SEARCH

SEARCH BY CITATION

Keywords:

  • demyelinating diseases;
  • immunology;
  • multiple sclerosis;
  • molecular genetics

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflict of interest and sources of funding statement
  9. References

Objective

The chemokine receptor CCR5 may be important for the recruitment of pathogenic T cells to the CNS in multiple sclerosis (MS). We hypothesized that this chemokine receptor might still be important for T-cell migration during treatment with anti-very late antigen (VLA)-4 antibody. We therefore analysed whether natalizumab-treated MS patients carrying the CCR5 Δ32 deletion allele, which results in reduced expression of CCR5 on the cell surface, had lower disease activity.

Methods

CCR5 Δ32 was analysed in 212 natalizumab-treated MS patients.

Results

CCR5 Δ32 status had no significant impact on the frequency of relapses 1 year prior to natalizumab treatment or during the first 48 weeks of treatment. The multiple sclerosis severity score (MSSS) was significantly lower at baseline in patients carrying CCR5 Δ32 (P = 0.031).

Conclusions

CCR5 Δ32 is not associated with lower disease activity in MS patients treated with natalizumab. We found lower MSSS scores in patients carrying CCR5 Δ32 compared with the remaining patients, which is consistent with previous studies reporting an association with a more favourable disease course. Further studies are, however, needed before the relationship between CCR5 Δ32 and disease activity in MS can be definitely established.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflict of interest and sources of funding statement
  9. References

Multiple sclerosis (MS) is a chronic disease affecting young adults, characterized by inflammation in the central nervous system (CNS), resulting in demyelination and axonal damage [1]. The recruitment of pathogenic lymphocytes and other mononuclear cells to the CNS in MS is guided by sequential interactions between adhesion molecules and chemotactic factors. Thus, the expression of specific chemotactic factors in inflamed tissue helps guide specific subsets of immune cells expressing corresponding receptors to the site of inflammation. Perivascular inflammation is typical in MS lesions, and chemokines and their receptors are important for leucocyte recruitment into the CNS [2-4]. The gene for one such receptor, the CC chemokine receptor 5 (CCR5), located on chromosome 3p21, is predominantly expressed on activated Th1-cells, macrophages, dendritic cells and microglia. In active, demyelinating brain lesions CCR5 expression has been observed on the surface of T helper type 1 (Th1) cells, regulatory T cells (T-reg) and monocytes [5-7].

A deletion in the coding region of CCR5 termed CCR5 Δ32 gives rise to a non-functional receptor that is retained in the cell [8]. CCR5 Δ32 heterozygous individuals have low expression of CCR5 protein and homozygous carriers of this mutation lack CCR5 on the cell surface. Among untreated MS patients, carriers of CCR5 Δ32 have a lower risk of recurrent disease activity, lower T2 lesion load, later onset of disease and less rapid disease progression [9-13]. Other studies have, however, found that CCR5Δ32 has no favourable effect on the disease course [8, 14-18].

Chemokine receptor 5 is also involved in the cellular entry of human immunodeficiency virus (HIV), and CCR5 antagonists have now been developed for the treatment of HIV infection [19]. If MS patients carrying the CCR5 Δ32 allele and treated with disease-modifying therapies were found to be more protected from disease activity than patients carrying two wild-type alleles, this might imply enhanced efficacy of combination therapy with a CCR5 antagonist and standard disease-modifying therapies. We hypothesized that carriers of the CCR5 deletion allele would have fewer relapses of disease than non-carriers. This hypothesis was addressed in prospectively followed Danish patients with relapsing–remitting (RRMS) treated with natalizumab who were genotyped for the CCR5 Δ32 allele.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflict of interest and sources of funding statement
  9. References

Materials

We included 212 consecutive natalizumab-treated RRMS patients attending our clinic at Rigshospitalet, Copenhagen. According to Danish regulatory provisions, natalizumab can be administered to (i) patients with two or more documented relapses or sustained increase of 2 EDSS points on disease-modifying therapy (DMT) in the previous year; (ii) patients switching from mitoxantrone either because they approached the upper limit of cumulative mitoxantrone dose or had disease activity on mitoxantrone therapy; and (iii) as de novo therapy to patients with rapidly evolving, severe RRMS defined by two or more disabling relapses in 1 year, and one or more gadolinium-enhancing lesions on brain MRI or a significant increase in T2 lesion load compared with a previous MRI. Written informed consent was obtained from all patients, and the regional ethics committee approved the protocol (KF 01314 009).

