SEARCH

SEARCH BY CITATION

Keywords:

  • biofloc;
  • Litopenaeus vannamei ;
  • immune genes;
  • qRT-PCR

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgements
  9. References

The bioflocs technology (BFT) for shrimp production has been proposed as a sustainable practice capable of reducing environmental impacts and preventing pathogen introduction. The microbial community associated with BFT not only detoxifies nutrients, but also can improve feed utilization and animal growth. Biofloc system contains abundant number of bacteria of which cell wall consists of various components such as bacterial lipopolysaccharide, peptidoglycan and β-1, 3-glucans, and is known as stimulating nonspecific immune activity of shrimp. Bioflocs, therefore, are assumed to enhance shrimp immunity because they consume the bioflocs as additional food source. Although there are benefits for having an in situ microbial community in BFT systems, better understanding on these microorganisms, in particular molecular level, is needed. A fourteen-day culture trial was conducted with postlarvae of Litopenaeus vannamei in the presence and absence of bioflocs. To determine mRNA expression levels of shrimp, we selected six genes (prophenoloxidase1, prophenoloxidase2, prophenoloxidase activation enzyme, serine proteinase1, masquerade-like proteinase, and ras-related nuclear protein) which are involved in a series of responses known as the prophenoloxidase (proPO) cascade, one of the major innate immune responses in crustaceans. Significant differences in shrimp survival and final body weights were found between the clear water and in the biofloc treatments. mRNA expression levels were significantly higher in the biofloc treatment than the clear water control. These results suggest that the presence of bioflocs in the culture medium gives positive effect on growth and immune-related genes expression in L.vannamei postlarvae.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgements
  9. References

Pacific white shrimp, Litopenaeus vannamei, is one of the most important farmed species in the world. However, farming activities of this species have been largely affected by diseases, mostly viral diseases such as the white spot syndrome virus (WSSV). Producers and researchers are constantly looking for methods to reduce massive shrimp losses due to disease outbreaks. Growing shrimp using biofloc technology (BFT) was proposed as a tool to reduce water exchange and minimize the introduction of viral pathogen thorough incoming water. In addition, observations on the effects of BFT on reducing viral disease outbreaks were reported (Avnimelech 2012).

Biofloc technology is based upon the production of shrimp with zero or minimal water exchange, resulting in the accumulation of organic substrates and subsequent development of dense microbial population, mostly aggregated in bioflocs (Avnimelech 2012). Bioflocs consist of a variety of bacteria, fungi, microalgae, detritus and other suspended organisms (Hargreaves 2006). These microorganisms not only remove excess nutrients, but also have been implicated in nutritional provision for the cultured species, including shrimp and tilapia (Burford, Thompson, McIntosh, Bauman & Person 2003; Hari, Kurup, Varghese, Schrama & Verdegem 2004; Azim & Little 2008). Several researchers suggested that the bioflocs provide sources of lipids, minerals and vitamins to cultured animal (Moss, Divakaran & Kim 2001; Thompson, Abreu & Wasielesky 2002; Moss, Forster & Tacon 2006; Arnold, Coman, Jackson & Groves 2009). Using the 15N isotope tagging method, Avnimelech and Kochba (2009) showed that bacterial protein in bioflocs is taken by the cultured animals. All of these results suggest that animals cultured in BFT can consume microorganisms and other components of bioflocs and use it for their nutrition or other purposes. It is well reported that the cell wall of the microorganisms such as bacteria and fungi consists of lipopolysaccharides (LPS), peptidoglycans (PG) and β -1, 3-glucans (BG), activating the nonspecific immune system in fish and crustaceans (Johansson & Söderhäll 1985, 1989; Söderhäll & Cerenius 1998) and enhancing the resistance against bacterial and viral infections in penaeid shrimp (Itami, Tsuchihira, Igusa & Kondo 1994; Song, Liu, Chan & Sung 1997; Chang, Su, Chen, Lo, Kou & Liao 1999). Therefore, it is assumed that the microorganisms abundantly present in biofloc systems may contribute to enhance the immune activity of the shrimp growing in the system.

