Guiding Postablative Lymphocyte Reconstitution as a Route Toward Transplantation Tolerance

Authors


Abstract

Anti-lymphocyte-depleting antibodies have increasingly been utilized in the clinic as induction therapy aiming to improve transplantation outcomes by reducing the need for long-term immunosuppression. However, maintenance immunosuppression is still required as lymphocyte reconstitution through homeostatic proliferation, partially driven by IL-7, continues to replenish tolerance-refractory immune cells capable of rejection. In murine models of MHC mismatched skin grafting, we investigated whether it is feasible to control the lymphocyte reconstitution process to delay rejection and favor tolerance processes. We found that a short course of anti-IL-7 receptor blocking antibody following T cell depletion, combined with the mammalian target of rapamycin inhibitor Rapamycin, could significantly delay graft rejection in one mouse strain, and achieve transplantation tolerance in another. The combination treatment was found to delay T cell reconstitution and, in the short term, enriched for Foxp3+ regulatory T cells (Tregs), at the expense of effector cells. Extended graft survival and tolerance were dependent on TGF-ß, indicating a role for induced Tregs. These findings point to the feasibility of building on lympholytic induction by guiding early lymphocyte reconstitution to favor endogenous regulatory mechanisms.

Abbreviations
αCD4/αCD8

anti-mouse CD4/CD8

agly-αIL-7R

aglycosylated variant of αIL-7R

αIL-7R

blocking anti-IL-7R antibody

FACS

fluorescence-activated cell sorting

IL-7R

IL-7 receptor-α

MST

median survival time

mTOR

mammalian target of rapamycin

pTreg

peripherally induced Treg

Rapa

rapamycin

Treg

regulatory T cell

Introduction

Anti-lymphocyte-depleting antibodies are widely adopted as induction therapy in transplantation to safeguard the graft during healing, after which the requirements for immunosuppression are less intense. Lymphocyte depletion alone, albeit profound and sustained, does not induce graft acceptance [1] as rebound lymphocyte reconstitution is antagonistic to tolerance [2, 3]. In part, this rebound is mediated through feedback control by IL-7 [4, 5], in a process often referred to as homeostatic proliferation [6]. This results in preferential emergence of effector/memory T cells [7-10], with the lymphocyte population acquiring resistance to induction of tolerance [3, 11]. As an infusion of regulatory T cells (Tregs) could overcome this tolerance-refractory state [2], we asked whether one could therapeutically guide reconstitution to favor the endogenous Tregs. We targeted the IL-7 receptor-α (IL-7R) and mammalian target of rapamycin (mTOR) as both are involved in homeostasis and activation of T cells, while mTOR inhibition also favors the induction of Foxp3+ Tregs [12, 13]. Moreover, as IL-7R is poorly expressed in naïve Tregs [14], we expected operational selectivity in the quality of reconstitution following IL-7R blockade.

We demonstrate that a short course of an mAb blocking anti-IL-7R (αIL-7R) [15], when used after lymphocyte depletion in association with the mTOR inhibitor Rapamycin, can substantially delay graft rejection, and in one mouse strain, induce tolerance to fully MHC mismatched skin grafts. This protocol favors early Treg reconstitution over other T cells, and is dependent on TGF-ß, implicating a role for peripherally induced Tregs (pTregs).

Materials and Methods

Experimental animals

CBA/Ca (H-2k), CBA.Rag1−/− (H-2k), C57BL/10 (B10) (H-2b), (B10 × BALB/k)F1 (H-2b,k), C57BL/6 (B6) (H-2b), (B6 × CBA/Ca)F1 (H-2b,k), D90.1 CBA/Ca (Thy1.1) (H-2k), homozygous CBA/Ca mice transgenic for hCD52 expression in T cells (hCD52-Tg) (H-2k) [16] and heterozygous (B6xhCD52-Tg)F1 mice were bred and maintained under specific pathogen-free conditions in the animal facility at the Sir William Dunn School of Pathology (Oxford, UK). Heterozygous (hCD52-Tg × CBA/Ca)F1 were used in some experiments instead of hCD52-Tg, because of homozygotes breeding shortage.