Patients were followed prospectively for at least 12 months. All patients were evaluated by a neurologist after 3 and 6 months, followed by biannual controls. Information about relapses and expanded disability status scale (EDSS) scores were recorded in the central Danish MS Treatment Registry. MS severity score (MSSS) values, a disease duration-corrected measure of MS severity based on the EDSS score, were calculated for all patients [20].

Methods

Venous blood samples were obtained in EDTA tubes. Purification of DNA from whole blood was performed using the NucleoSpin Blood (Macherey-Nagel) method resulting in yields ranging from 10 to 600 ng/μl. The DNA was stored at −80°C.

Prior to polymerase chain reaction (PCR) analysis, the DNA was diluted to a concentration of 10 ng/μl. PCR amplification was performed in a 20 μl reaction volume, using a master mix containing GeneAmp PCR Gold buffer (Applied Biosystems, Life Technologies, Nærum, Denmark), 2.5 mm MgCl2, 200 μm of each dNTP, 0.2 μm of each PCR primer, 1.2 unit of Amplitaq Gold DNA polymerase (Applied Biosystems) and 5 μl DNA template.

PCR primers for genotyping were designed to distinguish between the presence and absence of the CCR5 Δ32 allele [8]. A 264 bp segment was identified as the wild-type CCR5 allele, the 232 bp segment represented the deletion allele, and a 416 bp segment represented a heterodimer of heterozygous PCR products, visible only when run on a non-denaturating gel. PCR primers were 5′CCCAGGAATCATCTTTACCAG 3′ (forward) and 5′ATGATTGTTTATTTTCTCTTCTGGG3′ (reverse). PCR cycling parameters were 10-min activation of Taq enzyme at 95°C followed by 35 cycles of 95°C denaturation for 10 s, 55°C annealing for 30 s and 72°C elongation for 40 s and a final elongation step at 72°C for 4 min. Subsequent analysis of PCR products was performed on a DNA 1000 gel chip using a BioAnalyzer 2100 (Agilent Technologies, Hørsholm, Denmark), which uses a non-denaturating gel for separation of PCR products.

Statistics

Data from the Danish MS Treatment Registry were used to determine the time from beginning natalizumab treatment to first relapse, annualized relapse rates and EDSS scores. Due to the low number of CCR5 Δ32 homozygotes, hetero- and homozygotes were grouped together as carriers of the deletion allele in the statistical analyses. Data are given as median with interquartile range.

Annualized relapse rates and EDSS/MSSS data were analysed by the nonparametric Mann–Whitney U-test. The time to first relapse after initiation of treatment with natalizumab in carriers and non-carriers of CCR5 Δ32 was analysed in a Kaplan–Meier plot and by the log-rank test.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflict of interest and sources of funding statement
  9. References

A total of 212 patients were included in the analysis (Table 1). 73.6% carried the wild-type CCR5 allele. 24.1% were heterozygotes, and 2.4% were homozygotes for the CCR5 Δ32 allele. 64.5% were women, and 35.5% were men. Only men were homozygous for CCR5 Δ32. At MS onset, wild-type patients were on average 30.2 years of age, heterozygotes 30.7 years and homozygotes 26.4 years of age (P = 0.926). On average, wild-type patients had MS for 12.0 years, and carriers of the polymorphism 12.1 years before treatment with natalizumab was initiated. CCR5 Δ32 status had no significant impact on the frequency of relapses 1 year prior to natalizumab treatment (P = 0.439).

Table 1. A total of 212 patients were enrolled in the study. Only 5 patients were Δ32 homozygotes and were pooled with the 51 heterozygous patients in the statistical analysis. Median and interquartile range (IQR) are supplied for each factor. In total, 26.4% had either one or two deletion alleles. Patients with the deletion allele had significantly lower multiple sclerosis severity score (MSSS) scores at baseline, and expanded disability status scale (EDSS) showed the same trend. No significant difference was seen in age at multiple sclerosis (MS) disease onset, disease duration, number of relapses 1 year prior to natalizumab treatment or annualized relapse rate after initiation of natalizumab treatment
 Wild typeCCR5 Δ32 heterozygousCCR5 Δ32 homozygousP-value
n (%, with 95% confidence interval)156 (74, 68–78%)51 (24, 20–29%)5 (2.4, 1.1–4.9%)NA
Gender: women/men102/5435/160/5NA
Age at onset43 (IQR 15)42 (IQR 11)38 (IQR 15)NS
EDSS at baseline4.5 (IQR 3)4.0 (IQR 3)4.5 (IQR 4)NS
MSSS at baseline5.4 (IQR 2.9)4.2 (IQR 3.6)5.3 (IQR 5.8)NS
Disease duration10.0 (IQR 7)11.0 (IQR 7)6.0 (IQR 22)NS
Relapse 1 year prior to natalizumab2.0 (IQR 1)2.0 (IQR 1)3.0 (IQR 2)NS
Annualized relapse rate at 24 weeks0 (IQR 2)0 (IQR 2)0.44 (IQR 2)NS
Annualized relapse rate at 48-week observations0 (IQR 1)0 (IQR 1)1.5 (IQR 2)NS

