SEARCH

SEARCH BY CITATION

Keywords:

  • brown;
  • uncoupling protein;
  • white

Abstract

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results and discussion
  5. Conflict of interest
  6. References

Aim

Hypothermia induced by cold exposure at birth is prevented in sheep by the rapid onset of non-shivering thermogenesis in brown adipose tissue (BAT). Changes in adipose tissue composition in early life are therefore essential for survival but also influence adiposity in later life and were thus examined in detail during early development.

Methods

Changes in adipose composition were investigated by immunohistochemistry and qRT-PCR between the period from the first appearance of adipose in the mid gestation foetus, through birth and up to 1 month of age.

Results

We identified four distinct phases of development, each associated with pronounced changes in tissue histology and in distribution of the BAT specific uncoupling protein (UCP)1. At mid gestation, perirenal adipose tissue exhibited a dense proliferative, structure marked by high expression of KI-67 but with no UCP1 or visible lipid droplets. By late gestation large quantities of UCP1 were present, lipid storage was evident and expression of BAT-related genes were abundant (e.g. prolactin and β3 receptors). Subsequently, within 12 h of birth, the depot was largely depleted of lipid and expression of genes such as UCP1, PGC1α, CIDEA peaked. By 30 days UCP1 was undetectable and the depot contained large lipid droplets; however, genes characteristic of BAT (e.g. PRDM16 and BMP7) and most characteristic of white adipose tissue (e.g. leptin and RIP140) were still abundant.

Conclusion

Adipose tissue undergoes profound compositional changes in early life, of which an increased understanding could offer potential interventions to retain BAT in later life.

Brown adipose tissue (BAT) is a highly specialized tissue, uniquely able to rapidly produce large amounts of heat through the activation of non-shivering thermogenesis. This is facilitated by the action of its key marker protein, the BAT-specific uncoupling protein (UCP)1 (Cannon & Nedergaard 2004). BAT is particularly important at birth in precocial species such as sheep and human beings where young are born with a mature hypothalamic–pituitary–adrenal (HPA) axis and do not benefit from huddling with litter mates (Cannon et al. 1988). Subsequently depending on the species and depot, BAT can be lost completely during early life, or replaced by white adipose tissue (WAT). In sheep, the thermogenic capacity is thought to be irreversibly lost after birth within a matter of days after birth (Lomax et al. 2007). However, there is evidence that some inherent adipose plasticity exists from work in other species. In adult rodents for example, a reduction in environmental temperature can trigger a transformation of WAT back into BAT (Walden et al. 2012). The mechanisms behind such transformations are complex and remain to be fully elucidated. Rodent studies have established that brown adipocytes are derived from a myogenic lineage, separate entirely from WAT (Seale et al. 2008). Since this discovery, an increasing number of lineage defining BAT and WAT markers have been identified or proposed but have yet to be examined from a developmental perspective in detail in a large mammal such as the sheep.

We have investigated the expression of a variety of genes involved in adipose development and function. Firstly, genes involved in BAT adipogenesis were examined. These included bone morphogenic protein (BMP)7 (Tseng et al. 2008), cell death-inducing DFFA-like effector A (CIDEA) and peroxisome proliferator-activated receptor γ, coactivator (PGC)1α (Fruhbeck et al. 2009) PR domain containing 16 (PRDM16), potassium channel, subfamily K, member 3 (KCNK3), pyruvate dehydrogenase kinase, isozyme 4 (PDK4), transglutaminase 2 (TGM2) and homeobox (HOX)A1. Next, those linked to thermogenesis including the long form of the prolactin receptor (PRLR), glucocorticoid receptor type 2 (GR), adrenergic-β3-receptor (ADRB3) shown to cause adipose remodelling (Granneman et al. 2005) as well as playing a major role alongside deiodinase iodothyronine type II (DIO2) in promoting thermogenesis (Christoffolete et al. 2004, Forrest et al. 2007) and UCP1 itself.

Likewise, we examined genes involved in WAT adipogenesis such as BMP4 (Schulz & Tseng 2009) and antigen identified by monoclonal antibody Ki-67 (KI-67) a general marker of cellular proliferation. We also looked at HOXC9 proposed to be a marker of brown-in-white (BRITE) adipocytes. Finally, several genes whose expression has been shown to be high during adipogenesis of both WAT and BAT were investigated, many of which are associated with lipid sequestration and include CCAAT-enhancer-binding protein β (C/EBPβ), fatty acid-binding protein (FABP)4. leptin, adiponectin, adipose differentiation–related protein (ADRP) and twist homolog (TWIST)1, together with receptor-interacting protein (RIP)140 a known repressor of BAT that may be involved in tissue remodelling (Nichol et al. 2006).