Skin grafting and T cell transfer were performed between sex-matched mice. All procedures were conducted in accordance with the Home Office Animals (Scientific Procedures) Act of 1986.

mAbs and immunosuppressants

For T cell depletion mice were treated with campath, a rat IgG2b anti-hCD52 [17], 1 mg intraperitoneally (i.p.) on days −3 and −1, such depletion being equivalent in both homozygous and heterozygous hCD52-Tg mice. For B cell depletion mice received a mouse IgG2a anti-murine CD20 (αCD20) from Genentech (San Francisco, CA), 250 µg i.p. on days −3 and −1. For co-receptor blockade, mice were given YTS177.9, a rat IgG2a anti-mouse CD4 (αCD4), and YTS105.18, a rat IgG2a anti-mouse CD8 (αCD8), 1 mg of each i.p. on days 0, 2 and 5. For IL-7R blockade, mice received A7R34, a rat IgG1 αIL-7R [15], or its aglycosylated variant (agly-αIL-7R), seven i.p. injections of 0.4 mg from days −3 to 14. This antibody was validated by blockade of B cell development [15] (Figure S1). Campath, αCD4, αCD8 and αIL-7R were produced in our laboratory as previously described. For TGF-ß neutralization, mice were given 1D11, a mouse IgG1 αTGF-ß [18] (or the relevant isotype 13C4) seven i.p. injections of 2 mg from days −3 to 21; antibodies provided by Genzyme (Cambridge, MA). Rapamycin (Rapa) (Calbiochem, Nottingham, Nottinghamshire, UK) was dissolved in 100% ethanol and stored at −20°C; on the day of the injection a stock aliquot was diluted with 0.2% carboxymethycellulose sodium salt (Sigma-Aldrich, Gillingham, Dorset, UK) and administered i.p.; unless otherwise specified, mice received seven injections of 1.5 mg/kg from days −3 to 14 [13].

Preparation of chimeric aglycosyl human IgG1 αIL-7R

DNA encoding VH and VL of the rat αIL-7R [15] was prepared using the SMART cDNA kit (Clontech, Saint-Germain-en-Laye, France) applying SMART 11 A oligo AAGCAGTGGTATCAACGCAGAGTACGCGGG and kappa SMART primer GGTCTAACACTCATTCCTGTTGAA for the light chain and rat2ACH2 SMART primer ATCTTTGGTCTTTGGGGGGAAGAT for the heavy chain. Second strand RACE was then performed using primer nest A, AAGCAGTGGTATCAACGCAGAGT and kappa nest primer CTAACACTCATTCCTGTTGAAGCTCTT for the light chain and rat2AHinge nest primer TGTACATCCACAAGGATTGCATTC for the heavy chain. The amplified light chain fragment was cloned into EcoR1 site of PEE12 vector (Lonza, Slough, Berkshire, UK) and heavy chain fragment into Spe1 and BamH1 site of PEE12/CD5L/HuIgG1 aglycosyl vector. The resulting plasmids were co-transfected by electroporation into the cell line NSO, and stable transfectants were selected in glutamine-free IMDM (Invitrogen, Paisley, Renfrewshire, UK). Positive clones were selected by ELISA for binding to recombinant mouse IL-7RFc chimera (R&D Systems, Abingdon, Oxfordshire, UK). Antibody was purified by ProteinA affinity-binding (GE Healthcare, Little Chalfont, Buckinghamshire, UK) and quality-controlled for endotoxin.

Skin grafting

Full thickness tail-skin (0.5–1 cm2) was transplanted on recipients thoracic flank. When performing re-grafts, these were transplanted contra-laterally. Grafts were generally observed 3 times/week after the removal of the bandage at day 7, and considered rejected when no viable donor skin was present.

T cell enrichment and adoptive transfer

A single-cell suspension was obtained from pooled spleens and nodes, and erythrocytes were lysed with Tris-buffered ammonium-chloride. Cells were incubated with M5/114 and 187.1, rat antibodies anti-mouse H2-I-A/I-E and kappa chain, then with sheep anti-rat IgG magnetic beads (Dynabeads; Invitrogen), and negatively sorted. To investigate the effect of αIL-7R and Rapa in lymphocyte-deficient mice, T cell preparations from CBA/Ca donors were transferred into syngeneic CBA.Rag1−/− recipients at the dose of 6.5–9.5 × 106 per mouse, 3 days before B6 skin transplantation. To assess proliferation, 107 CFSE-labeled T cells from Thy1.1+ donors were transferred into syngeneic hCD52-Tg mice.

Analysis of T cell proliferation in vivo according to CFSE dilution

Thy1.1+ T cell enriched preparations were labeled with carboxyfluorescein diacetate succinimidyl ester 3 µM solution (CFSE; Molecular Probes, Paisley, Renfrewshire, UK), and injected into hCD52-Tg recipients on day 0 after depletion with campath; 7 days later spleens were collected for fluorescence-activated cell sorting (FACS) and proliferation analyses.

Analysis of T cell proliferation in vivo by EdU labeling

5-ethynyl-2′-deoxyuridine (EdU; Invitrogen) was dissolved in drinking water to 0.8 mg/mL and made available ad libitum to hCD52-Tg mice for 6 days from day 1 after depletion. Spleens were then collected and EdU-labeled T cells were detected with Click-iT EdU Flow-Cytometry Assay Kit (Invitrogen).

