatobiliary and Pancreatic Surgery, First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, China
    Search for more papers by this author
    • Both authors contributed equally to this work.

  • G. Jiang,

    1. Key Laboratory of Combined Multi-organ Transplantation, Ministry of Public Health, Department of Hepatobiliary and Pancreatic Surgery, First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, China
    Search for more papers by this author
  • L. Zhou,

    1. Key Laboratory of Combined Multi-organ Transplantation, Ministry of Public Health, Department of Hepatobiliary and Pancreatic Surgery, First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, China
    Search for more papers by this author
  • H. Xie,

    1. Key Laboratory of Combined Multi-organ Transplantation, Ministry of Public Health, Department of Hepatobiliary and Pancreatic Surgery, First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, China
    Search for more papers by this author
  • X. Xie,

    1. Department of General Surgery, Division of Gastrointestinal Surgery, First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, China
    Search for more papers by this author
  • X. Yu,

    1. Key Laboratory of Combined Multi-organ Transplantation, Ministry of Public Health, Department of Hepatobiliary and Pancreatic Surgery, First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, China
    Search for more papers by this author
  • Y. Ding,

    1. Key Laboratory of Combined Multi-organ Transplantation, Ministry of Public Health, Department of Hepatobiliary and Pancreatic Surgery, First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, China
    Search for more papers by this author
  • J. Tian,

    1. Department of Nephrology, First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, China
    Search for more papers by this author
  • Y. Dai,

    1. The Center of Metabolic Disease Research, School of Basic Medical Sciences, Nanjing Medical University, Nanjing, China
    Search for more papers by this author
  • S. Zheng

    Corresponding author
    • Key Laboratory of Combined Multi-organ Transplantation, Ministry of Public Health, Department of Hepatobiliary and Pancreatic Surgery, First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, China
    Search for more papers by this author

Corresponding author: Shusen Zheng

shusenzheng@zju.edu.cn

Abstract

Liver allografts are spontaneously accepted across MHC barriers in mice. The mechanisms underlying this phenomenon remain poorly understood. Galectin-1, an endogenous lectin expressed in lymphoid organs, plays a vital role in maintaining central and peripheral tolerance. This study was to investigate the role of galectin-1 in spontaneous tolerance of liver allografts in mice, and to evaluate the therapeutic effects of galectin-1 on liver allograft rejection induced by donor Flt3L pretreatment. Blockade of the galectin-1 pathway via neutralizing antigalectin-1 mAb did not affect survival of the liver allografts from B6 donors into C3H recipients. Administration of rGal-1 significantly prolonged survival of liver allografts from Flt3L-pretreated donors and ameliorated Flt3L-triggered liver allograft rejection. This effect was associated with increased apoptosis of T cells in both allografts and spleens, decreased frequencies of Th1 and Th17 cells, decreased expression of Th1-associated cytokines (IL-12, IL-2 and IFN-γ), Th17-associated cytokines (IL-23 and IL-17) and granzyme B, in parallel with selectively increased IL-10 expression in liver allografts. In vitro, galectin-1 inhibited Flt3L-differentiated DC-mediated proliferation of allo-CD4+ T cells and production of IFN-γ and IL-17. These data provide new evidence of the potential regulatory effects of galectin-1 in alloimmune responses in a murine model of liver transplantation.