In this study we selected six genes including prophenoloxidase1 (proPO1), prophenoloxidase 2 (proPO2), prophenoloxidase activating enzyme 1 (PPAE1), serine proteinase1 (SP1), masquerade-like serine proteinase (mas), and ras-related nuclear protein (Ran) to evaluate effects of bioflocs on shrimp immune response. These genes are known to be directly or indirectly related to nonspecific immune response in shrimp (Francisco & Gloria 2000; Lee, Zhang, Kim, Park, Park & Kawabata 2002; Han & Zhang 2007; Wu 2011). Like other crustaceans, a critical step in shrimp immune response is the recognition of invading organisms. This is mediated by a group of proteins, called pattern recognition proteins (PRPs), which recognize and bind to the molecules present on the surface of microorganisms (Janeway 1989). Binding of PRPs to microbial cell wall components such as LPS, PG and β-1, 3-glucans triggers a series of responses which lead to the activation of the host defense system (Lee & Söderhäll 2002). This series of responses is known as the prophenoloxidase (proPO) activating system, one of the major innate immune responses in invertebrates (Cerenius & Söderhäll 2004). In case of injury or infection, nonself molecules, such as LPS, PG and β-1, 3-gulcan, recognized by PRPs, leads to the activation of the proPO cascade (Söderhäll & Cerenius 1998). The proPO cascade involves several proteolytic steps which are catalysed by multiple clip-SPs. A serine proteinase (SP) that converts the inactive proPO into its active form is called a prophenoloxidase activating enzyme (PPAE). This process has been characterized in several insects and crustacean (Satoh, Horii, Ochiai & Ashida 1999; Kwon, Kim, Choi, Joo, Cho & Lee 2000; Wang, Lee, Cerenius & Söderhäll 2001; Lee et al. 2002). Shrimp β-glucan binding protein (BGBP) appears to be a constitutive plasma protein that after binding to β-glucan reacts with hemocyte surface and stimulates the release of hemocytic granules. The contents of the granules become activated in presence of plasma Ca2+, leading to the activation of the proPO1 and proPO2 (Francisco & Gloria 2000; Amparyup & Charoensapsri 2009). The PPAE which is the direct activator of proPO is also a key member of the proPO activating system (Cerenius & Söderhäll 2004). The mas gene is reported to be also related to various biological functions including bacterial binding, bacterial clearance, antimicrobial activity and hemocyte adhesion (Jitvaropas 2009). Wu (2011) suggested that mas and serine proteinase homologues (SPHs) are involved in the activation of the proPO cascade in invertebrates. On the other hand, the Ran gene was known to be involved in the antiviral immunity of Marsupenaeus japonicus (Han & Zhang 2007). Previously, He, Liu and Xu (2004) and Pan, He, Yang, Liu and Xu (2005) found a cDNA fragment which is highly homologous with the Ran proteins from WSSV resistant shrimp.

To date, only limited information is available concerning the effect of bioflocs on shrimp immune response. The present study was designed to evaluate the effect of bioflocs on growth, survival and mRNA expression of selected immune-related genes in L.vannamei postlarvae.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgements
  9. References

Experimental design

The experiment was carried out at the Crustacean Research Center, National Fisheries Research and Development Institute (NFRDI), Taean, South Korea. The postlarvae used in this study were produced from specific pathogen free (SPF) L. vannamei broodstock imported from Hawaii, USA in February 2010. Twenty-day-old postlarvae were stocked into 30 L circular polyethylene bins (34 cm diameter × 34 cm depth) filled with 20 L of culture media at a culture room. Each bin contained 400 animals (mean body weight 14.12 mg). Prior to stocking, 90 individuals of postlarvae were separately measured for body weight. Two experimental groups were prepared in triplicate. The photoperiod of the culture room was maintained with a regime of 14 h light and 10 h darkness, and the room temperature was maintained at 26–29°C with an air-conditioning system. The postlarvae were cultured for 2 weeks. Based on the culture medium, the experimental groups consisted of biofloc and clear seawater ones as a control. The culture medium in control group was daily exchanged at a rate of 50% with seawater that was ozone-sterilized after filtering with 5 μm. In order to maintain fully developed biofloc or microbial community conditions, the culture medium in the biofloc group was daily renewed with biofloc seawater at a rate of 50%. The biofloc water source renewed for biofloc group was daily provided from a greenhouse enclosed intensive shrimp production raceway tank (14 m width × 22 m length × 1.2 m depth) with zero exchange at the experimental station. During the present study, L. vannamei of approximately 10 g was growing with a stocking density of 400 shrimp per m2 in the raceway tank. The biofloc water of the greenhouse raceway was removed from reservoir tanks (200 L in volume) using a water pump, filtered with a 100 μm mesh and provided with a strong aeration to keep particulates suspended until provided to culturing bins. Top of culturing bins was covered with plastic cap to prevent escape of the animals. Each bin was provided with an air stone at the centre of bottom to maintain particles gently suspended and dissolved oxygen above 4 mg L−1. The shrimp were provided with larval diet (45% in crude protein, CJ feed company, Korea) at three equal daily portions (09:00, 17:00 and 22:00 hours). Uneaten feeds on under bottom were daily removed when culture medium is exchanged using a newly designed net (100 μm in mesh size) to prevent escape of the postlarvae.

Water temperature, salinity, pH and dissolved oxygen (DO) were measured daily in all culturing bins using an YSI85 meter (YSI Inc., Yellow Springs, OH, USA). For measurement of total ammonia-nitrogen (TA-N), nitrite-nitrogen (NO2-N), nitrate-nitrogen (NO3-N), chlorophyll-a (Chl-a), total suspended solids (TSS) and volatile suspended solids (VSS), 1 liter of water sample was taken from all culturing bins at every 3 days. For measurement of nitrogen compounds, 200 mL subsamples filtered through a 1.2 μm GF/C glass microfiber filter (Whatman, Piscataway, NJ, USA) were kept at a refrigerator and analysed within 24 h. Separate 50 mL subsamples were filtered onto pre-combusted GF/C filters for analysis of TSS and VSS concentrations. Another 50 mL subsample for Chl-a measurement was filtered through GF/C fibre filter and stored at a refrigerator for 24 h until used for analysis. All analysis of water quality was followed by the procedures of the APHA (1998).