The extent to which adipose tissue development from foetal to postnatal life may be characterized by specific changes in brown and/or white adipocyte populations has yet to be fully described. Therefore, we performed a study in sheep to define the major changes in adipose tissue composition, and its molecular signature through these critical stages of development. Our ontogeny study began with the first appearance of adipocytes within the mid-gestation sheep foetus. It then encompassed the period around birth coincident with the rapid appearance of UCP1 (Clarke et al. 1997a) and ended when BAT had been completely replaced with WAT at 30 days of postnatal life (Clarke et al. 1997b). The study was undertaken on the perirenal–abdominal depot as this represents ~75% of total adipose tissue in the foetal/neonatal sheep (Alexander & Bell 1975) and is subsequently the fastest growing tissue over the first month of postnatal life (Clarke et al. 1997b).

Materials and methods

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results and discussion
  5. Conflict of interest
  6. References

Animals and diets

A mixture of Welsh Mountain and Border Leicester cross Swaledale sheep were used in this study. Previous work by our groups has established no distinguishable differences between breeds at the same developmental ages in terms of the molecular characteristics of primary organs including adipose tissue (Gnanalingham et al. 2005, Hyatt et al. 2007). Perirenal–abdominal adipose tissue was sampled from foetuses at 80 and 140 days gestation (term approx. 147 days), and sheep within 12 h of birth and at 7 and 30 days after birth (n = 4–8 at each sampling age, from a total of 32 sheep), following euthanasia with an overdose of barbiturate (i.v. 200 mg kg−1 pentobarbital sodium: Euthatal: RMB Animal Health, UK). All sheep at postnatal time points were born normally at term to mothers that were fed 100% of their total metabolizable energy requirements [taking into account requirements for both ewe maintenance and growth of the conceptus to produce a 4.5 kg lamb at term (Agricultural & Food Research Council 1993)]. The adipose tissue was rapidly dissected, weighed and placed in formalin or snap frozen in liquid nitrogen and stored at −80 °C until analysed. All animal procedures were performed in accordance with the United Kingdom Animals (Scientific Procedures) Act, 1986 with approval from the Local Ethics Committee of the University of Nottingham (Nottingham, UK).

Laboratory procedures

Histology

Adipose tissue samples were fixed in formalin and embedded in paraffin. Sections were cut at 5 μm and processed as previously described (Sharkey et al. 2009). They were initially stained using haematoxylin and eosin. Secondly, immunohistochemistry was performed using a UCP1 primary antibody raised against ovine UCP1 (Schermer et al. 1996) at a dilution of 1 : 750 (Bispham et al. 2003) and detected using the EnVision+ System (HRP-DAB-rabbit) (Dako, Ely, UK) with appropriate controls undertaken in the absence of the primary antibody. Sections were imaged (Fig. 1) using a Nikon Eclipse 90i microscope with a charge-coupled device high-speed colour camera (Micropublisher 3.3RTV; QImaging, Surrey, BC, Canada) using Velocity 5 software (Improvision, Coventry, UK) (Sharkey et al. 2009).

image

Figure 1. Summary of the changes in adipose tissue structure with development. Representative images are shown for (a, f) mid (80 days) gestation foetus; (b, g) late (140 days) gestation foetus; (c, h) newborn; (d, i) 7 days old; and (e) 30-day old sheep. Histological sections (a–e) stained with haematoxylin and eosin and (f–i) immunohistochemical detection of uncoupling protein 1. Bar represents 10 μm.

Download figure to PowerPoint

Gene expression

Gene expression analysis

Total RNA was extracted from ~150 mg of adipose tissue with an RNeasy Plus Mini extraction kit (Qiagen, West Sussex, UK) using an adapted version of the single step acidified phenol-chloroform homogenization method (Chomczynski & Sacchi 1987). The RNA integrity of RNA was confirmed by bioanalyser, and it was quantified by Nanodrop® ND-1000 spectroscopy (Nanodrop Technologies, Wilmington, DE, USA) and RNA samples were normalized by dilution to 1 ng μL−1. Samples were reverse transcribed using the High Capacity RNA-to-cDNA kit (Life Technologies, Paisley, UK)and cDNA amplified on a Touchgene Gradient thermocycler (Techne Inc, Bibby Scientific Limited, Staffordshire, UK). Q-PCR was performed using a Fast SYBR® green Taq polymerase master mix (Life Technologies) and ovine specific oligonucleotide primers against appropriate negative controls and a cDNA gene standard curve to verify the efficiency of the reaction. The mRNA abundance for each gene of interest was determined using the primers detailed in Table 1. Gene expression data were normalized using the arithmetic mean of the three most stably expressed genes identified by the Normfinder algorithm from a reference gene panel, namely IPO8, YWHAZ and RSP2 using the inline image calculation (Livak & Schmittgen 2001). All results are expressed as fold-changes compared to the expression obtained from sheep sampled on the day of birth.

Table 1. Summary of the ovine specific oligonucleotide forward and reverse primers used for real time PCR
 AbbreviationSenseAnti-sense
  1. a

    Primer sequences taken from David Garcia-Crespo et al.

  2. b

    Proprietory reference gene primers (PrimerDesign, UK).

  3. c

    Custom assay (PrimerDesign, UK).

