SEARCH

SEARCH BY CITATION

FilenameFormatSizeDescription
bij12115-sup-0001-si.doc260K

Table S1. Samples included in the DNA barcode analyses. Tables summarize collection information, the life stage of each sample (egg, larva or adult), host plant family/species, and sequence quality (percentage of untrimmed bases of high-quality; HQ%). DNA amplifications were performed with the Folmer primers: GGTCAACAAATCATAAAGATATTGG (F) and TAAACTTCAGGGTGACCAAAAAATCA (R).

bij12115-sup-0002-si.doc68K

Table S2. DNA sequences (COI) of limited quality and not deposited in GenBank (FASTA format). Sequences in this supplement were included in the analyses because they successfully identified individuals to the species level with 100% confidence. Numbers at the beginning of each sequence represent collection numbers. Information for each collection was included in Table S1.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.