Total bacterial counts

To determine the total bacterial counts, water samples were taken from all culturing bins at every 3 days. Direct quantification of total bacteria was carried out by epifluorescent direct count method (Hobbie, Daley & Jasper 1977) using 4′, 6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich, USA) staining. One mL samples were fixed with 25 μL formaldehyde solution (2% v/v). The samples were stained with 75 μL DAPI (100 μg mL−1 final concentration) and incubated for 10 min at room temperature. After staining, the samples were vacuum-filtered onto 25-mm-diameter black polycarbonate membrane filters with a 0.2-μm-pore-size (ADVANTEC, Tokyo, Japan). These filters were mounted on slide glasses with immersion oil and fluorescing cells were counted using an ocular graticule. Ten random fields per slide were counted at 1000× magnification (Z1 fluorescence microscope; Carl Zeiss, Oberkochen, Baden-Württemberg, Germany). Bacterial numbers were calculated as described by Kirchman, Sigda, Kapuscinski and Mitchell (1982).

Growth performance and survival rate

At the end of the study, wet weights of total 90 individuals of shrimp from each treatment group were measured and survival rates were calculated.

Immune-related genes expression by qRT-PCR

A Taqman probe-based quantitative reverse transcription PCR (qRT-PCR) technique was taken to determine expression of the six selected genes at transcript level. Pairs of gene-specific primers and Taqman probes of six genes were designed using Primer Express(r) Software v3.0 (Applied Biosystems, Scoresby, Vic., Australia) (Table 1).

Table 1. Primers and probes of six selected immune related genes for Taqman qRT-PCR
NamePrimers and probes (5′[RIGHTWARDS ARROW] 3′)GenBank accession No. & remarks
proPO1-RT- FCCTCACAGGCTGGAACACAA EF115296.1
proPO1-RT- RGGCGAAGAATCACGGGTCTA EF115296.1
proPO1-RT- PAGCCAGCCGCGGCATCGA EF115296.1
proPO2-RT- FGTTGGAGGCCGACTCGAAT EF565469.1
proPO2-RT- RAATGAGGACGTGACCCATGTT EF565469.1
proPO2-RT- PCAGCGTGAACTCGCCTTACTACGGTGAC EF565469.1
PPAE1-RT- FAGTTCCTACGACACGACCACCTAJang et al. 2011;
PPAE1-RT- RTCGACGTTGAAGTTGGTGCTTJang et al. 2011;
PPAE1-RT- PAACGACATCGCCATCATCAAGCTGCJang et al. 2011
SP1- RT- FTCAGGTGGCCCCTTGGTJX644456, present study
SP1-RT- RCAGGACCGTAGGAGACAATGCJX644456, present study
SP1-RT- PCTTGCCGGCACTTTTGGTCCTCCJX644456, present study
mas-RT- FCGGCTGCGCTCAAAGGJX644451, present study
mas-RT- RTCGGATGAAGTTGGCATACGJX644451, present study
mas-RT- PTCCAGGTGTCTACGTCAACGTGGCCJX644451, present study
Ran-RT- FCCAGAGCAAGCGAGGTATCCJX644455, present study
Ran-RT- RTTGTAGAAGGTATGATGCCAGATCTTJX644455, present study
Ran-RT- PATGGTTACTACATCCAGGCCCACTGTGCJX644455, present study
β-actin-RT- FCGAGGTATCCTCACCCTGAAATJang et al. 2011;
β-actin-RT- RGTGATGCCAGATCTTCTCCATGTJang et al. 2011;
β-actin-RT- PCGAGCACGGCATCGTCACCAAJang et al. 2011

At the end of the experiment, three animals from each treatment were removed to liquid nitrogen and stored at −80°C until used for RNA extraction. Total RNA was extracted with the RNeasy Mini Kit and further purified with DNase I (Qiagen, Valencia, CA, USA). One-step real time RT-PCR was accomplished using the One Step Prime Script™ RT-PCR perfect real time Kit (Takara Bio, Otsu, Japan). The reaction mixture consisted of 10 μL 2X One-Step RT-PCR Buffer III, 2 units of Takara Ex Hot Start Taq enzyme, 0.4 μL reverse transcript enzyme Mix II and 0.4 μM each of forward primer, reverse primer, and Taqman probe in a final reaction volume of 20 μL. All PCR conditions were as follows: 42°C for 5 min and 95°C for 10 s, followed by 40 cycles of 95°C for 5 s and 60°C for 30 s. Fluorescent signal detection began at the first cycle of the annealing stage. All samples were analysed in triplicate, and relative expression was determined by the comparative threshold cycle method (2−ΔΔCT method Livak & Schmittgen 2001) using β-actin as a reference.

Data analysis

The results were expressed as the mean ± standard deviation (SD). Each significant difference between different groups was determined by independent samples T-tests with 95% confidence level in SPSS13.0 software.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgements
  9. References

Water quality

Water quality parameters in tanks are presented in Table 2. Water temperature was maintained at 27.5–27.8°C, and salinity between 32.3 and 33.3 psu with no significant differences between treatments. DO and pH were significantly different between control and biofloc, both lower in the biofloc treatment. Mean dissolved oxygen concentrations were 5.8 and 4.9 and pH 8.6 and 7.7 in the control and biofloc groups respectively. Inorganic nitrogen (TA-N, NO2-N and NO3-N) and chlorophyll-a concentrations were higher in the biofloc group as compared with the control. TSS and VSS were significantly different between treatments, much higher in the biofloc group (678 vs. 13 mg L−1), in biofloc and control treatments respectively. Chl-a concentration in control was 1 μg L−1 significantly lower than in biofloc (25 μg L−1). During the present study, the water quality in the indoor super-intensive shrimp production raceway tank in which we provided daily the water to the reservoir tank for the biofloc group was as follows: TAN 0.5 mg L−1, NO2-N 7.4 mg L−1, NO3-N 96.1 mg L−1, TSS 402.1 mg L−1 and VSS 168.9 mg L−1 in mean concentrations.