Genes of brown adipogenesis
Peroxisome proliferator-activated receptor c coactivator 1 alphaPGC1alphacGGAACAGCAGCAGAGACAAAGGGTCAGAGGAAGAGATAAAGTT
Cell death-inducing DFFA-like effector aCIDE-AcCCTTCCGTGTCTCCAACCATCGACCACCAGTGCATCCAA
Pyruvate dehydrogenase kinase, isozyme 4PDK4GCCTCATTGGAAGCATTGATTGGTTGGCCTGGAAATTTTA
PR domain containing 16PRDM16GACGACCAGAACCTCACCATTCTTTCACATGGACCAGCAG
Bone morphogenetic protein 7BMP7GCTCCAAGACGCCCAAGAACTGCCTCTGGTCGCTGCTG
Potassium channel, subfamily K, member 3KCNK3CCTTCTACTTCGCCATCACCGTGCAGCAGGTACTTCACGA
Homeobox A1HOXA1cCCTCTTCTCCAGCACAAACCTTGACCCACGTAGCCATACTCT
Transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)TGM2TTTCATGCTGGGTCAGTTCAAACTTGGGGTTGACATCCAG
Genes for thermogenesis
Long form of prolactin receptorl-oPRLRCTCCACCCACCATGACTGATCAGCGAATCTGCACAAGGTA
Deiodinase, iodothyronine, type IIDIO2AGCCGCTCCAAGTCCACTCTTCCACTGGTGTCACCTCCT
Glucocorticoid receptor 2 (nuclear receptor subfamily 3, group C, member 1 pseudogene 1 )GCR2ACTGCCCCAAGTGAAAACAGAATGAACAGAAATGGCAGACATTTTATT
Adrenergic, beta-3-, receptorADRB3cCGCCTCCAACATGCCCTACGCGTAGACGAAGAGCATCAC
Uncoupling protein 1UCP1AGAGGTGGTCAAGGTCAGATTCTGTAAGCATTGTAAGTCC
Genes of white adipogenesis
Bone morphogenetic protein 4BMP4AGTCTGGGGAGGAGGAAGAGGGGATG CTGCTGAGGTTAAA
Genes of proliferating cells
Antigen identified by monoclonal antibody Ki-67KI-67TCAGTGAGCAGGAGGCAGTAGGAAATCCAGGTGACTTGCT
Genes of brown and white adipose
Corepressor receptor-interacting protein 140 (nuclear receptor interacting protein 1 )RIP140CGAGGACTTGAAACCAGAGCTCTTAGGGACCATGCAAAGG
Fatty acid binding protein 4, adipocyteFABP4TGAAATCACTCCAGATGACAGGTGGTGGTTGATTTTCCATCC
LeptinLeptinCCAGGATGACACCAAAACCTGGACAAACTCAGGAGAGG
AdiponectinAdiponectinATCAAACTCTGGAACCTCCTATCTACTTG CATTG CAGG CTCAAG
Adipose differentiation-related protein (perilipin 2)ADRPCAGAGAAGGGCATGAAGACCTCTTTTGCCCCAGTCATAGC
Twist homolog 1 (Drosophila)TWIST1AGCTGAGCAAGATCCAGACCCATCTTGGAGTCCAGCTCGT
Peroxisome proliferator-activated receptor alphaPPARalphaAGGATCAGATGGCTCCGTTACCGCAGATCCTACACTCGA
Peroxisome proliferator-activated receptor gammaPPARgammaGACCCGATGGTTGCAGATTATGAGGGAGTTGGAAGGCTCT
CCAAT/enhancer-binding protein betaC/EBPbetaACGACTTCCTCTCCGACCTCCCCAGACTCACGTAGCCGTA
Genes of BRITE (brown-in-white) adipose
Homeobox C9HOXC9GACCTGGACCCCAGCAACGCTCGGTGAGGTTGAGAAC
Reference genes
Importin 8IP08GCCCTTGCTCTTCAGTCATTGTGCAACAGCTCCTGCATAA
Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptideYWHAZaTGTAGGAGCCCGTAGGTCATCTTTCTCTCTGTATTCTCGAGCCATCT
Ribosomal protein S2RPS2 b b

Statistical analysis

All data are presented as means ± SEM. Significant differences (< 0.05) between values obtained at different ages were determined by one-way anova with post hoc Bonferroni test correction for parametric data with a Kruskal–Wallis test for nonparametric data followed by focused Mann–Whitney group to group comparisons where appropriate.

Results and discussion

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results and discussion
  5. Conflict of interest
  6. References

Histological changes in adipose tissue with developmental age

At each sampling age, there was a marked transition in the histological appearance of the tissue. At 80 days gestation, it was a dense cellular structure without UCP1 (Fig. 1). By 140 days gestation, as the depot increased in size, cells with the appearance of both white and brown adipocytes were clearly visible with the latter surrounding the larger, single lipid droplet filled white cells. After birth, there was a notable reduction in the number of lipid filled white adipocytes and maximal UCP1 abundance. There was a gradual disappearance of brown adipocytes throughout the postnatal period, culminating in only white cells being discernible by 30 days of age. In summary, a cellular transition was observed as UCP1 expressing brown adipocytes disappeared and were then replaced by lipid filled white cells that increased in size with age. This adaptation is paralleled by changes in UCP1 gene expression (Fig. 2a).

image

Figure 2. Changes in gene expression within the perirenal–abdominal adipose tissue between mid-gestation and 1 month of age in foetal and postnatal sheep. This includes genes that are primarily markers of brown adipose tissue (a) thermogenesis and/or (b) adipogenesis and white adipose tissue (c) adipogenesis and/or (d) brown-in-white (BRITE) tissue. For a full description of each gene see Table 1. Values are means with their standard errors and significant changes between ages; *P < 0.05, **P < 0.01 and ***P < 0.001; dg: days of gestation, d: days after birth.