Abbreviations
APC

antigen presenting cell

B6

C57BL/6

CFSE

carboxy-fluorescein diacetate succinimidyl ester

DC

dendritic cells

Flt3L

fms-like tyrosine kinase 3 ligand

IHC

immunohistochemistry

LPS

lipopolysaccharides

MHC

major histocompatibility complex

MST

mean survival time

NK

natural killer

PMA

phorbol-12-myristate-13-acetate

rGal-1

recombinant galectin-1

Treg

regulatory T cell

TUNEL

terminal deoxynucleotidyl transferase dUTP nick end labeling

Introduction

Allogeneic liver transplantation in mice across MHC-incompatible barriers results in spontaneous graft acceptance without the requirement for immunosuppressive therapy and the induction of donor-specific tolerance in immune-competent recipients [1]. The mechanisms underlying this phenomenon remain poorly understood. It has been well established that spontaneous liver transplant tolerance is not achieved by immunological ignorance but by an active process involving T cell activation, proliferation and infiltration of the liver allograft [2, 3]. Early experiments suggested that T cell deletion may be responsible for spontaneous liver allograft acceptance in mice [2]. The critical role of T cell apoptosis in tolerance was confirmed in later studies showing that interventions such as recipient steroid or IL-2 treatment, donor irradiation or fms-like tyrosine kinase 3 ligand (Flt3L) treatment significantly reduces the number of apoptotic lymphocytes in liver allografts and recipient spleens, leading to graft rejection [4, 5]. Recently, CD4+CD25+Foxp3+ Tregs have proved important in spontaneous acceptance of liver allografts, as depletion of recipient CD25+CD4+ T cells using anti-CD25 mAb induces acute liver allograft rejection [6, 7]. More recently, accumulating evidence suggests that donor APC, in particular DC, which present antigen via the direct pathway of allorecognition, play an important role in determining liver transplant outcome [8, 9]. In the steady state, donor liver-derived DC progenitors are phenotypically immature and poor allostimulators, which induce T cell anergy or apoptosis and the generation of regulatory T cells, contributing to the spontaneous liver transplant tolerance [10]. Whereas under the influence of DC maturation stimuli, such as donor Flt3L administration, liver DCs expand and mature ex vivo into potent APCs, resulting in the rejection of otherwise accepted liver allografts [10, 11]. Thus, induction of apoptosis of alloreactive T cells, expansion of Treg cells and inhibition of DC-mediated allo-T cell proliferation might be exploited to prevent graft rejection and induce transplant tolerance.

Galectin-1, a member of a growing family of β-galactoside binding proteins, has been shown to induce apoptosis of thymocytes and activated T cells, suggesting a potential role for galectin-1 in thymic tolerance and peripheral T cell homeostasis [12, 13]. Recent studies support the idea that, in addition to inducing apoptosis of T cells [14], galectin-1 can selectively blunt Th1 and Th17 responses, inhibit secretion of pro-inflammatory cytokines and promote the generation of tolerogenic DC [15, 16]. Taken together, these data prompted us to investigate the role of galectin-1 in the regulation of liver transplant tolerance in vivo.

Method

Animals

Male C57BL/6 (B6; H2b) and C3H/HeNCrlVr (C3H; H2k) mice (8–12 weeks old), were obtained from the Shanghai Experimental Center (Shanghai, China) and Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China), respectively. Mice were maintained under specific pathogen-free conditions within the animal facility, provided with water and food ad libitum, and housed under 12-h light/dark cycles. The study was conducted in accordance with the Guidelines for the Care and Use of Laboratory Animals and was approved by the Animal Ethics Review Committees of Zhejiang University.

Mouse liver transplantation

B6 or C3H mice were used as donors and C3H mice were used as recipients. Transplantation surgery was performed using a combined cuff and suture technique under inhalation anesthesia as described in a previous study [17]. The hepatic artery was not reconstructed. Allograft survival was determined by recipient survival, and rejection was confirmed histologically.

Antigalectin-1 mAb, Flt3L and rGal-1 administration

To block galectin-1 in vivo, neutralizing antigalectin-1 mAbs (Peprotech, NJ, USA) were administered intraperitoneally (i.p.) to the recipient C3H mice on day 0 (500 μg) and days 2, 4, 6 (250 μg) posttransplantation. In some experiments, recombinant human Flt3L (Peprotech) was administered by daily i.p. injection from days −7 to −1 before liver transplantation. Recombinant human galectin-1 (Peprotech) was injected i.p. (250 μg/mouse) on days 0, 2, 4, 6 posttransplantation. Rat IgG2 or saline was injected at equivalent doses and schedules as controls.

Histology evaluation and immunohistochemistry

Formalin-fixed paraffin-embedded tissues were cut into 3 μm thick sections placed on polylysine-coated slides and stained with hematoxylin and eosin for histological analysis. Slides for immunohistochemistry (IHC) were processed as described in our previous study [18].

Western Blot analysis

The expression of galectin-1 in liver allografts and recipient spleens were evaluated by western blot analysis using antigalectin-1 (R&D System, USA) and β-actin mAbs (Sigma-Aldrich, St. Louis, MO, USA). Equal amounts of protein (30 μg/lane) were resolved by 10–12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto a nitrocellulose membrane. Then the membranes were developed in the ECL Western detection reagents (Amersham–Pharmacia Biotech, Piscataway, NJ, USA), according to the manufacturer's protocol.

Preparation of liver mononuclear cells

Liver mononuclear cells were prepared as described previously [19]. Briefly, liver tissues were mechanically disrupted, and digested for 30 minutes at 37°C in Hank's solution containing 2 μg/mL DNase I and 0.163 U/mL Collagenase IV GIBCO, NY, USA), and then pressed through a 200-gauge stainless steel mesh. The suspension was then centrifuged twice at 50 g for 1 min at 4°C. After washing, the cells were resuspended in RPMI 1640 medium, gently overlaid onto Mouse Mononuclear Separation Medium (Jiamay Biotech, China), and centrifuged at 2,000 rpm for 20 min. The interface cells were aspirated and washed twice with RPMI 1640 medium.