FACS analysis

Spleens were collected in RPMI containing 10% fetal bovine serum; single-cell suspensions and erythrocytes lysis were obtained as above; vital cells were counted with Trypan Blue (Sigma-Aldrich). Blood samples were collected in heparin and erythrocytes water lysis performed. Nonspecific labeling was blocked with an anti-mouse Fc gamma receptor antibody (2.4G2). Cells were stained for membrane markers with primary antibodies, then, where required, with streptavidin conjugates (BD Pharmingen, Oxford, Oxfordshire, UK), finally fixed with formaldehyde. For Foxp3 staining, cells were fixed and permeabilized with Foxp3 Staining Buffer Set (eBioscience, Hatfield, Hertforshire, UK), then stained with anti-Foxp3 antibodies. The following anti-mouse antibodies and relevant isotype controls were used: anti-CD19 (1D3), anti-CD45R/B220 (RA3-6B2), anti-CD3 (145-2C11), anti-CD4 (H129.19 and RM4-5), anti-CD8 (53-6.7), anti-CD44 (IM7), anti-CD62L (MEL-14), anti-CD90.1 (OX-7) (from BD Pharmingen); anti-CD25 (PC61.5) and anti-Foxp3 (FJK-16s) (from eBioscience); goat-anti-mouse IgG (Sigma); anti-kappa chain (187.1, produced in our laboratory). Flow-cytometry was performed with a four-color FACSCalibur flow-cytometer (BD Biosciences). Data were analyzed using FlowJo software, version 9.5 (Tree Star, Ashland, OR).

Statistical analysis

Statistical analysis was performed using Graphpad Prism software, version 5.0d (San Diego, CA). Log-rank Mantel-Cox test was used to compare graft survival curves and, unless otherwise specified, one-way analysis of variance followed by Bonferroni's posttests for comparison among the groups. p-Values < 0.05 were considered statistically significant, p > 0.05 not significant (NS), *p < 0.05, **p < 0.01; ***p < 0.001 and ****p < 0.0001.

Results

Lymphocyte depletion is insufficient for transplantation tolerance, but does not prevent its induction through co-receptor blockade

In order to study the effect of lymphocyte depletion and subsequent reconstitution on graft survival, we utilized, as recipients of MHC mismatched skin grafts, hCD52-Tg CBA/Ca mice [16], in which treatment with the anti-hCD52 antibody (campath) was particularly effective at depleting T cells (Figure 1A, Figure S2). T cell depletion in mice delayed, but never prevented, graft rejection (Figure 1B). Additional B cell depletion could not provide any further benefit (Figure S2). However, as anticipated [2], tolerance induction through co-receptor blockade was not hindered by T cell depletion (Figure 1B and C).

Figure 1.

T cell depletion is insufficient to promote long-term graft survival, but does not hinder the induction of tolerance with co-receptor blockade. (A) hCD52-Tg mice untreated or treated with campath, two intraperitoneal injections on days −3 and −1 at the dosage indicated in the figure, were euthanized on day 7 (3–5 mice/group); spleens were collected, live cells counted and characterized by fluorescence-activated cell sorting. Absolute numbers were calculated as product of numbers of spleen live cells and percentage of CD3+ (white bars), CD8+ (diagonally striped bars) and CD4+ T cells (longitudinally striped bars). Shown are means ± SD of absolute numbers of cells per spleen. (B) Fully mismatched B6 skin grafts were transplanted to (hCD52-Tg × CBA/Ca)F1 heterozygous mice under the cover of different treatments. Co-receptor blockade with αCD4 and αCD8 (♦, no. 5) induced graft acceptance in all the treated mice (MST >100 days). Depletion of T cells with campath (▴, no. 5) was insufficient to prevent graft rejection (MST 20 days). Treatment with αCD4 and αCD8 following depletion with campath (▪, no. 5) induced long-term graft survival (MST >100 days, p = 0.0049 compared with campath, p = 0.26 vs. αCD4 and αCD8). One mouse treated with campath, αCD4 and αCD8 was censored in the survival analysis on day 9 due to surgical failure. (C) The mice that had accepted the first skin graft under the cover of campath, αCD4 and αCD8 (▪, no. 3), or αCD4 and αCD8 (♦, no. 5) received a second B6 skin graft 100 days after the first graft. The majority of the mice in both the groups accepted also the second grafts, and there was no difference in graft survival between the two groups (MST >100 days for both the groups, p = 0.6). **p < 0.01, ***p < 0.001. αCD4/αCD8, anti-mouse CD4/CD8; MST, median survival time.