Download figure to PowerPoint

Changes in gene expression and adipocyte type with age

We have established that, in the major adipose depot within the foetal and neonatal sheep, over the early phase of development, there are pronounced changes in appearance and structure that reflect substantive adaptations for its functions. These appear to be different to those seen in rodents and are likely to reflect the more profound metabolic changes which occur in large, compared to small, mammals around the time of birth (Symonds et al. 2007). Importantly, we have shown that the previously established changes in adipocyte size, lipid content and mitochondrial morphology in perirenal–abdominal adipose tissue during late gestation and early postnatal life (Smith et al. 2004) are underpinned by a clear sequence of molecular events. These reflect firstly a response to changing diet as in utero nutrients are tightly regulated and little if any lipid crosses the ovine placenta (Symonds et al. 1995). Then in postnatal life there is a much higher lipid supply through lactation (Symonds et al. 2012a). Secondly, the foetus must adapt from an environment in which it has little, if any, thermogenic demands to the substantial energetic demands experienced in postnatal life. In view of the pronounced histological changes seen within the perirenal–abdominal depot with developmental age, the concomitant adaptations in gene expression were indicative of four distinct changes in adipose tissue development from which the changes in gene expression (Fig. 2) are summarized in Figure 3. The four phases can be categorized as including an initial early proliferative period that is followed by a preparative phase pre-empting the imminent thermogenic requirement. Thirdly, there is a period of maximal UCP1 expression promoted by birth. Finally, a period in which UCP1 expression is lost and the fat depot becomes primarily white and accumulates large quantities of lipid. It is distinctly possible that this rapid transition of the depot is due to it being composed of BRITE (‘brown-in-white’)/beige cells recently identified in rodents (Petrovic et al., 2010) and humans (Wu et al. 2012). A thermogenic signalling cascade would provide the ‘browning’ stimulus, removal of which would initiate retrogression to a WAT-like appearance. These individual phases of adipose tissue development will now be considered in more detail.

image

Figure 3. Summary of the relative changes in gene expression within perirenal–abdominal adipose tissue between mid-gestation and 1 month of age in foetal and postnatal sheep: gd: gestational days, d: days after birth +++, maximal expression; −, not detectable.

Download figure to PowerPoint

Proliferative phase

The proliferative phase is coincident with the initial appearance of adipose tissue within the foetus and is characterized by rapid cellular multiplication, detectable by the high expression of KI-67 (Fig. 2a) a marker of proliferating cells. KI-67 is established to be expressed in all phases of the cell cycle, but absent from quiescent cells (Scholzen & Gerdes 2000). In mid gestation, the depot becomes established from precursor cells and replication of pre-adipocytes increases the cell pool and, therefore, depot size. The majority of other genes at 80 days of gestation were either expressed at basal levels or were below the limits of detection (Fig. 2) indicative of immature cells yet to attain specialized functionality. The exceptions were some genes characteristic of developing cells such those of the HOX and BMP families including HOXA1, HOXC9, BMP4 and 7 which further indicates a period of developmental transition (Fig. 2b). There was little change in their expression with age suggesting, as indicated from rodent studies (Zhang et al. 2010), that their role is primarily to promote adipogenesis.

Preparative phase – preparation for thermogenesis at birth

Growth of the perirenal–abdominal depot continues up to term (Clarke et al. 1997a) and is likely to be mediated, in part, by PRDM16 and C/EBPβ (Fig. 2b) which form a transcriptional complex critical for adipogenesis (Kajimura et al. 2009) although these are probably not involved in promoting the peak in UCP1 expression after birth. Nevertheless, this second phase of development is firstly characterized with significant abundance of UCP1. In sheep, it is essential that BAT is functionally mature immediately prior to birth as the onset of non-shivering thermogenesis is essential to prevent hypothermia (Clarke et al. 1997c, 1996). This process is primarily regulated by the rapid appearance of endocrine stimulatory factors, which act to maximize both the amount and thermogenic potential of UCP1 (Bird et al. 1996, Symonds et al. 1995). Notably, PRLR expression was highest at this age (Fig. 2a) in accordance with of its critical role in promoting thermogenesis demonstrated in studies in both small (Viengchareun et al. 2008) and large (Pearce et al. 2005) mammals. Mice lacking the PRLR have reduced expression of PPARγ, PGC1α and the β3AR (Viengchareun et al. 2008). Concomitant rises in each of these genes prior to birth may all be driven by the PRLR, a role that is confined to birth as the rapid loss of this gene after delivery precedes the decline of UCP1. The peak in DIO2 close to term (Fig. 2a) would have the potential to provide an endogenous source of triiodothyronine, which can activate thyroid response elements in several genes (Ribeiro et al. 2010) and, notably, is essential for UCP1 function (Hall et al. 2010). One such gene, PGC1α, has been shown to be the ‘master regulator’ of mitochondrial biogenesis across a range of species (Uldry et al. 2006, Lomax et al. 2007) and would appear to be a prerequisite for maximizing heat production by BAT following cold exposure at birth (Fernandez-Marcos & Auwerx 2011). At the same time, the peak in expression of ADRB3 will further facilitate BAT thermogenesis (Bassett & Symonds 1998) in conjunction with PPARα and PPARγ, which can act to reduce adipocyte size and promote mitochondrial biogenesis (Seale 2010). Depot size peaks at this point, prior to birth (Clarke et al. 1997a) and gene expression of KI-67 declines to basal levels indicating the replicative period has ceased, and cells are committed to terminal differentiation (Gregoire et al. 1998). Gene expression of C/EBPβ, FABP4 and adiponectin also increased at this stage (Fig. 2b,d) reflecting the greater lipid storage evident at this time point (Fig. 1).