Apoptosis assays

Apoptotic cells in tissue sections were detected by TUNEL assay using the ApopTag® Peroxidase In Situ Apoptosis Detection Kit (Billerica, MA, USA), following the manufacturer's instructions. For analysis of apoptotic CD4 and CD8 T cells in graft-infiltrating cells, following surface CD3 and CD4 staining, cells were fixed in 4% paraformaldehyde, then permeabilized with 0.1% Triton X-100 and 0.1% sodium citrate. APO-BrdU™ TUNEL Assay Kit (Invitrogen, Carlsbad, CA, USA) was then added according to the manufacturer's instructions. Quantitative analysis was performed by flow cytometry. For analysis of cell apoptosis in vitro, cells were stained with the annexin V-FITC and PI (BD Biosciences, San Diego, CA, USA) according to the manufacturer's instructions. Stained cells were analyzed via a BD LSR II Flow Cytometer and CellQuest software (BD Biosciences, NJ, USA).

Generation of bone marrow-derived DC

Myeloid DCs were generated from B6 mouse bone marrow cells as previously described [20]. Briefly, bone marrow cells were cultured in six-well plates, at 2 × 106 cells/mL, in RPMI 1640 medium, supplemented with 10% FBS, 2 mM L-glutamine, 1 mM sodium pyruvate, 100 U penicillin-streptomycin and 0.05 mM 2-ME in the presence of 100 ng/mL of recombinant human Flt3L (Peprotech, Rocky Hill, NJ, USA). On day 9, nonadherent cells were collected and CD11c+ DCs were isolated using the CD11c MicroBeads (Miltenyi Biotec, Auburn, CA, USA), according to the manufacturer's instruction. CD11c+ DCs were induced into maturation with LPS (1 μg/mL, Sigma-Aldrich) for a further 24h.

Purification of CD4+ T cells from spleen

CD4+ T cells from the spleen were selected using the CD4+ T Cell Isolation Kit (Miltenyi Biotec GmbH, Germany) according to the manufacturer's instructions. Non-CD4+ T cells were indirectly magnetically labeled using a cocktail of biotin-conjugated antibodies against CD8a, CD11b, CD11c, CD19, CD45R (B220), CD49b (DX5), CD105, Anti-MHC-class II and Ter-119.

T cell proliferation assay

CFSE-based proliferation assays were performed using a CFSE cell proliferation kit (Invitrogen, Carlsbad, CA) according to manufacturer's instruction. Briefly, freshly isolated spleen CD4+ T cells were first labeled by incubating with 0.5 μM of CFSE at 37°C for 5 minutes. After washing, the CFSE-labeled cells were then aliquoted into a 96-well U-bottom plate at 2 × 105 cells per well. Allogeneic FL-DCs were treated with 25 μg/mL mitomycin C (Sigma) for 30 min at 37°C. Treated FL-DCs were added to the CFSE-labeled T cells at a ratio of 1:10 in triplicate. After 3 days of incubation, cells were recovered and T cell proliferation was assessed by measuring CFSE dilution using flow cytometry. Supernatants were collected for IFN-γ and IL-17 measurement by ELISA using respective ELISA kits (R&D).

Intracellular cytokine staining assay

Cells were resuspended in RPMI 1640 medium and stimulated with PMA (5 ng/mL; Sigma-Aldrich) plus ionomycin (500 ng/mL; Sigma-Aldrich) for 6 hours at 37°C. GolgiStop (BD PharMingen, San Diego, CA, USA) was added to the cells during the last 2 hours of the incubation. After staining for the surface marker CD4, cells were fixed and permeabilized with Cytofix/Cytoperm solution (BD Biosciences) and incubated with anti-IFN-γ and anti-IL-17 for 30 min at 4°C. A gate was set on CD4+ cells, and the percentage of Th1 and Th17 cells was determined by flow cytometric analysis.

Total RNA isolation and real-time quantitative PCR

Cytokine mRNA levels were determined by real time quantitative PCR (RT-qPCR) as described in our previous study [18], using an ABI PRISM 7500 real-time PCR System and SYBR Green PCR master mix (Applied Biosystems, Foster City, CA, USA). The gene-specific primers used in PCR analysis were shown in Table 1. Relative quantification was performed using the comparative threshold cycles (2−ΔΔCt method) as described in the manufacturer's manual.

Table 1. Sequences of primers used in real-time RT-PCR
GenePrimers (5’–3’)
  1. EDTA = ethylene diamine tetraacetic acid; FoxP3 = forkhead transcription factor protein 3; IFN = interferon; IL = interleukin; MPO = myeloperoxidase; TGF = transforming growth factor; *catalog number = others: clone number.