Short-course αIL-7R therapy following T cell depletion with campath can induce dominant transplantation tolerance in hCD52-Tg CBA/Ca mice

The addition of short-course αIL-7R to campath significantly prolonged graft survival, and in some experiments promoted long-term acceptance in more than 50% of the mice (p = 0.0003 vs. campath) (Figure 2A). The use of agly-αIL-7R achieved the same outcome (p < 0.0001 vs. campath) (Figure 2B and C), indicating that this benefit derives wholly from blockade of IL-7 binding to its receptor. Tolerant mice exhibited linked-suppression [19] to third-party (multiple minor) antigens incorporated in a second graft bearing the tolerated antigens (Figure 2D) so providing some evidence for active regulation. Moreover, αIL-7R prevented production of donor-specific antibodies (Figure S3), although this was not the overriding mechanism for enabling tolerance, as some mice making no anti-donor antibody rejected their grafts.

Figure 2.

Treatment with αIL-7R following T cell depletion with campath can induce dominant transplantation tolerance. B10 skin grafts were transplanted to hCD52-Tg homozygous mice under the cover of different treatments. (A) Depletion of T cells with campath (□, no. 10) significantly delayed the rejection of the graft compared to treatment with αIL-7R alone (▵, no. 10) (MST 25 and 16 days, respectively, p < 0.0001). The combination of campath and αIL-7R (▴, no. 11) significantly prolonged graft survival and promoted the acceptance of the graft in more than 50% of the mice (MST >200 days, p = 0.0003 vs. campath). Data are aggregated results of two experiments. One mouse treated with campath and αIL-7R died on day 28 and was censored in the survival analysis. (B) Similar results were obtained when aglycosylated version of the αIL-7R (agly-αIL-7R) was utilized: campath and agly-αIL-7R (▴, no. 14) versus campath alone (□, no. 10) (MST 145.5 and 21.5 days respectively, p < 0.0001). Data are aggregated results of two experiments. (C) In another experiment 14 hCD52-Tg homozygous mice received B10 skin grafts under the cover of campath and agly-αIL-7R (▴, no. 14); eight mice so treated accepted their grafts indefinitely. (D) 80 days later, all 14 mice received a second skin transplant from (B10 × BALB/k)F1 donors. Six out of eight mice that had accepted the first B10 graft (▴, no. 8) accepted also the second graft (MST >150 days, p = 0.0001 vs. all the other groups); whereas all the mice that had rejected the first graft (▵, no. 6) promptly rejected the second (MST 10 days), as did untreated (B6xCBA/Ca)F1 controls (○, no. 5) (MST 25 days), phosphate buffered saline treated hCD52-Tg controls (▪, no. 7) (MST 17 days), and mice treated campath and agly-αIL-7R without the first graft (□, no. 6) (MST 16 days). αIL-7R, blocking anti-IL-7R antibody; MST, median survival time.

The combination of αIL-7R and Rapa promotes long-term graft survival

However, the benefit of αIL-7R after T cell depletion was not always as impressive, and variable results were observed across different experiments: We obtained indefinite median survival time (MST) (>150 days) in five experiments, MST 55 days in one experiment, MST 39 days in two experiments using hCD52-Tg homozygous CBA/Ca recipients and MST 21 days in one experiment using hCD52-Tg heterozygous mice (Figure 3A). The addition of Rapa to campath did not prevent rejection (MST 31 days), while the combination of Rapa with campath and αIL-7R achieved extended graft survival in virtually all the recipients (MST 56 days, p = 0.001 vs. campath + Rapa), and, in a separate experiment with a prolonged course of Rapa, complete graft survival in two-thirds of the mice (MST > 100 days) (Figure 3A). The synergy between αIL-7R and Rapa was also observed when small numbers of T cells were transferred into lymphocyte-deficient mice, where campath had not been used to purge T cells (Figure 3B), and in campath-treated (B6xhCD52-Tg)F1 mice (Figure 3C), although in this strain tolerance was not achieved.

Figure 3.