Birth and non-shivering thermogenesis

Prior to birth, the depot contains a significant number of lipid filled cells which become rapidly depleted after birth as heat production is maximized (Clarke et al. 1997c). This process is coincident with significant falls in the expression of adiponectin, leptin and RIP140 (Fig. 2c,d). There is also a significant and marked loss of PRLR (Fig. 2a). As expected this phase is also characterized by peak abundance of the UCP1 gene. Rises in C/EBPβ and BMP4 (Fig. 2b) are also present perhaps providing an indication of the start of a change over to a WAT-like phenotype. There are no further significant changes in the mRNA abundance of any of the other genes of interest measured; however, the xenith of expression for several notable BAT genes such as CIDEA an established marker of BAT in rodents (Li 2004), together with PDK4 (Forner et al. 2009), PRDM16 and HOXA1 (Fig. 2b) coincide with that of UCP1.

Clearly, a majority of genes known to be involved in enhancing BAT function are switched on around the time of birth but, perhaps surprisingly, their rate of loss after this early period of maximal thermogenesis varies considerably indicating that the perirenal–abdominal depot does not simply convert to a WAT depot or that this conversion is complex.

The loss of UCP1 and accumulation of lipid within the perirenal–abdominal depot

The final phase from 7 to 30 days of age the expected loss of UCP1 occurred (Clarke et al. 1997b). As the depot adopted primary WAT characteristics and adipocyte size increased expression for a number of genes characteristic of mature adipocytes peaked, including adiponectin, leptin and RIP140, together with PPARγ, BMP7, GR2 and HOXC9 were all maximal (Fig. 2c,d). Loss of UCP1 was accompanied by a decline in those genes primarily associated with BAT, that is PRLR, PGC1α and DIO2 (Fig. 2a). Expression of CIDEA, PDK4 and PRDM16 also declined but not to basal amounts (Fig. 2b). The linear rise in RIP140 (Fig. 2d) is in accord with its repressor action on UCP1 and PGC1α activity (Hallberg et al. 2008). This process may be facilitated by the concomitant rise in TWIST1 as it is a transcriptional repressor that interacts directly with PGC1α to suppress both thermogenic and mitochondrial transcription factors (Pan et al. 2009). Induced expression of PPARγ in human embryonic stem cell-derived mesenchymal progenitor cells is sufficient to induce them to differentiate into white adipocytes (Ahfeldt et al. 2012) and so PPARγ may also play a role in the depot whitening.

The expression of a number of other genes also peaked at 30 days of age, following more modest changes from late gestation and/or birth (Fig. 2c,d). This may be indicative of a small change in adipocyte cell number over this period; however, the primary changes of note are an increase in cell size together with the loss of a BAT phenotype (Fig. 1). Continuing differentiation of white adipocytes is possible as indicated by the rise in gene expression of BMP4 (Fig. 2c), although BMP7 a brown differentiation marker is also evident (Schulz & Tseng 2009). Other genes which may regulate postnatal adipose tissue growth include the GR2. These can promote UCP1 action in the foetal sheep (Mostyn et al. 2003) and gene expression of the receptor is known to increase in parallel with WAT deposition through postnatal and juvenile life (Gnanalingham et al. 2005) in accord with the present study (Fig. 2d). FABP4 can function as a cytoplasmic lipid-binding protein required for binding long chain fatty acids and as such would be a marker of mature adipocytes of either colour. Its expression here is likely to indicate the maturation state of the depot (Fig. 2c). Gene expression for ADRP, a lipid droplet protein, peaked at 7 days of age. ADRP is a marker of differentiating adipocytes and is lost as lipid droplets in mature cells instead become coated with perilipin (Bickel et al. 2009).