Galectin-1Forward: ACT TCA ATC CTC GCT TCAA
 Reverse: GGC CAC GCA CTT AAT CTT
IFN-γForward: CCT GCG GCC TAG CTC TGA G
 Reverse: GCC ATG AGG AAG AGC TGC A
IL-17AForward: CTC CAG AAG GCC CTC AGA CTA C
 Reverse: GGG TCT TCA TTG CGG TGG
IL-12p35Forward: TTG ATG ATG ACC CTG TGC C
 Reverse: GAT TCT GAA GTG CTG CGT TG
IL-23p19Forward: GGG AAC AAG ATG CTG GAT T
 Reverse: CTT CAC ACT GGA TAC GGG G
IL-12p40Forward: ACA GCA CCA GCT TCT TCA TCA G
 Reverse: TCT TCA AAG GCT TCA TCT GCA A
IL-10Forward: GAC AAC ATA CTG CTA ACC GAC TC
 Reverse: CAC TCT TCA CCT GCT CCA CT
β-ActinForward: CGT TGA CAT CCG TAA AGA CC
 Reverse: AAC AGT CCG CCT AGA AGC AC
Granzyme BForward: AGA CCC AGC AAG TCA TCC C
 Reverse: CCA ACC AGC CAC ATA GCA C
IL-2Forward: GCCTAGAAGATGAACTTGGAC
 Reverse: TTATTGAGGGCTTGTTGAGA

Statistical analysis

All data were analyzed using the SPSS 11.6 for Windows (SPSS Inc, Chicago, IL). Graft survival was expressed graphically using the Kaplan–Meier method. Comparison between various groups was performed using the Mann–Whitney U test. For all tests, two-sided p<0.05 was considered statistically significant.

Result

Galectin-1 production is increased after liver transplantation

We first analyzed galectin-1 expression after liver transplantation. We performed quantitative real-time RT-PCR for whole liver allografts and recipient spleens obtained 4 days after transplantation. As shown in Figure 1, the mRNA levels of galectin-1 were significantly increased in liver allografts and slightly up-regulated in isografts when compared to normal controls. Higher levels of galectin-1 mRNA were detected in liver allografts than those in isografts (fold of control, 4.43 ± 1.51 vs. 1.74 ± 1.16, p < 0.05, n = 5). Galectin-1 mRNA levels were also upregulated in recipient spleens after allogeneic and syngeneic liver transplantation, compared to those in normal spleen tissues. However, no significant differences were observed in galectin-1 mRNA levels between allogeneic and syngeneic groups (fold of control, 3.51 ± 0.39 vs. 2.75 ± 1.22, p < 0.05, n = 5). In line with the results of the PCR, immunoblot assay showed that galectin-1 protein levels were increased in both liver allografts and isografts (Figure 1B). However, no significant differences of galectin-1 protein levels in recipient spleens were observed among the control, allogeneic and syngeneic groups. IHC staining showed that galectin-1 was mainly localized on liver nonparenchymal cells and splenocytes (Figure 1C).

Figure 1.

Expression of galectin-1 in liver allografts and recipient spleens after liver transplantation. (A) Real-time RT-PCR analysis of galectin-1 mRNA levels in normal livers, isografts, allografts and corresponding spleens 4 days after transplantation. Results are means ± SD obtained from five mice in each group. (B) Representative Western blot of galectin-1 expression in normal livers, isografts, allografts and corresponding spleens. (C) Representative immunohistochemical stainings of galectin-1 in liver allografts and recipient spleens. Original magnification, ×400. NC: normal controls, Iso: isografts, Allo: allografts. *Represents significant differences (p < 0.05) with Mann–Whitney test.

Blockade of galectin-1 alone fails to disrupt the devel-opment of liver transplant spontaneous tolerance

Having demonstrated that galectin-1 was upregulated after liver transplantation, we then determined whether galectin-1 was essential for spontaneous tolerance of liver allografts in mice. Therefore, the effect of galectin-1 blockade on liver allograft survival was evaluated. In our study, MHC-mismatched B6 liver allografts were spontaneously accepted by C3H recipients without the need for any immunosuppressive therapy (>100, 76, >100, 97, >100, >100, >100, >100 days, respectively, MST>100 days; n = 8). Antigalectin-1 mAbs were administered to recipients to block or neutralize biological activities of endogenous galectin-1. However, administration of antigalectin-1 mAb did not result in a significant change in the survival of liver allografts from B6 donors into C3H recipient mice (84, >100, >100, 93, >100, >100 days, respectively, MST >100 days; n = 6, Figure 2). The results suggest that blockade of galectin-1 alone might be insufficient to disrupt the development of liver transplant spontaneous tolerance.