The addition of Rapa to αIL-7R promotes long-term graft survival. (A) (hCD52-Tg × CBA/Ca)F1 heterozygous mice were transplanted with a fully mismatched B6 skin graft under the cover of different treatments. All the mice treated with campath and αIL-7R (▴, no. 7) rejected their graft (MST 21 days). Also mice treated with campath and Rapa (▪, no. 6) rejected their grafts (MST 31 days, p = 0.11 vs. campath and αIL-7R). The addition of αIL-7R to campath and Rapa (♦, no. 6) significantly extended graft survival (MST 56 days, p = 0.001 compared with campath and Rapa). In a separate experiment a prolonged administration of Rapa (10 injections over the first 35 days) (▾, no. 6) promoted long-term graft survival with four mice accepting the graft for more than 100 days (MST >100 days). (B) Fully mismatched B6 skin grafts were transplanted to CBA.Rag1−/− mice 3 days after the adoptive transfer of CBA/Ca CD3-enriched cells. A group of mice did not receive T cells (○, no. 4) and accepted the grafts indefinitely (MST > 75 days); whereas mice that received T cells without any treatment (□, no. 5) promptly rejected the grafts (MST 19 days). Treatment with αIL-7R (▴, no. 5) did not delay graft rejection (MST 21 days, p = 0.09 compared with no treatment). Treatment with Rapa (▪, no. 3) significantly extended graft survival (MST 49 days, p = 0.01 compared with no treatment), but could not prevent the rejection of the graft. The combination of αIL-7R and Rapa (♦, no. 5) promoted long-term graft survival, and induced graft acceptance in three mice (MST > 75 days, p = 0.02 and 0.04 compared with αIL-7R alone and Rapa alone, respectively). Data are aggregated results of three different experiments; within each experiment all the mice of different groups received the same number of cells: 6.5, or 7.5 or 9.5 × 106. (C) Fully mismatched BALB/C (H-2d) skin grafts were transplanted to (B6xhCD52-Tg)F1 heterozygous recipients under the cover of the different treatments given as in A: campath (□, no. 6) MST 16.5 days; campath plus αIL-7R (▴, no. 6) MST 18 days (p = 0.11); campath plus Rapa (▪, no. 6) MST 18.5 days (p = 0.08), campath αIL-7R and Rapa (♦, no. 6) MST 40 days (p = 0.01). αIL-7R, blocking anti-IL-7R antibody; MST, median survival time; Rapa, rapamycin.

Treatment with αIL-7R and Rapa delays T cell reconstitution and enriches for Tregs

In order to establish the extent to which αIL-7R and Rapa could influence T cell reconstitution, we treated hCD52-Tg mice with campath alone, or in combination with either αIL-7R or Rapa, or both drugs. We found that splenic T cell counts reached the nadir 1 week following depletion, irrespective of any additional drug (p < 0.001 vs. untreated group). Thereafter, T cell reconstitution started and was complete by week 4 in mice treated with campath alone, and proceeded similarly in mice that received αIL-7R. In contrast, reconstitution was delayed at week 4 in mice that received Rapa, alone or in combination with αIL-7R (p < 0.01 vs. untreated group). Nevertheless, even in these mice T cell counts returned to basal levels by weeks 12–14, 10–12 weeks after Rapa was stopped (Figure 4A, C and D). The addition of αIL-7R to Rapa prevented the imbalance between reconstituting CD8+ and CD4+ cells at weeks 1 and 4 (Figure 4B). Following depletion, irrespective of any additional drug, the emerging pattern of T cell phenotypes was significantly skewed toward an effector/memory composition characterized by more CD44+ cells and fewer CD62L+. This skewing was transient and disappeared once T cell reconstitution was complete (by week 4 for mice treated with campath ± αIL-7R, and by week 12–14 for those treated with campath + Rapa ± αIL-7R) (Figure 4E–H). Finally the addition of αIL-7R to campath induced a significant increase in the proportion of Foxp3+ Tregs at week 1; Rapa had a similar effect, which extended through to week 4; the combination of αIL-7R and Rapa further increased the proportion of reconstituting Tregs, which however, returned to basal levels by weeks 12–14. These data suggest that the treatment with αIL-7R and Rapa following depletion with campath might promote graft acceptance by delaying T cell reconstitution, and enriching for Tregs in the early reconstitution period. In this way the control of homeostatic expansion might provide a suitable context on which an allograft can impose tolerance.

Figure 4.

A short-course αIL-7R and Rapa delays T cell reconstitution after depletion with campath and enriches for reconstituting regulatory T cells. T cell reconstitution was studied in hCD52-Tg mice treated with campath alone (gray bars) or in combination with either αIL-7R (vertically striped bars) or Rapa (horizontally striped bars) or both drugs (black bars) (3–6 mice per group per time point). Spleens were collected 1, 4 and 12–14 weeks after depletion; live cells were counted and characterized by FACS. Statistical analysis was performed with one-way analysis of variance followed by Bonferroni's test for comparison of the different groups of mice at a given time point with not treated mice (NT; white bars). See Materials and Methods. Within group comparisons, where not significant to each other, are shown as NS. Results are represented as mean and standard deviation for comparison between the different groups at each given time point (horizontal brackets). (A, C, D) CD3+, CD4+ and CD8+ splenic T cells. Absolute numbers were obtained as product of live cell counts per spleen and relative FACS percentage. (B) Ratio of CD8+ versus CD4+ cells. (E, F) Percentage of CD44+ effector/memory T cells among CD4 and CD8 subpopulations. (G, H) Percentage of CD62L+ CD44− naïve T cells among CD4 and CD8 subpopulations. NA, data not available. (I) Percentage of CD25+ Foxp3+ cells among CD4 subpopulation. NS, not significant. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. αIL-7R, blocking anti-IL-7R antibody; FACS, fluorescence-activated cell sorting; Rapa, rapamycin.