Markers of BAT and WAT that suggest BIEGE adipocytes remain present after birth

It is becoming clear that each adipose tissue depot has a unique molecular signature (Walden et al. 2012), which may result in its potential to exhibit some brown-like characteristics (Wu et al. 2012) when appropriately stimulated. In our study, the perirenal depot demonstrates a phenotype indicative of WAT by 30 days of age as previously shown (Clarke et al. 1997b). We found detectable HOXC9 expression throughout our ontogeny and peaked at 30 days of age (Fig. 2d). HOXC9, a BRITE marker, has been shown to be more highly expressed in mouse cells treated with rosiglitazone a PPARγ agonist which causes tissue ‘browning’ (Petrovic et al. 2010, Walden et al. 2012). It is, therefore, apparent that at 30 days of age, although UCP1 was not detectable a subpopulation of latent cells could exist which have the potential to exhibit the characteristics of brown adipocytes, which could explain why the expression of CIDEA and PRDM16 are still evident at this point (Fig. 2b). Alternatively, this depot could feasibly be made up entirely of BRITE adipocytes responding to thermogenic requirements when necessary and then reverting to a WAT phenotype once such signalling recedes. Further work is now required to elucidate the exact nature of the cells present.

In conclusion, there are pronounced changes in adipose tissue appearance and composition in early life, which reflect the significant changes in its function over this period. These can now be used both to compare this process between different depots as well as to establish the primary adaptations to the nutritional environment of early life with its potential impact on later metabolic health (Symonds et al. 2012b).

Conflict of interest

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results and discussion
  5. Conflict of interest
  6. References

The authors conceptualized, designed and performed the study, collected the data, performed analysis and interpreted the data, prepared the manuscript and have no conflicts of interest to disclose.