Table 2. Mean values of water quality parameters in control and biofloc groups (mean ± SD and range). Significant differences between control and biofloc groups are marked with a different superscript letter
ParametersControlBiofloc P
  1. NS, not significant.

  2. *P < 0.05; **P < 0.01.

WT (°C)27.8 ± 0.6 (27.8–29.9)27.5 ± 0.6 (27.5–29.2)NS
Salinity (psu)32.3 ± 0.7 (31.0–33.5)33.3 ± 0.5 (32.2–33.8)NS
pH8.6 ± 0.1a (8.4–8.7)7.7 ± 0.2b (7.3–8.2) **
DO (mg L−1)5.8 ± 0.5 (5.1–6.6)4.9 ± 0.3 (4.5–5.3)NS
Chl-a (μg L−1)1.0 ± 0.00a (0.0–2.19)25.0 ± 0.01b (9.01–37.35) *
TA-N (mg L−1)0.0 ± 0.0a (0.0–0.01)0.8 ± 0.3b (0.32–1.23) **
NO2-N (mg L−1)0.0 ± 0.0a (0.0–0.01)1.1 ± 0.9b (0.40–2.62) *
NO3-N (mg L−1)0.3 ± 0.1a (0.21–0.39)214.4 ± 38.0b (174.8–271.4) **
TSS (mg L−1)13.0 ± 3.0a (10.6–18.1)673.5 ± 65.1b (612.7–761.6) **
VSS (mg L−1)10.5 ± 1.1a (9.6–12.3)408.1 ± 57.5b (364.0–504.0) **

Total bacterial counts

The density of bacteria in the biofloc group was significantly higher than that in control (Table 3). The number of total bacteria in control group ranged from 2.59 × 105 to 7.98 × 105 cells mL−1 (mean 4.86 × 105 cells mL−1) and that in biofloc group was 2.10 × 106 to 1.00 × 107 cells mL−1 (mean 5.43 × 106 cells mL−1). Total bacterial number in biofloc group was approximately 10 times higher than in control.

Table 3. Total bacterial count (mean and range, P < 0.05). Significant differences between control and biofloc groups are marked with asterisk
 ControlBiofloc
Total bacterial count (cells/mL)4.86 × 1055.43 × 106*
2.59 ~7.98 × 1052.10 × 106~1.00 × 107

Growth performance and survival rate

Table 4 summarizes the mean body weight and survival rate of the shrimp on the day of the study termination. Shrimp final mean body weights were 77 ± 6.7 mg and 132 ± 9.8 mg for the control and biofloc group, and the survival rate was on the average 82.5 and 91.5% for the control and biofloc treatments respectively. Both differences between treatments were statistically significant.

Table 4. Shrimp final body weight and survival rate (Mean ± SD, n = 90, < 0.05). Significant differences between control and biofloc groups are marked with a different superscript letter
 ControlBiofloc
Final body weight (mg)76.97 ± 6.66a132.07 ± 9.76b
Survival rate (%)82.5a91.5b

mRNA expressions of six selected genes

Results of relative mRNA expression in six genes are summarized in Fig. 1. All immune related genes mRNA expression levels in shrimp of biofloc group were significantly higher than that in control.

image

Figure 1. Comparative mRNA exp-ression levels of proPO1, proPO2, PPAE1, SP1, mas and Ran genes of L. vannamei postlarvae between control and biofloc groups. The transcription level was detected by Taqman qRT-PCR. Gene expression level was normalized to β-actin. Nine samples were taken as replicates. Significant differences bet-ween control and biofloc groups are marked with asterisk (P < 0.01).

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgements
  9. References

Several statistically significant differences were found in water quality parameters between treatments in the present study (Table 2). However, it needs to be emphasized that the water characteristics in the biofloc group largely depend on water source from an indoor intensive shrimp production system in operation during this study (see 'Materials and methods'). The pH in the biofloc group was lower than that of the control, probably due to the respiration of heterotrophic organisms, which increased the carbon dioxide concentration in the water of the biofloc treatment and due to the extensive nitrification (Tacon, Cody, Conquest, Divakaran, Forster & Decamp 2002; Wasielesky, Stokes & Browdy 2006), as demonstrated by the very high level of nitrates in the biofloc pond. As expected, DO levels were lower in the biofloc treatments than the control because of the greater demand by the bacteria and other microorganisms. Chl-a reading was higher in biofloc treatment than the control. Despite differences in water quality parameters among treatments, all water quality parameters were within acceptable ranges reported by other researchers for optimal survival and growth of L. vannamei (Wickins 1976; Van Wyk & Scarpa 1999; Cohen, Samocha, Fox & Lawrence 2005; Mishra, Samocha, Patnaik, Speed, Gandy & Ali 2008). Statistically significant differences were also found between the biofloc treatment and the control in TSS and VSS. TSS and VSS concentrations were 673 and 13 mg L−1 in TSS, and 408 and 11 mg L−1 in VSS for the biofloc and the control respectively. Ray, Lewis, Browdy and Leffler (2010) proposed that a TSS concentration of approximately 460 mg/L should be the goal to produce results similar to those of this study. Samocha, Patnaik, Speed, Ali, Burger, Almeida, Ayub, Harisanto, Horowitz and Brock (2007), cultured L. vannamei postlarvae in indoor limited discharge nursery system, reported that TSS concentration ranged from 275 to 800 mg L−1 (mean 379 mg L−1) with 85.8% in survival rate. These authors noted that short-term exposures of the shrimp in these systems to TSS concentrations above 500 mg L−1 could be tolerated by the shrimp with no obvious negative impact. We also did not observe any apparent negative effect on the postlarvae growth and survival with TSS ranging from 613 to 762 mg L−1 (mean 673 mg L−1) in biofloc group during this study.