Figure 2.

Effect of galectin-1 blockade on the development of liver transplant spontaneous tolerance. C3H mice with B6 liver allografts were treated with anti-Gal-1 mAb or control rat IgG on day 0 (500 μg) and days 2, 4, 6 (250 μg) posttransplantation. No significant difference was observed in allograft survival between the two groups. n = 8 in the control group; n = 6 in the anti-Gal-1 mAb-treated group. Two recipients died within 1 week (3 and 5 days, respectively) posttransplantation due to surgical complications in the IgG-treated group and were excluded from the study. One recipient died 2 days posttransplantation due to biliary obstruction in the anti-Gal-1 mAb-treated group and was excluded from the study.

Administration of rGal-1 prolongs the survival of liver allografts from Flt3L-pretreated donors

The antiinflammatory and tolerogenic properties of recombinant galectin-1 have been evaluated in several models of autoimmune diseases [16], and are considered potential therapeutic tools to prevent graft rejection [21] or graft-versus-host disease [22]. Previous studies demonstrated that pretreatment of donors with Flt3L resulted in acute liver allograft rejection in mice. We herein investigated the effects of exogenous rGal-1 administration on Flt3L-triggered acute liver allograft rejection. Consistent with previous observations, our results showed that liver allografts from Flt3L-pretreated B6 donors were rejected within 12 days in C3H recipients (12, 9, 6, 8, 7, 5, respectively, MST, 7.8 ± 2.48 days, n = 5), whereas naive B6 liver allografts survived more than 100 days. Administration of rGal-1 (250 μg on days 0, 2, 4, 6 after transplantation) significantly prolonged the survival of liver allografts from Flt3L-pretreated donors (21, 26, 24, 18, 23 respectively, MST, 22.4 ± 3.05, n = 5) compared with the saline-treated group (Figure 3A).

Figure 3.

Effect of galectin-1 on the rejection of liver allografts from Flt3L-pretreated donors. (A) Analysis of graft survival from naive B6 mice or Flt3L-pretreated donors, with or without rGal-1 administration. C3H mice received naive B6 liver allografts or liver allografts from Flt3L-pretreated donors, with or without rGal-1 administration. Controls received saline instead of rGal-1. n = 5 mice in the rGal-1-treated group, n = 6 in other two groups. One recipient died 2 days posttransplantation in the rGal-1-treated group and one recipient died days posttransplantation in the saline-treated group due to surgical complications and was excluded from the study. (B) Histological analysis of liver allografts from naive donors or Flt3L-pretreated donors. Original magnification, ×400.

Four days after liver transplantation, mice were killed, and the liver allografts and recipient spleens were removed for further analysis. As shown in Figure 3B, massive leukocyte infiltration and parenchymal necrosis were observed in liver allografts from Flt3L-pretreated donors, and were markedly attenuated following rGal-1 administration. Taken together, these data indicated that rGal-1 significantly prolongs the survival of liver allografts from Flt3L-pretreated donors and attenuates Flt3L-triggered acute liver allograft rejection.

Administration of rGal-1 increases apoptosis of T cells in both liver allografts from Flt3L-pretreated donors and recipient spleens

Galectin-1 has been shown to induce apoptosis of activated T cells in vitro and in vivo [14]. Therefore, we hypothesized that the prolonged survival of liver allografts from Flt3L-pretreated donors achieved by rGal-1 administration is associated with increased apoptosis of alloreactive T cells in liver allografts. To test our hypothesis, we performed in situ TUNEL to determine apoptotic activity in both liver allografts and spleens, 4 days after transplantation. As shown in Figure 4, pretreatment of donors with Flt3L significantly reduced apoptosis of infiltrating mononuclear cells within portal areas of liver allografts and cells within T cell areas of recipient spleens compared with controls. This was consistent with previous findings. However, administration of rGal-1 significantly increased the density of TUNEL+ cells within portal areas of liver allografts and in recipient spleens compared with the saline-treated mice. Muticolor immunostaining of graft-infiltrating cells and splenocytes by TUNEL, anti-CD3 and anti-CD4 mAb using flow cytometric assay showed that administration of rGal-1 significantly enhanced apoptosis of both CD4 (CD3+CD4+) and CD8 (CD3+CD4) T cells in liver allografts. (CD4 T cell: 14.8% ± 2.8% vs. 5.7% ± 1.5%; CD8 T cell: 16.5% ± 3.7% vs. 9.2% ± 2.1%, Figure 4C).

Figure 4.