Comparing EDSS scores between carriers of the CCR5 Δ32 allele and wild-type patients, we found that scores were somewhat, albeit not significantly, lower at baseline in carriers of the deletion allele (4.0) than in patients carrying two wild-type alleles (4.5). The MSSS was significantly lower at baseline in carriers of CCR5 Δ32 (4.6) than in patients who were homozygous for the wild-type allele (5.4, P = 0.031). This difference between the EDSS and MSSS may reflect that the EDSS is an assessment of the clinical severity of the disease at a single point in time, whereas the MSSS is a measure of disease severity that is calculated by correcting the EDSS for disease duration [20].

After initiation of natalizumab treatment, we found that relapse rates among carriers and non-carriers of the CCR5 Δ32 allele were not significantly different from week 0 to 24 and week 0 to 48 of treatment (P = 0.318 and 0.532). Finally, we analysed the time to first relapse for deletion allele carriers and wild-type patients during the first year of treatment with natalizumab (Fig. 1). We found a weak trend to longer relapse-free periods in the CCR5 Δ32 carriers, but this difference was far from being statistically significant (P = 0.35).

image

Figure 1. Kaplan–Meier survival plot showing time to first relapse among carriers and non-carriers of the CCR5 Δ32 deletion allele. Observation period was 1 year, and relapses were marked with ‘+’. Although a week trend was seen in favour of patients with the deletion allele, no significant difference was detected among the two groups.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflict of interest and sources of funding statement
  9. References

The role of the adhesion molecule VLA4 in the pathogenesis of MS is proven by the clinical efficacy of treatment with natalizumab. However, patients treated with natalizumab still suffer relapses. This could signify redundancy in the pathogenesis with other adhesion molecules also being of importance. Indeed, recent studies indicate that in the animal model experimental autoimmune encephalomyelitis, VLA4 is necessary for the recruitment of pathogenic T helper type 1 (Th1) but not Th17 cells to the CNS [21, 22]. An alternative explanation for the residual disease activity in patients treated with natalizumab is that the dose of natalizumab could be too low to completely saturate VLA4 on the target leucocytes [23-25]. Finally, relapses might be initiated by reactivation of pathogenic immune cells within the CNS without a need for recruitment of additional cells from the blood stream [26].

Regardless of the exact explanation for the residual disease activity in patients treated with natalizumab, we hypothesized that carriers of CCR5 Δ32 treated with natalizumab could have lower disease activity than non-carriers as lower expression of the CCR5 receptor on immune cells might still affect the transmigration of pathogenic cells across the blood–brain barrier as previously shown for untreated patients with MS [10]. If so, we would expect carriers of the deletion allele to have longer relapse-free periods and fewer relapses. This did not, however, turn out to be the case. This may reflect redundancy in the chemokine receptor system, for example, a key role of the chemokine receptor CCR6 in the recruitment of pathogenic Th17 cells which do not depend on VLA4 for recruitment to the CNS [21, 22, 27]. The lack of an association between disease activity and CCR5 genotype would, however, also be expected if treatment with natalizumab itself sufficiently impairs the ability of CCR5-expressing, pathogenic cells to migrate across the blood–brain barrier. Subsets of CD4+ T cells do, indeed, co-express CCR5 and the target of natalizumab VLA4 [28]. Thus, even though we could not detect an association between CCR5 Δ32 and relapses in patients treated with natalizumab, this does not exclude a role of CCR5 as a functionally relevant chemokine receptor in the pathogenesis of MS. Furthermore, our results do not exclude that patients carrying CCR5 Δ32 could progress more slowly on treatment with natalizumab as our study was only powered to detect an effect on relapse risk.