Although the number of total bacteria in biofloc group was significant higher than that of control in present study (Table 3), this number of mean 5.43 × 106 cells mL−1 is pretty lower than the previously reported numbers in similar biofloc-rich environments. The common range of bacteria in zero exchange intensive ponds is from 107 to 108 cells mL−1 (Avnimelech 2012). Otoshi, Holl, Moss, Arce and Moss (2006) observed 3.9 × 108 cells mL−1 in mean total bacterial count from the raceway-based intensive RAS shrimp tank. Burford, Thompson, Bauman and Pearson (2003), in the intensive shrimp ponds of Belize, observed from 3.35 to 5.42 × 107 cells mL−1 in the total bacterial number. They also found that more than 50% of the bacteria were free living and the reminder was associated with detritus in the form of flocculated matter. Considering the presumptively large quantity of bacteria associated with flocs as suggested by Burford, Thompson, Bauman et al. (2003), the total bacterial number in the biofloc group probably is much higher than the given number of the present result.

The survival and growth rates of shrimp in biofloc group were significantly higher than those in control group in this study (Table 4). Many of previous studies have shown that growing L. vannamei in biofloc systems can improve shrimp survival and growth performance, compared to clear water (Moss & Pruder 1995; Cohen et al. 2005; Azim & Little 2008; Mishra et al. 2008). One reason for the improved performance is probably related to harvesting and consuming bioflocs by the shrimp. For example, Burford, Thompson, McIntosh, Bauman and Pearson (2004) reported that up to 29% of daily feed intake of this species can come from flocculated particles in heterotrophic culture system. However, very limited information is available for harvesting or collecting mechanisms of bioflocs by shrimp. Most bacteria are free-living and very small, having a typical diameter of about 1 μm, but in dense microbial biomass, and they tend to congregate and create flocs, conglomerates of microbes having a diameter in the range of 0.1 to several mm (Avnimelech 2012). Recently, Kent, Browdy and Leffler (2011), based on the examination of the setae on the third maxilliped using a scanning electron microscope photography, speculated that juveniles (2 g in body weight) of L. vannamei were able to potentially select and consume suspended food particles of approximately 10 μm in diameter using their net-like setae arrangement. This speculation may explain the enhanced growth performance of shrimp growing in biofloc systems.

The microbial cell wall largely consists of peptidoglycans (PG), lipopolysaccharides (LPS) and β-1, 3-glucans, which trigger a prophenoloxidase (proPO) activating system, one of the major non-specific immune system in crustaceans including shrimp (Johansson & Söderhäll 1985; Kanost & Gorman 2008; Labbe & Little 2009; Rao, Ling & Yu 2010). Therefore, it is assumed that the presumptively large quantity of bacteria associated with bioflocs may contribute to enhance the immunity as well as growth performance of shrimp when the bioflocs are consumed by shrimp. The selected six genes including proPO1, proPO2, PPAE1, SP1, mas and Ran in the present study are known to be related with the nonspecific immune response in shrimp (Francisco & Gloria 2000; Lee et al. 2002; Han & Zhang 2007). In this study the mRNA expression levels of the six genes of the postlarvae in the biofloc group were significantly higher than the control (Fig. 1). This result suggests that the bioflocs may contribute to enhance the immunity of L. vannamei postlarvae. Cerenius and Söderhäll (2004) reported that inactive proPO zymogen is converted to active phenoloxidase (PO) by a clip domain serine proteinase (clip-SP), referred to a PPAE. This process was well documented in insects and crustaceans (Kwon et al. 2000; Sritunyalucksana & Söderhäll 2000; Wang et al. 2001). In Penaeus monodon, PPAE (pmPPAE) is known as an essential molecule in proPO system with pmproPO1 and pmproPO2 playing an important role in the shrimp defence mechanism against bacterial infection (Amparyup & Charoensapsri 2009; Charoensapsri & Amparyup 2009). Jang, Pang, Yu, Kim, Seo and Cho (2011) identified a PPAE in L. vannamei (referred to lvPPAE1), which showed 94% similarity to PPAE1 of P. monodon. They found that lvPPAE1 expression significantly increased in gill, acting as the primary bacterial clearance site, after V. harveyi challenge. Its expression was also enhanced when shrimps were exposed to biofloc-rich environment. In vivo gene silencing of the lvPPAE1 by RNAi significantly reduced the PO activity and increased the susceptibility of shrimp to V. harveyi. This finding strongly suggests that PO activity of L. vannamei is positively controlled by lvPPAE1. The present results also showed significantly enhanced mRNA expression of these genes including proPO1, proPO2 and PPAE1 when L. vannamei were cultured in biofloc-rich water. Pang, Kim and Jang (2011) cloned a novel serine protease in L. vannamei (referred to lvSP1), showing 85% similarity to PPAE2 of P. monodon, and reported this gene acts as an upstream regulator in the proPO cascade. Amparyup, Jitvaropas, Pulsook and Tassanakajon (2007) found that the transcript expression of masquerade-like serine proteinase (mas) homologues in P. monodon (pmmas SPH) was up-regulated when was challenged with V. harveyi. The antibacterial activity of this gene was also reported by Jitvaropas (2009). The mas gene expression in this study is consistent with these findings. Ran (ras-related nuclear protein) is also of interest as it is part of the mitogen-activated-protein-kinase pathway: a large signal transduction network that can feed into other signalling networks, such as the immune-related Janus-Kinase-Signal transducer and activator of transcription (JAKSTAT) pathway, and cellular immune responses (Lemaitre & Hoffmann 2007). It was reported that Ran gene is up-regulated in WSSV infected M. japonicus, suggesting Ran protein is involved in the antiviral immunity of shrimp (He et al. 2004; Pan et al. 2005; Han & Zhang 2007). Like proPO1, proPO2 and PPAE1, the enhanced expression of the other three genes including SP1, mas and Ran was also observed in L. vannamei postlarvae cultured in biofloc-rich environment in this study. The present results suggest that bioflocs or microbes associated with bioflocs may enhance expression of some selected immune-related genes and therefore be involved in immune activity of L. vannamei.