Treatment with αIL-7R and Rapa selectively reduces the expansion of conventional T cells, but not regulatory T cells Tregs

We studied the effects of combined treatment on T cell proliferation in vivo by monitoring EdU incorporation in T cells. The proportion of EdU-labeled cells among splenic T cells was significantly higher in all the groups treated with campath compared to untreated controls (Figure 5A–C). While EdU incorporation into CD3+ cells seemed unaffected by αIL-7R and/or Rapa (Figure 5A), there was a significant reduction in the proportion of CD8+ EdU+ cells (46.6% ± 5.0 vs. 63.7% ± 9.2; p < 0.05) (Figure 5B) and an increase in CD4+ EdU+ cells (65.7% ± 3.0 vs. 47.6% ± 5.6; p < 0.01) (Figure 5C) with combined αIL-7R and Rapa, compared with campath alone. These findings suggest that treatment with αIL-7R and Rapa preferentially blocked CD8+ cell expansion.

Figure 5.

Treatment with αIL-7R and Rapa reduces the proportion of EdU-labeled CD8+ cells, while increasing that of CD4+ cells. EdU dissolved in drinking water at 0.8 mg/mL was administered to hCD52-Tg mice for 6 days from day 1 after T cell depletion with campath. The following groups were included: no treatment (○, no. 6); campath (□, no. 6); campath + αIL-7R (▴, no. 4); campath + Rapa (▪, no. 4); campath + αIL-7R + Rapa (♦, no. 6); on day 7 spleens were collected and the proportion of EdU+ T cells was determined by fluorescence-activated cell sorting. (A–C) Percentage of EdU-labeled cells among CD3+, CD8+ and CD4+ populations. NS, not significant. **p < 0.01, ***p < 0.001. αIL-7R, blocking anti-IL-7R antibody; Rapa, rapamycin.

The study above was conducted in circumstances where potentially lytic campath antibody remained in the circulation. In order to get a clear window on reconstitution, we studied proliferation by transferring CFSE-labeled T cells from Thy1.1+ donors into syngenic hCD52-Tg recipients. Consistent with the data on reconstitution (Figure 4), Thy1.1+ T cells transferred into hosts treated with campath acquired an effector/memory phenotype characterized by higher CD44 expression and lower CD62L, irrespective of any additional drug (Figure 6A and B). A significantly higher proportion of Thy1.1+ CD4+ Foxp3+ cells was found in mice treated with campath compared with controls (23.4% ± 5.3 vs. 6.7% ± 1.7, p < 0.001); the addition of αIL-7R or Rapa further enriched for Tregs (35.6% ± 4.0 and 39.0% ± 4.5, p < 0.01 vs. campath); and the combination of the three drugs was particularly effective at favoring Treg emergence (52.4% ± 3.7, p < 0.01 vs. campath + αIL-7R or campath + Rapa) (Figure 6C).

Figure 6.

Treatment with αIL-7R and Rapa enriches for reconstituting regulatory T cells. 107 CFSE-labeled CD3-enriched Thy1.1+ cells were adoptively transferred into syngenic hCD52-Tg (Thy1.2+) mice. The following groups were included: no treatment (○); campath (□); campath + αIL-7R (▴); campath + Rapa (▪); campath + αIL-7R + Rapa (♦) (3–6 mice/group). Seven days later splenic cells were collected and analyzed by fluorescence-activated cell sorting. (A) Expression of the memory marker CD44 on Thy1.1+ cells. (B) Expression of the naivety marker CD62L on Thy1.1+ cells. (C) Percentage of Foxp3+ cells in the Thy1.1+ CD4+ subset. NS, not significant. **p < 0.01, ***p < 0.001. αIL-7R, blocking anti-IL-7R antibody; Rapa, rapamycin.