Administration of rGal-1 increases apoptosis of T cells in both liver allografts from Flt3L-pretreated donors and recipient spleens. (A) Representative images of in situ TUNEL assay to evaluate apoptosis in liver allografts (upper) from naive B6 mice or Flt3L-pretreated donors and recipient spleens (lower), with or without rGal-1 administration. Liver and spleen samples were obtained 4 days after transplantation. (B) Quantification of TUNEL-positive mononuclear cells in portal areas of liver allografts and recipient spleens (×200). (C) Increased incidence of TUNEL-positive CD4 (CD3+CD4+) and CD8 (CD3+CD4) T cells in liver allografts from Flt3L-pretreated donors. Graft-infiltrating mononuclear cells were isolated from liver allografts from naive B6 donors or Flt3L-pretreated donors, with or without rGal-1 administration. Cells were stained with PE-CY5-conjugated anti-CD3 and APC-conjugated anti-CD4 mAb, and were treated with the APO- BrdUTM TUNEL Assay Kit. Results are means ± SD obtained from five mice in each group. *Represents significant differences (p < 0.05) with Mann–Whitney test.

We then further assessed the effect of rGal-1 on apoptosis of spleen T cells isolated from naive C3H mice and recipient mice with liver allografts from Flt3L-pretreated donors, 4 days after transplantation. T cells were incubated for 12 hours with increased concentrations of rGal-1. As illustrated in Figure 5, spleen T cells from recipient mice with liver allografts from Flt3L-pretreated donors were clearly more sensitive to undergoing apoptosis in response to rGal-1 treatment than T cells from naive C3H mice. rGal-1 caused selective apoptosis of spleen T cells from recipient mice with liver allografts from Flt3L-pretreated donors in a dose-dependent manner. This was consistent with previous observation indicating that galectin-1 induces apoptosis of activated T cells but not resting T cells. These data strongly suggested that induction of alloreactive T cell apoptosis may be a critical mechanism for galectin-1 in prolonging survival of liver allografts from Flt3L-pretreated donors.

Figure 5.

Effect of rGal-1 treatment on apoptosis of spleen T cells from naive C3H mice and recipient mice with liver allografts from Flt3L-pretreated donors. (A) Representative FACS scatter plots of spleen T cell apoptosis 12 h after coculture with rGal-1. (B) Spleen T cells from recipient mice with liver allografts from Flt3L-pretreated donors were clearly more sensitive to undergoing apoptosis in response to rGal-1 treatment than T cells from naive C3H mice. The results are representative of three separate experiments.

Administration of rGal-1 reduced the frequencies of Th1 cells and Th17 cells within liver allografts from Flt3L-pretreated donors

To further understand the cellular mechanism of galectin-1-mediated immune regulation on liver transplantation, we measured the frequencies of Th1, Th17 and Treg cells within liver allografts 4 days after transplantation, by intracellular staining using flow cytometry. As shown in Figure 6, pretreatment of donors with Flt3L resulted in significant increases in the frequencies of Th1, Th17 and CD4+CD25+Foxp3+ T cells within liver allografts. Administration of rGal-1 reduced the frequencies of Th1 and Th17 cells within liver allografts from Flt3L-pretreated donors compared with saline-treated recipients (Th1, 9.15% ± 1.87% vs. 13.6% ± 2.13%, p < 0.01; Th17, 4.43% ± 1.64% vs. 6.10% ± 1.40%, p < 0.01, n = 6). However, no significant differences were observed in the frequency of CD4+CD25+Foxp3+ Tregs between the rGal-1-treated and saline-treated groups (16.63% ± 0.87% vs. 16.38% ± 0.77%, p > 0.05). These data indicate that administration of rGal-1 preferentially suppresses Th1 and Th17 alloimmune responses, but does not significantly affect the generation of CD4+CD25+Foxp3+ Tregs within liver allografts.

Figure 6.

Administration of rGal-1 reduced the frequencies of Th1 cells and Th17 cells within liver allografts from Flt3L-pretreated donors. (A, B) Flow cytometric analysis of Th1 and Th17 levels in liver allografts from naive B6 donors or Flt3L-pretreated donors, with or without rGal-1 administration. (C, D) Flow cytometric analysis of Treg levels in liver allografts from normal B6 donors or Flt3L-pretreated donors, with or without rGal-1 administration. Results are means ± SD obtained from five mice in each group. *Represents significant differences (p < 0.05) with Mann–Whitney test.