Conclusions

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgements
  9. References

The present work follows a series of observations indication that biofloc systems provide some protection against diseases of cultured shrimp. As for now, these observations lack scientific evaluations, mechanistic cause and effect reasoning. The present work provides some replicated and statistically significant evidence of a sequence of processes leading to increased shrimp immunity when grown in biofloc systems. As discussed in the introduction, immune mechanism of shrimp is labile (no long lasting memory). Thus, when pathogens get into the shrimp production systems, the shrimp population is not equipped with an immediate immune mechanism. However, it is shown, that this is not the case when shrimp are growing in a biofloc system, rather than in a clear water system. It is postulated that the dense microbial population associated with the bioflocs induces a permanent trigger towards the development and maintenance of the shrimp immune system and thus build up a defence mechanism in the shrimp population. This mechanism and its utilization may be a very important means to protect shrimp against drastic disease outbreaks that often lead to collapse of shrimp production systems and to huge losses. It has to be emphasized that the present work is just a start and a trigger of needed subsequent studies. The present work was limited to a short growth phase of postlarvae. Preliminary tests failed as yet to demonstrate any relation between the concentration of the biofloc suspension and the immune genes expression. We need much more information regarding specific activity of different components of the biofloc biota, etc. We believe that more works in the present direction will follow.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgements
  9. References