We studied the extent of proliferation of T cell subsets by analyzing CFSE dilution with the FlowJo proliferation platform. Two parameters were followed: the division index, the mean number of divisions of the whole cell population; and the proliferation index, the mean number of divisions of the cells that have divided at least once [20]. The division index of Thy1.1+ CD8+ and CD4+ cells was increased when the cells were transferred into mice depleted with campath compared to that into replete controls (1.5 ± 0.3 vs. 0.1 ± 0.1, p < 0.001 for CD8+; 1.2 ± 0.1 vs. 0.1 ± 0.09, p < 0.001 for CD4+). The addition of αIL-7R or Rapa significantly decreased this index, and the combination of the two drugs further reduced it to levels similar to those found in controls (0.3 ± 0.1, p > 0.5 for CD8+; 0.2 ± 0.05, p > 0.5 for CD4+ vs. controls) (Figure 7A and B, left diagrams). The proliferation index of Thy1.1+ CD8+ cells was not affected by any treatment, whereas the proliferation index of Thy1.1+ CD4+ cells was increased in depleted mice treated with αIL-7R and Rapa (3.4 ± 0.5 vs. 1.8 ± 0.2 in mice treated with campath; p < 0.001) (Figure 7A and B, right diagram). The division index of Thy1.1+ CD4+ Foxp3+ and Foxp3− cells was similar following treatment with campath (1.0 ± 0.2 vs. 1.2 ± 0.2, p > 0.05), whereas the addition of αIL-7R and Rapa selectively reduced the division index of Foxp3− cells (0.8 ± 0.1 vs. 0.1 ± 0.01, p < 0.001) (Figure 7C). Taken together these results indicate that the combination of αIL-7R and Rapa reduces the homeostatic expansion of CD8+ and CD4+ T cells but does not hinder the accumulation of Tregs, which emerge preferentially under this treatment.

Figure 7.

Treatment with αIL-7R and Rapa selectively reduces the expansion of CD8+ and conventional CD4+ T cells, but not that of regulatory T cells. Data are obtained from the same experimental mice described in Figure 6: no treatment (○); campath (□); campath + αIL-7R (▴); campath + Rapa (▪); campath + αIL-7R + Rapa (♦) (3–6 mice per group). Analysis of cell division and proliferation was performed according to CFSE dilution analyzed with FlowJo proliferation platform. Division index is the mean number of divisions of the whole population of cells; proliferation index is the mean number of divisions of the cells that divided at least once. (A and B, histograms) Representative histograms of CFSE dilution of Thy1.1+ CD8+ or CD4+ cells in mice not treated (shaded), treated with campath (black line), treated with campath + αIL-7R + Rapa (gray line). (A and B, left diagrams) Division index of Thy1.1+ CD8+ and CD4+ cells. (A and B, right diagrams) Proliferation index of Thy1.1+ CD8+ and CD4+ cells. Abbreviations: NT, no treatment; C, campath; +αIL-7R, campath + αIL-7R; +Rapa, campath + Rapa; All, campath + αIL-7R + Rapa. (C, histogram) Representative histogram of CFSE dilution of Thy1.1+ CD4+ (shaded), CD4+ Foxp3− (black line) and CD4+ Foxp3+ cells (gray line) in mice treated with campath + αIL-7R + Rapa. (C, diagrams) Division index (left) and proliferation index (right) of Thy1.1+ CD4+ (○) Foxp3− (▵) and Foxp3+ (□) cells in mice treated with campath alone or campath in combination with αIL-7R and Rapa. Abbreviations: +αIL-7R + Rapa: campath + αIL-7R + Rapa. NS, not significant. *p < 0.05, **p < 0.01, ***p < 0.001. αIL-7R, blocking anti-IL-7R antibody; Rapa, rapamycin.

TGF-ß neutralization reduces graft survival in T cell–depleted mice treated with αIL-7R and Rapa

We asked whether TGF-ß, a cytokine crucial for the induction of pTreg [21] might play a role in this setting. In mice receiving the combined drugs TGF-ß neutralization substantially diminished graft survival time (MST 28 days vs. >40 days in mice that received the isotype control; p = 0.03) (Figure 8A), although the proportion of reconstituting Foxp3+ T cells favored by treatment with αIL-7R and Rapa was not reduced by TGF-ß blockade (Figure 8B).

Figure 8.

TGF-ß neutralization reduces graft survival in T cell–depleted mice treated with αIL-7R and Rapa. Fully mismatched B6 skin grafts were transplanted to hCD52-Tg mice under the cover of different treatments. Recipient mice were monitored 3 times/week for graft rejection, and bled at weeks 1 and 4 after transplantation to measure CD4+ CD25+ Foxp3+ cells by fluorescence-activated cell sorting. (A) Graft survival. Depletion of T cells with campath (□; no. 5) delayed graft rejection compared with no treatment (○; no. 5) (MST 19 and 11 days, respectively; p < 0.0001). The combination of αIL-7R and Rapa improved survival compared with treatment with campath alone: MST >40 days in the isotype control group (♦; no. 5) and 28 days in the αTGF-ß group (▾; no. 6) (p < 0.0042 vs. campath). However, TGF-ß neutralization significantly limited such improvement compared to the Isotype control (p = 0.032). (B) Proportion of CD4+ CD25+ Foxp3+ regulatory T cells in the peripheral blood at weeks 1 and 4 after transplantation (same symbols as for panel A). One mouse in the αTGF-ß group was censored in the survival analysis due to surgical failure on day 7; four mice in the isotype control group were euthanized on days 39–44 while still carrying a viable graft. NT, no treatment. NS, not significant. *p < 0.05, **p < 0.01. αIL-7R, blocking anti-IL-7R antibody; MST, median survival time; Rapa, rapamycin.