To confirm the above results, we then further analyzed gene expression of Th1-associated cytokines (IL-12p35 and IFN-γ), Th17-associated cytokines (IL-23p19 and IL-17), granzyme B and IL-10 within liver allografts by RT-PCR analysis. As illustrated in Figure 7, donor pretreatment of Flt3L significantly increased all these gene expression within liver allografts 4 days after transplantation. Administration of rGal-1 significantly attenuated the increase of mRNA transcripts of IL-12p40, IL-2, IL-12p35, IFN-γ, IL-23p19, IL-17 and granzyme B induced by donor Flt3L pretreatment, although these mRNA transcripts remained elevated compared to the naive liver allografts (data not shown). In contrast, administration of rGal-1 resulted in a significant increase in gene expression of IL-10 (7.26 ± 1.52 vs. 4.18 ± 0.96, p > 0.05, fold of control). Taken together, these data suggest that administration of rGal-1 attenuates the imbalance between pathogenic and regulatory T cells triggered by donor Flt3L-pretreatment, leading to prolonged liver allograft survival.

Figure 7.

Effect of rGal-1 administration on cytokine mRNA levels in liver allografts from Flt3L-pretreated donors. When compared with saline-treated group, expressions of IL-2, IL-12p40, IL-12p35, IL-23p19, IFN-γ, IL-17 and Granzyme B were inhibited in rGal-1-treated group (n = 5), while expression of IL-10 was upregulated in the rGal-1-treated group. Results are means ± SD obtained from five mice in each group. *Represents significant differences (p < 0.05) with Mann–Whitney test.

Gal-1 inhibits FL-DC-mediated allo-stimulation of CD4+ T cells in vitro

Augmented donor-derived potential allostimulatory DCs are considered to be of critical importance in mediating the rejection of liver allografts from Flt3L-pretreated donors. We herein investigated the effect of galectin-1 on DC-allo CD4+ T cell interactions in vitro. DCs were generated from bone marrow precursors followed culturing the cells with Flt3L for 9 days (FL-DC). After treated with mitomycin C, FL-DCs were cultured with CFSE-labeled allo-CD4+ T cells in a well-controlled cell culture system for 3 days, in the presence or absence of rGal-1 at increasing concentrations. As shown in Figure 8, galectin-1 inhibited FL-DC-mediated proliferation of allo-CD4+ T cells in a dose-dependent manner. The amount of IFN-γ and IL-17 in the supernatant of the cell cultures was then measured by ELISA assay. Lower levels of IFN-γ and IL-17 were detected in supernatants of rGal-1-treated cells compared with those of the controls. These data suggested that galectin-1 inhibits DC-mediated allo-stimlation of CD4 T cells and production of Th1 and Th17 cytokines, a potential mechanism for galectin-1 in prolonging the survive of liver allografts from Flt3L-pretreated donors.

Figure 8.

Galectin-1 inhibits FL-DC-mediated allo-stimulation of CD4+ T cells in vitro. (A) Representative flow cytometric histograms for the data from CFSE-based proliferation assay. FL-DCs were cultured with CFSE-labeled allo-CD4+ T cells for 3 days in the presence or absence of rGal-1 at increasing concentrations. (B) rGal-1 treatment caused decreased proliferation of allo-CD4 T cell mediated by FL-DCs in a dose-dependent manner. (C) Detection of IFN-γ and IL-17 levels in supernatant of cell cultures by ELISA. rGal-1 treatment inhibited production of IFN-γ and IL-17 in the supernatants from CD4 T cells cultured with FL-DCs. The results are representative of three separate experiments. *Represents significant differences (p < 0.05) with Mann–Whitney test.

Discussion

The fate of a transplanted liver allograft is determined by the balance between regulatory mechanisms that induce tolerance and pathogenic factors that promote rejection. Liver allografts are spontaneously accepted across MHC barriers in mice. Interestingly, the tolerance can be broken by systemic treatment of donors with the hematopoietic growth factor Flt3L, although the mechanisms remain unclear [11]. In the present study we provide the first experimental evidence of a therapeutic role for galectin-1 in ameliorating Flt3L-triggered acute liver allograft rejection. Administration of rGal-1 significantly prolonged the survival of liver allografts from Flt3L-pretreated donors. Histopathological examination confirmed the clinical findings, which showed that rGal-1 administration inhibited leukocyte infiltration of liver allografts and ameliorated parenchymal necrosis.

Galectin-1 has been implicated in a variety of biological processes involving cell adhesion, cell apoptosis, cell growth regulation and metastasis [12]. Recently, galectin-1 has attracted the attention of investigators as a key regulator of immune homeostasis and inflammation. In the present study we have demonstrated that galectin-1 is involved in regulation of Flt3L-triggered liver allograft rejection by inducing apoptosis of alloreactive T cells. Both previous studies and our findings revealed that Flt3L administration results in a marked decrease in apoptosis of alloreactive T cells [5]. We here further found that rGal-1 completely reversed this effect and significantly increased the incidence of apoptotic T cells within liver allografts and recipient spleens. These data strongly suggest that the prolonged survival of liver allografts from Flt3L-pretreated donors achieved by rGal-1 is associated with increased apoptosis of alloreactive T cells.