This work was supported by the Project ‘Environmentally-friendly BFT shrimp culture technology’ (No. RP-2012-AQ-050), National Fisheries Research & Development Institute (NFRDI), Republic of Korea.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgements
  9. References
  • Amparyup P. & Charoensapsri W. (2009) Two prophenoloxidases are important for the survival of Vibrio harveyi challenged shrimp Penaeus monodon. Developmental and Comparative Immunology 33, 247256.
  • Amparyup P., Jitvaropas R., Pulsook N. & Tassanakajon A. (2007) Molecular cloning, characterization and expression of a masquerade-like serine proteinase homologue from black tiger shrimp Penaeus monodon. Fish and Shellfish Immunology 22, 35546.
  • APHA (1998) Standard Methods for the Examination of the Water and Wastewater (22nd edn). American Public Health Association, Washington, DC, USA.
  • Arnold S.J., Coman F.E., Jackson C.J. & Groves S.A. (2009) High-intensity, zero water-exchange production of juvenile tiger shrimp, Penaeus monodon: an evaluation of artificial substrates and stocking density. Aquaculture 293, 4248.
  • Avnimelech Y. (2012) Biofloc Technology (2nd edn). World Aquaculture Society, Baton Rouge, LA, pp.48, 189.
  • Avnimelech Y. & Kochba M. (2009) Evaluation of nitrogen uptake and excretion by tilapia in biofloc tanks, using 15N tracing. Aquaculture 287, 163168.
  • Azim M.E. & Little D.C. (2008) The biofloc technology (BFT) in indoor tanks: water quality, biofloc composition, and growth and welfare of Nile tilapia (Oreochromis niloticus). Aquaculture 283, 2935.
  • Burford M.A., Thompson P.J., Bauman H. & Pearson D.C. (2003) Microbial communities affect water quality, shrimp performance at Belize Aquaculture. Global Aquaculture Advocate 6, 6465.
  • Burford M.A., Thompson P.J., McIntosh R.P., Bauman R.H. & Person D.C. (2003) Nutrient and microbial dynamics in high-intensity, zero-exchange shrimp ponds in Belize. Aquaculture 219, 393411.
  • Burford M.A., Thompson P.J., McIntosh R.P., Bauman R.H. & Pearson D.C. (2004) The contribution of flocculated material to shrimp (Litopenaeus vannamei) nutrition in a high-intensity, zero exchange system. Aquaculture 232, 525537.
  • Cerenius L. & Söderhäll K. (2004) The prophenoloxidase-activating system in invertebrates. Immunological Reviews 198, 116126.
  • Chang C.F., Su M.S., Chen H.Y., Lo C.F., Kou G.H. & Liao I.C. (1999) Effect of dietary beta-1,3-glucan effectively improves immunity and survival of Penaeus monodon challenged with white spot syndrome virus. Fish and Shellfish Immunology 36, 163168.
  • Charoensapsri W. & Amparyup P. (2009) Gene silencing of a prophenoloxidase activating enzyme in the shrimp, Penaeus monodon, increases susceptibility to Vibrio harveyi infection. Developmental & Comparative Immunology 33, 811820.
  • Cohen J., Samocha T.M., Fox J.M. & Lawrence A.L. (2005) Biosecured production of juvenile Pacific white shrimp in an intensive raceway system with limited water discharge. Aquaculture Engineering 32, 425442.
  • Francisco V.A. & Gloria Y.P. (2000) Beta-glucan binding protein and its role in shrimp immune response. Aquaculture 191, 1321.
  • Han F. & Zhang X. (2007) Characterization of a ras-related nuclear protein (Ran protein) up- regulated in shrimp antiviral immunity. Fish and Shellfish Immunology 23, 937944.
  • Hargreaves J.A. (2006) Photosynthetic suspended-growth systems in aquaculture. Aquaculture Engineering 34, 344363.
  • Hari B., Kurup B.M., Varghese J.T., Schrama J.W. & Verdegem M.C.J. (2004) Effects of carbohydrate addition on production in extensive shrimp culture systems. Aquaculture 241, 179194.
  • He N., Liu H. & Xu X. (2004) Identification of genes involved in the response of haemocytes of Penaeus japonicus by suppression subtractive hybridization (SSH) following microbial challenge. Fish and Shellfish Immunology 17, 121128.
  • Hobbie J.E., Daley R.J. & Jasper S. (1977) Use of nucleopore filters for counting bacteria by fluorescence microscopy. Applied and Environmental Microbiology 33, 12251228.
  • Itami T., Tsuchihira E., Igusa H. & Kondo M. (1994) Enhancement of disease resistance of kuruma prawn Penaeus japonicus and increase in phagocytic activity of prawn hemocytes after oral administration of β1,3-glucan (Schizophyllan). Proceedings of the 3rd Asian Fisheries Forum, October 2630. 1992, Asian Fisheries Society, Manila, Philippines, pp. 375–378.
  • Janeway C.A. (1989) Approaching the asymptote? Evolution and revolution in immunology. Cold Spring Harbor Symposia on Quantitative Biology 54, 113.
  • Jang I.K., Pang Z., Yu J., Kim S.K., Seo H.C. & Cho Y.R. (2011) Selectively enhanced expression of prophenoloxidase activating enzyme 1 (PPAE1) at a bacteria clearance site in the white shrimp, Litopenaeus vannamei. BMC Immunology 12, 70.
  • Jitvaropas R. (2009) Functional characterization of a masquerade-like serine proteinase homologue from the black tiger shrimp Penaeus monodon. Comparative biochemistry and physiology (part B) 153, 236243.
  • Johansson M.W. & Söderhäll K. (1985) Cellular immunity in crustaceans and the proPO system. Parasitology Today 5, 171176.
  • Johansson M.W. & Söderhäll K. (1989) A cell adhesion factor from crayfish haemocyte has degranulating activity towards crayfish granular cells. Insect Biochemistry 19, 183190.
  • Kanost M.R. & Gorman M.J. (2008) Phenoloxidases in insect immunity. In: Insect Immunology (ed. by N.E. Beckage), pp. 6996. Academic Press, San Diego, CA, USA.
  • Kent M., Browdy C.L. & Leffler J.W. (2011) Consumption and digestion of suspended microbes by juvenile Pacific white shrimp Litopenaeus vannamei. Aquaculture 319, 363368.