Discussion

Extended graft survival and even transplantation tolerance to MHC mismatched skin grafts were achieved following T cell depletion by use of a protocol based on guiding lymphocyte reconstitution. Clinical experience with alemtuzumab has indicated preferential survival of CD4+ CD25+ Tregs in patients [22, 23], and also in hCD52-Tr mice [24]. Clearly, that differential impact of lymphocyte ablation was insufficient to prevent graft rejection [1]. Previous studies in lymphopenic mice have indicated that sufficient naïve Tregs made available from the outset were able to control rejection responses mediated through homeostatic expansion [2, 25].

Antibody blockade of IL-7R has proven effective at preventing and treating certain experimental autoimmune diseases [26], and graft-versus-host disease [27]. We found that short-course αIL-7R could, albeit variably, prolong the survival of fully mismatched skin grafts in hCD52-Tg mice following T cell depletion with campath, and induce transplantation tolerance in up to 50% of CBA mice carrying the CD52 transgene (Figure 2). This extended survival was associated with dominant tolerance because of the evidence of linked suppression toward third-party antigens presented together with the tolerated set [19]. This variation between strains might be explained by the strain-specific persistence of effector/memory T cells, which are more resistant to antibody lysis than naïve T cells [10]. The addition of Rapa, known to block proliferation of activated T cells [28], and to selectively enhance Treg expansion [12] provided a level of synergy in hCD52-Tg heterozygous mice (Figure 3A). The same combination could also delay rejection in lymphocyte-deficient mice injected with syngeneic T cells (Figure 3B), a system that provides a more stringent test of a tolerizing protocol [11] as transferred T cells rapidly repopulate by homeostatic expansion and a substantial proportion acquire a functional memory-like phenotype [8].

This protocol, despite enriching for Foxp3+ T cells early on, did not prevent eventual normalization of T cell counts and acquisition by some T cells of typical memory-like phenotypes [2, 9, 25] (Figure 4). Moreover, the addition of αIL-7R was capable of restraining the expansion of CD8+ T cells and promotion of CD8+ memory cells by Rapa when given alone.

Measures of proliferation in vivo with two different approaches (Figures 5 and 7) allowed us to confirm that treatment with αIL-7R and Rapa constrained CD8+ T cell proliferation. The effect on CD4+ T cells is more complex: αIL-7R and Rapa reduced the proportion of CD4+ cells entering division, but those cells that escaped this block proliferated more than reconstituting CD4+ cells in mice treated with campath alone. Consistent with our working hypothesis, we found that Tregs are included within this set of CD4+ cells whose proliferative capacity is unaffected by αIL-7R and Rapa.

A further and unexpected benefit of αIL-7R relates to its ability to inhibit generation of anti-donor antibodies (Figure S3); nonetheless, additional B cell ablation did not provide extended graft survival beyond T cell depletion alone (Figure S2).

Finally, neutralization of TGF-ß abrogated the benefit of our short maintenance protocol (Figure 8); as Tregs are essential for tolerance [29] and are peripherally induced by TGF-ß [21], enhanced graft loss following TGF-ß blockade might be due to decreased conversion to pTregs.

Collectively, these results suggest that one might build on the benefits of lymphocyte depletion as induction therapy, by additional short-term therapies, which could skew the lymphocyte reconstitution pattern in favor of regulation. This is not to say that the drug combination we have used should be adopted in the clinic, but rather emphasizes that future research should seek drug combinations targeting the character of lymphocyte reconstitution.

Acknowledgments

The work was supported by grants from the ERC Framework Programmes 6 “RISET” and 7 “Betacell therapy,” ERC Advanced Investigator Grant “PARIS,” and the Medical Research Council. GP was partially supported by a grant by Italian Society of Nephrology.

Disclosure

The authors of this manuscript have conflicts of interest to disclose as described by the American Journal of Transplantation. Drs. Waldmann and Cobbold are recipients of royalties for the commercialization of alemtuzumab, and the work reported here was partially supported by Genzyme Corporation.

Ancillary