CD4+ T cells and CD4+ T cell-derived cytokines play an important role in regulating alloimmune responses. Naive CD4+ T cells were considered to differentiate toward Th1, Th2, Th17 and Treg phenotypes [23]. In the context of organ transplantation, Th1 cells and Th1-related cytokines, such as IFN-γ and IL-12, were considered the main mediators of allograft rejection, while Th2 cells were thought to be protective [24, 25]. In our previous studies using rat liver transplantation model, we found that Th17 immunity contributes to acute liver allograft rejection [26, 27]. In our current study, we found that pretreatment of donors with Flt3L resulted in significant increases in the frequencies of Th1 and Th17 cells within liver allografts, which confirmed the critical role of Th17 pathway in mediating liver allograft rejection. rGal-1 administration reduced the frequencies of Th1 cells and Th17 cells within liver allografts from Flt3L-pretreated donors compared with the saline-treated recipients. In addition, rGal-1 significantly attenuated the increase of mRNA transcripts of IL-12p35, IFN-γ, IL-23p19, IL-17 and granzyme B induced by donor Flt3L pretreatment. IL-12 is necessary for the development of the Th1 response, while IL-23 is necessary for the development of the Th17 response. Granzyme B, preferentially expressed in CD8+ T and NK cells, has been shown to contribute to CTL-mediated injury in acute allograft rejection [28]. These results suggest that immunomodulatory activity of galectin is mediated not only by the deletion of the alloreactive T cell clone, but also by suppression of proinflammatory cytokines. Administration of rGal-1 attenuates the imbalance between pathogenic and regulatory T cells triggered by donor Flt3L-pretreatment, leading to prolonged liver allograft survival. Although administration of rGal-1 did not affect the generation of CD4+CD25+Foxp3+ Tregs in liver allografts from Flt3L-pretreated donors in our study, galectin-1 has been shown to be overexpressed in both human and mouse CD4+CD25+ Treg cells and a key effector molecule for Treg function. Tregs have been suggested to play an indispensible role in both the induction and maintenance of liver allograft tolerance. Thus, further studies are still needed to investigate the relationship of galectin-1 and Tregs in the transplant setting.

DCs are the best-characterized APC in the context of organ transplantation, where those favor graft acceptance are considered tolerogenic, and those that induce graft rejection are viewed as immunogenic [8]. Augmented donor-derived potential immunogenic DCs are considered to be of critical importance in mediating the rejection of liver allografts from Flt3L-pretreated donors [29]. In our in vitro experiments, we found that galectin-1 significantly inhibited FL-DC-mediated proliferation of allo-CD4+ T cells and production of IFN-γ and IL-17 by CD4+ T cells. These data suggest that galectin-1 inhibits DC-mediated allo-stimulation of CD4 T cells and production of Th1 and Th17 cytokines, a potential mechanism for galectin-1 in prolonging the survive of liver allografts from Flt3L-pretreated donors. Emerging evidence indicates that galectin-1 may serve as a signaling molecule that promotes the generation of tolerogenic DCs, which blunt Th1 and Th17 responses, preferentially expand Treg cells and induce IL-10 production [15]. Thus, galectin-1-differentiated tolerogenic DCs may be used to achieve liver transplant tolerance clinically in future.

In summary, to our knowledge, this study is the first to demonstrate that galectin-1 ameliorates Flt3L-triggered acute liver allograft rejection by inducing apoptosis of alloreative T cells, inhibiting Th1 and Th17 responses, and inhibiting allostimulatory capacity of Flt3L-differentiated DCs. More importantly, our data highlight a novel molecular target for manipulation of T-cell tolerance and apoptosis with profound implications for inducing liver transplant tolerance and improving the overall success of liver transplantation. Further experiments will be required to evaluate the immunological role of galectin-1 in other solid organ transplantation (heart, lung, bowel, etc.).

Acknowledgments

This study was supported by the National Basic Research Program of China (973 Program) (No. 2009CB522403); National Natural Science Foundation of China (30901366), National High Technology Research and Development Program of China (‘863’ Program, 2011AA020103) and National Natural Science Foundation of China (81172830). We thank all subjects for their ongoing participation in this study.

Disclosure

The authors of this manuscript have no conflicts of interest to disclose as described by the American Journal of Transplantation.

Ancillary