  • Kirchman D., Sigda J., Kapuscinski R. & Mitchell R. (1982) Statistical analysis of the direct count method for enumerating bacteria. Applied and Environmental Microbiology 44, 376382.
  • Kwon T.H., Kim M.S., Choi H.W., Joo C.H., Cho M.Y. & Lee B.L. (2000) A masquerade-like serine proteinase homologue is necessary for phenoloxidase activity in the coleopteran insect, Holotrichia diomphalia larvae. European Journal of Biochemistry 267, 61886196.
  • Labbe P. & Little T.J. (2009) Prophenoloxidase in Daphnia magna: cDNA sequencing and expression in relation to resistance to pathogens. Developmental & Comparative Immunology 33, 674680.
  • Lee S.Y. & Söderhäll K. (2002) Early events in crustacean innate immunity. Fish and Shellfish Immunology 12, 421437.
  • Lee K.Y., Zhang R., Kim M.S., Park J.W., Park H.Y. & Kawabata S.I. (2002) A zymogen form of masquerade-like serine proteinase homologue is cleaved during pro-phenoloxidase activation by Ca2+ in coleopteran and Tenebrio molitor larvae. European Journal of Biochemistry 269, 43754383.
  • Lemaitre B. & Hoffmann J. (2007) The host defense of Drosophila melanogaster. Annual Review of Immunology 25, 697743.
  • Livak K.J. & Schmittgen T.D. (2001) Analysis of relative gene expression data using real time quantitative PCR and the 2-ΔΔCT method. Methods 25, 402408.
  • Mishra J.K., Samocha T.M., Patnaik S., Speed M., Gandy R.L. & Ali A. (2008) Performance of an intensive nursery system for the Pacific white shrimp, Litopenaeus vannamei, under limited discharge condition. Aquaculture Engineering 38, 215.
  • Moss S.M. & Pruder G.D. (1995) Characterization of organic particles associated with rapid growth in juvenile white shrimp, Penaeus vannamei (Boone), reared under intensive culture conditions. Journal of Experimental Marine Biology and Ecology 187, 175191.
  • Moss S.M., Divakaran S. & Kim B.G. (2001) Stimulating effects of pond water on digestive enzyme activity in the Pacific white shrimp, Litopenaeus vannamei (Boone). Aquaculture Research 32, 125131.
  • Moss S.M., Forster I.P. & Tacon A.G.J. (2006) Sparing effect of pond water on vitamins in shrimp diets. Aquaculture 258, 388395.
  • Otoshi C.A., Holl C.M., Moss D.R., Arce S.M. & Moss S.M. (2006) Super-intensive RAS trial yields encouraging shrimp harvest at Oceanic institute. Global Aquaculture Advocate 9, 6465.
  • Pan D., He N., Yang Z., Liu H. & Xu X. (2005) Differential gene expression profile in hepatopancreas of WSSV-resistant shrimp (Penaeus japonicus) by suppression subtractive hybridization. Developmental & Comparative Immunology 29, 103112.
  • Pang Z., Kim S.K. & Jang I.K. (2011) A like serine proteases from Pacific white shrimp Litopenaeus vannamei responsible to PO cascade but takes a difference role than PPAE. Conference of World Aquaculture Society, Natal, Brazil.
  • Rao X.J., Ling E. & Yu X.Q. (2010) The role of lysozyme in the prophenoloxidase activation system of Manduca sexta: an in vitro approach. Developmental & Comparative Immunology 34, 264271.
  • Ray A.J., Lewis B.L., Browdy C.L. & Leffler J.W. (2010) Suspended solids removal to improve shrimp (Litopenaeus vannamei) production and an evaluation of a plant-based feed in minimal-exchange, super intensive culture systems. Aquaculture 299, 8998.
  • Samocha T.M., Patnaik S., Speed M., Ali A.-M., Burger J.M., Almeida R.V., Ayub Z., Harisanto M., Horowitz A. & Brock D.L. (2007) Use of molasses as carbon source in limited discharge nursery and grow-out systems for Litopenaeus vannamei. Aquacultural Engineering 36, 184191.
  • Satoh D., Horii A., Ochiai M. & Ashida M. (1999) Prophenoloxidase-activating enzyme of the silkworm, Bombyx mori: purification, characterization and cDNA cloning. The Journal of Biological Chemistry 274, 74417453.
  • Söderhäll K. & Cerenius L. (1998) Role of the prophenoloxidase-activating system in invertebrate immunity. Current Opinion in Immunology 10, 2328.
  • Song Y.L., Liu J.J., Chan L.C. & Sung H.H. (1997) Glucan induced disease resistance in tiger shrimp (Penaeus monodon). Developments in Biological Standardization 90, 413421.
  • Sritunyalucksana K. & Söderhäll K. (2000) The proPO and clotting system in crustaceans. Aquaculture 191, 5369.
  • Tacon A.G.J., Cody J.J., Conquest L.D., Divakaran S., Forster I.P. & Decamp O.E. (2002) Effect of culture system on the nutrition and growth performance of Pacific white shrimp Litopenaeus vannamei fed different diets. Aquaculture Nutrition 8, 121137.
  • Thompson F.L., Abreu P.C. & Wasielesky W. (2002) Importance of biofilm for water quality and nourishment in intensive shrimp culture. Aquaculture 203, 263278.
  • Van Wyk P. & Scarpa J. (1999) Water quality and management. In: Farming Marine Shrimp in Recirculating Freshwater Systems (ed. by P. VanWyk, M. Davis-Hodgkins, R. Laramore, K.L. Main, J. Mountain, J. Scarpa), pp. 128138. Florida department of agriculture and consumer services, Tallahassee, FL, USA.
  • Wang R., Lee S.Y., Cerenius L. & Söderhäll K. (2001) Properties of the prophenoloxidase activating enzyme of the freshwater crayfish, Pacifastacus leniusculus. European Journal of Biochemistry 268, 895902.
  • Wasielesky W.H.A., Stokes A. & Browdy C.L. (2006) Effect of natural production in a zero exchange suspended microbial floc based super-intensive culture system for white shrimp Litopenaeus vannamei. Aquaculture 258, 396403.
  • Wickins J.F. (1976) The tolerance of warm-water prawns to recirculated water. Aquaculture 9, 1937.
  • Wu C. (2011) Innate immune proteins in a crustacean Pacifastacus leniusculus. Acta Universitatis Upsaliensis. Digital comprehensive summaries of Uppsala dissertations from the faculty of science and technology pp. 737772. Uppsala. ISBN 978-91-554-8015-8.