We previously studied whether genetic polymorphism in the CCR5 gene might be associated with disease activity in MS patients treated with IFN-β, but found no difference in disease activity in carriers of the CCR5 Δ32 allele or in patients carrying different polymorphisms in the promoter region of the CCR5 gene [29]. Surprisingly, the relationship between CCR5 Δ32 and lower cell surface expression of CCR5 expression normally observed was not found in MS patients treated with IFN-β. It is possible that this reflects a direct effect of IFN-β on the expression of CCR5 on the cell surface [30]. This could reflect a direct effect on the transcription or stability of CCR5 mRNA, but in a previous study, we did not detect lower CCR5 gene expression in MS patients treated with IFN-β [31]. Alternatively, the effect could reflect suppression of the translation of CCR5 protein or gross changes in circulating T-cell subsets in MS patients treated with IFN-β [30]. Effects on the expression of CCR5 on cell types other than T cells, for example, monocytes and microglia, should also be taken into account [5, 6].

CCR5 Δ32 homozygotes do not express functional CCR5 receptor on the cell surface. In our patient group, we found 5 patients who were CCR5 Δ32 homozygous. These patients were not significantly different in age at onset, annualized relapse rate and recurrent disease activity compared with CCR5 wild-type MS patients. Interestingly, we found that patients carrying CCR5 Δ32 had a lower mean MSSS score than the remaining patients. This finding is consistent with previous studies suggesting that CCR5 Δ32 may be associated with a less severe disease course and a lower relapse risk [9-11]. The results of the present study indicate that, as for patients treated with IFN-β, CCR5 Δ32 is not associated with lower disease activity in patients treated with natalizumab. This implies that combination therapy with either of these agents and CCR5 antagonists is unlikely to be more efficacious than treatment with either IFN-β or natalizumab alone. Further studies of untreated MS patients are needed before the relationship between CCR5 Δ32 and disease activity and the precise role of this chemokine receptor in the pathogenesis of MS can be definitely assessed. Thus, at present, the analysis of the CCR5 Δ32 deletion allele is not useful as a prognostic or treatment response marker in MS.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflict of interest and sources of funding statement
  9. References

This project could not have been conducted without the competent help from Vibeke Fuglholt and other staff at DMSC.

Conflict of interest and sources of funding statement

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflict of interest and sources of funding statement
  9. References

The study was supported by the Danish MS Society, Brødrene Rønje Holding, the Warwara Larsen Foundation, the Danish Council for Strategic Research and the Johnsen Foundation.

Morten Møller and Helle Bach Søndergaard have nothing to disclose. Nils Koch-Henriksen has received honoraria for lecturing and participation in advisory boards, travel expenses for attending congresses and meetings and financial support for monitoring the Danish MS Treatment Registry from Bayer-Schering, Merck-Serono, Biogen Idec, Novartis and Sanofi-Aventis. His department has received compensation for participation in pharmaceutical company sponsored clinical trials from Biogen Idec and from Merck Serono. Per Soelberg Sorensen has served on scientific advisory boards for Biogen Idec, Merck Serono, Novartis, Genmab, TEVA, Elan, GSK, has been on steering committees or independent data monitoring boards in clinical trials sponsored by Merck Serono, Genmab, TEVA, GSK, Bayer Schering, and has received funding of travel for these activities; he has served as Editor-in-Chief of the European Journal of Neurology and is currently editorial board member for Multiple Sclerosis Journal, European Journal of Neurology, Therapeutic Advances in Neurological Disorders; he has received speaker honoraria from Biogen Idec, Merck Serono, TEVA, Bayer Schering, Sanofi-Aventis and Novartis. His department has received research support from Biogen Idec, Bayer Schering, Merck Serono, TEVA, Baxter, Sanofi-Aventis, BioMS, Novartis, Bayer, RoFAR, Roche, Genzyme, from the Danish Multiple Sclerosis Society, the Danish Medical Research Council and the European Union Sixth Framework Programme: Life sciences, Genomics and Biotechnology for health.Finn Sellebjerg has served on scientific advisory boards for Biogen Idec, Merck Serono, Novartis, Sanofi-Aventis and TEVA, has been on the steering committee of a clinical trial sponsored by Merck Serono, and served as consultant for Biogen Idec and Novo Nordisk; he has received support for congress participation from Biogen Idec, Novartis and Sanofi Aventis; he has received speaker honoraria from Biogen Idec, Merck Serono, Bayer Schering, Schering-Plough, Sanofi-Aventis and Novartis. His laboratory has received research support from Biogen Idec, Bayer Schering, Merck Serono, Sanofi-Aventis and Novartis. Annette Bang Oturai has served on scientific advisory boards for Novartis, has received speaker honoraria from Biogen Idec, Merck Serono and Novartis, and has received research support from the Danish Multiple Sclerosis Society, the Warwara Larsen Foundation and the Johnsen Foundation.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflict of interest and sources of funding statement
  9. References