References

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results and discussion
  5. Conflict of interest
  6. References
  • Agricultural and Food Research Council 1993. Technical Committee on Responses to Nutrients. Report No. 9.) Technical Committee on Responses to Nutrients. Report No. 9. CAB International, Wallingford.
  • Ahfeldt, T., Schinzel, R.T., Lee, Y.K., Hendrickson, D., Kaplan, A., Lum, D.H., Camahort, R., Xia, F., Shay, J., Rhee, E.P. et al. 2012. Programming human pluripotent stem cells into white and brown adipocytes. Nat Cell Biol 14, 209219.
  • Alexander, G. & Bell, A.W. 1975. Quantity and calculated oxygen consumption during summit metabolism of brown adipose tissue in newborn lambs. Biol Neonate 26, 214220.
  • Bassett, J.M. & Symonds, M.E. 1998. β2-Agonist ritodrine, unlike natural catecholamines, activates thermogenesis prematurely in utero in fetal sheep. Am J Physiol Regul Integr Comp Physiol 275, R112R119.
  • Bickel, P.E., Tansey, J.T. & Welte, M.A. 2009. PAT proteins, an ancient family of lipid droplet proteins that regulate cellular lipid stores. Biochim Biophys Acta 1791, 419440.
  • Bird, J.A., Spencer, J.A.D., Mould, T. & Symonds, M.E. 1996. Endocrine and metabolic adaptation following caesarean section or vaginal delivery. Arch Dis Child 74, F132F134.
  • Bispham, J., Gopalakrishnan, G.S., Dandrea, J., Wilson, V., Budge, H., Keisler, D.H., Broughton Pipkin, F., Stephenson, T. & Symonds, M.E. 2003. Maternal endocrine adaptation throughout pregnancy to nutritional manipulation: consequences for maternal plasma leptin and cortisol and the programming of fetal adipose tissue development. Endocrinology 144, 35753585.
  • Cannon, B. & Nedergaard, J. 2004. Brown adipose tissue: function and physiological significance. Physiol Rev 84, 277359.
  • Cannon, B., Connoley, E., Obregon, M.-J. & Nedergaard, J. 1988. Perinatal activation of brown adipose tissue. In: W.K.A.A. Jesen (ed) The Endocrine Control of the Fetus, pp. 306320. Springer Verlag, Berlin.
  • Chomczynski, P. & Sacchi, N. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162, 156159.
  • Christoffolete, M.A., Linardi, C.C., de Jesus, L., Ebina, K.N., Carvalho, S.D., Ribeiro, M.O., Rabelo, R., Curcio, C., Martins, L., Kimura, E.T. & Bianco, A.C. 2004. Mice with targeted disruption of the Dio2 gene have cold-induced overexpression of the uncoupling protein 1 gene but fail to increase brown adipose tissue lipogenesis and adaptive thermogenesis. Diabetes 53, 577584.
  • Clarke, L., Bird, J.A., Lomax, M.A. & Symonds, M.E. 1996. Effect of β3-adrenergic agonist (Zeneca D7114) on thermoregulation in near-term lambs delivered by cesarean section. Pediatr Res 40, 330336.
  • Clarke, L., Bryant, M.J., Lomax, M.A. & Symonds, M.E. 1997a. Maternal manipulation of brown adipose tissue and liver development in the ovine fetus during late gestation. Br J Nutr 77, 871883.
  • Clarke, L., Buss, D.S., Juniper, D.S., Lomax, M.A. & Symonds, M.E. 1997b. Adipose tissue development during early postnatal life in ewe-reared lambs. Exp Phys 82, 10151017.
  • Clarke, L., Heasman, L., Firth, K. & Symonds, M.E. 1997c. Influence of route of delivery and ambient temperature on thermoregulation in newborn lambs. Am J Physiol Regul Integr Comp Physiol 272, R1931R1939.
  • Garcia-Crespo, D., Juste, R.A. & Hurtado, A. 2005. Selection of ovine housekeeping genes for normalisation by real-time RT-PCR; analysis of PrP gene expression and genetic susceptibility to scrapie. BMC Vet Res 1, 3.
  • Fernandez-Marcos, P.J. & Auwerx, J. 2011. Regulation of PGC-1alpha, a nodal regulator of mitochondrial biogenesis. Am J Clin Nutr 93, 884S90.
  • Forner, F., Kumar, C., Luber, C.A., Fromme, T., Klingenspor, M. & Mann, M. 2009. Proteome differences between brown and white fat mitochondria reveal specialized metabolic functions. Cell Metab 10, 324335.
  • Forrest, R.H., Hickford, J.G. & Frampton, C.M. 2007. Polymorphism at the ovine beta3-adrenergic receptor locus (ADRB3) and its association with lamb mortality. J Anim Sci 85, 28012806.
  • Fruhbeck, G., Sesma, P. & Burrell, M.A. 2009. PRDM16: the interconvertible adipo-myocyte switch. Trends Cell Biol 19, 141146.
  • Gnanalingham, M.G., Mostyn, A., Symonds, M.E. & Stephenson, T. 2005. Ontogeny and nutritional programming of adiposity in sheep: potential role of glucocorticoid action and uncoupling protein-2. Am J Physiol Regul Integr Comp Physiol 289, R1407R1415.
  • Granneman, J.G., Li, P., Zhu, Z. & Lu, Y. 2005. Metabolic and cellular plasticity in white adipose tissue I: effects of beta3-adrenergic receptor activation. Am J Physiol Endocrinol Metab 289, E608E616.
  • Gregoire, F.M., Smas, C.M. & Sul, H.S. 1998. Understanding adipocyte differentiation. Physiol Rev 78, 783809.
  • Hall, J.A., Ribich, S., Christoffolete, M.A., Simovic, G., Correa-Medina, M., Patti, M.E. & Bianco, A.C. 2010. Absence of thyroid hormone activation during development underlies a permanent defect in adaptive thermogenesis. Endocrinology 151, 45734582.
  • Hallberg, M., Morganstein, D.L., Kiskinis, E., Shah, K., Kralli, A., Dilworth, S.M., White, R., Parker, M.G. & Christian, M. 2008. A functional interaction between RIP140 and PGC-1alpha regulates the expression of the lipid droplet protein CIDEA. Mol Cell Biol 28, 67856795.
  • Hyatt, M.A., Budge, H., Walker, D., Stephenson, T. & Symonds, M.E. 2007. Ontogeny and nutritional programming of the hepatic growth hormone-insulin-like growth factor-prolactin axis in the sheep. Endocrinology 148, 47544760.
  • Kajimura, S., Seale, P., Kubota, K., Lunsford, E., Frangioni, J.V., Gygi, S.P. & Spiegelman, B.M. 2009. Initiation of myoblast to brown fat switch by a PRDM16-C/EBP-beta transcriptional complex. Nature 460, 11541158.
  • Li, P. 2004. Cidea, brown fat and obesity. Mech Ageing Dev 125, 337338.
  • Livak, K.J. & Schmittgen, T.D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402408.
  • Lomax, M.A., Sadiq, F., Karamanlidis, G., Karamitri, A., Trayhurn, P. & Hazlerigg, D.G. 2007. Ontogenic loss of brown adipose tissue sensitivity to beta-adrenergic stimulation in the ovine. Endocrinology 148, 461468.
  • Mostyn, A., Pearce, S., Budge, H., Elmes, M., Forhead, A.J., Fowden, A.L., Stephenson, T. & Symonds, M.E. 2003. Influence of cortisol on adipose tissue development in the fetal sheep during late gestation. J Endocrinol 176, 2330.
  • Nichol, D., Christian, M., Steel, J.H., White, R. & Parker, M.G. 2006. RIP140 expression is stimulated by estrogen-related receptor alpha during adipogenesis. J Biol Chem 281, 3214032147.
  • Pan, D., Fujimoto, M., Lopes, A. & Wang, Y.X. 2009. Twist-1 is a PPARdelta-inducible, negative-feedback regulator of PGC-1alpha in brown fat metabolism. Cell 137, 7386.
  • Pearce, S., Budge, H., Mostyn, A., Genever, E., Webb, R., Ingleton, P., Walker, A.M., Symonds, M.E. & Stephenson, T. 2005. Prolactin, the prolactin receptor and uncoupling protein abundance and function in adipose tissue during development in young sheep. J Endocrinol 184, 351359.
  • Petrovic, N., Walden, T.B., Shabalina, I.G., Timmons, J.A., Cannon, B. & Nedergaard, J. 2010. Chronic peroxisome proliferator-activated receptor gamma (PPARgamma) activation of epididymally derived white adipocyte cultures reveals a population of thermogenically competent, UCP1-containing adipocytes molecularly distinct from classic brown adipocytes. J Biol Chem 285, 71537164.
  • Ribeiro, M.O., Bianco, S.D., Kaneshige, M., Schultz, J.J., Cheng, S.Y., Bianco, A.C. & Brent, G.A. 2010. Expression of uncoupling protein 1 in mouse brown adipose tissue is thyroid hormone receptor-beta isoform specific and required for adaptive thermogenesis. Endocrinology 151, 432440.
  • Schermer, S.J., Bird, J.A., Lomax, M.A., Shepherd, D.A. & Symonds, M.E. 1996. Effect of fetal thyroidectomy on brown adipose tissue and thermoregulation in newborn lambs. Reprod Fertil Dev 8, 9951002.
  • Scholzen, T. & Gerdes, J. 2000. The Ki-67 protein: from the known and the unknown. J Cell Physiol 182, 311322.
  • Schulz, T.J. & Tseng, Y.H. 2009. Emerging role of bone morphogenetic proteins in adipogenesis and energy metabolism. Cytokine Growth Factor Rev 20, 523531.
  • Seale, P. 2010. Transcriptional control of brown adipocyte development and thermogenesis. Int J Obes (Lond) 34(Suppl 1), S17S22.
  • Seale, P., Bjork, B., Yang, W., Kajimura, S., Chin, S., Kuang, S., Scime, A., Devarakonda, S., Conroe, H.M., Erdjument-Bromage, H., Tempst, P., Rudnicki, M.A., Beier, D.R. & Spiegelman, B.M. 2008. PRDM16 controls a brown fat/skeletal muscle switch. Nature 454, 961967.
  • Sharkey, D., Gardner, D.S., Fainberg, H.P., Sebert, S., Bos, P., Wilson, V., Bell, R., Symonds, M.E. & Budge, H. 2009. Maternal nutrient restriction during pregnancy differentially alters the unfolded protein response in adipose and renal tissue of obese juvenile offspring. FASEB J 23, 13141324.
  • Smith, S.B., Carstens, G.E., Randel, R.D., Mersmann, H.J. & Lunt, D.K. 2004. Brown adipose tissue development and metabolism in ruminants. J Anim Sci 82, 942954.
  • Symonds, M.E., Bird, J.A., Clarke, L., Gate, J.J. & Lomax, M.A. 1995. Nutrition, temperature and homeostasis during perinatal development. Exp Phys 80, 907940.
  • Symonds, M.E., Stephenson, T., Gardner, D.S. & Budge, H. 2007. Long-term effects of nutritional programming of the embryo and fetus: mechanisms and critical windows. Reprod Fertil Dev 19, 5363.
  • Symonds, M.E., Pope, M. & Budge, H. 2012a. Adipose tissue development during early life: novel insights into energy balance from small and large mammals. Proc Nutr Soc 71, 363370.
  • Symonds, M.E., Pope, M., Sharkey, D. & Budge, H. 2012b. Adipose tissue and fetal programming. Diabetologia 55, 15971606.
  • Tseng, Y.H., Kokkotou, E., Schulz, T.J., Huang, T.L., Winnay, J.N., Taniguchi, C.M., Tran, T.T., Suzuki, R., Espinoza, D.O., Yamamoto, Y., Ahrens, M.J., Dudley, A.T., Norris, A.W., Kulkarni, R.N. & Kahn, C.R. 2008. New role of bone morphogenetic protein 7 in brown adipogenesis and energy expenditure. Nature 454, 10001004.
  • Uldry, M., Yang, W., St-Pierre, J., Lin, J., Seale, P. & Spiegelman, B.M. 2006. Complementary action of the PGC-1 coactivators in mitochondrial biogenesis and brown fat differentiation. Cell Metab 3, 333341.
  • Viengchareun, S., Servel, N., Feve, B., Freemark, M., Lombes, M. & Binart, N. 2008. Prolactin receptor signaling is essential for perinatal brown adipocyte function: a role for insulin-like growth factor-2. PLoS ONE 3, e1535.
  • Walden, T.B., Hansen, I.R., Timmons, J.A., Cannon, B. & Nedergaard, J. 2012. Recruited vs. nonrecruited molecular signatures of brown, “brite”, and white adipose tissues. Am J Physiol Endocrinol Metab 302, E19E31.
  • Wu, J., Bostrom, P., Sparks, L.M., Ye, L., Choi, J.H., Giang, A.H., Khandekar, M., Virtanen, K.A., Nuutila, P., Schaart, G. et al., 2012. Beige adipocytes are a distinct type of thermogenic fat cell in mouse and human. Cell 150, 366376.
  • Zhang, H., Schulz, T.J., Espinoza, D.O., Huang, T.L., Emanuelli, B., Kristiansen, K. & Tseng, Y.H. 2010. Cross talk between insulin and bone morphogenetic protein signaling systems in brown adipogenesis. Mol Cell Biol 30, 42244233.