Reduced expression of MIR409-3p in primary immune thrombocytopenia

Authors

  • Huiyuan Li,

    1. State Key Laboratory of Experimental Haematology, Institute of Haematology & Blood Diseases Hospital, Chinese Academy of Medical Sciences & Peking Union Medical College, Tianjin, China
    Search for more papers by this author
  • Haifeng Zhao,

    1. Department of Haematology and Oncology, Tianjin Medical University Cancer Institute and Hospital, Key Laboratory of Cancer Prevention and Therapy, Tianjin, China
    Search for more papers by this author
  • Feng Xue,

    1. State Key Laboratory of Experimental Haematology, Institute of Haematology & Blood Diseases Hospital, Chinese Academy of Medical Sciences & Peking Union Medical College, Tianjin, China
    Search for more papers by this author
  • Xian Zhang,

    1. State Key Laboratory of Experimental Haematology, Institute of Haematology & Blood Diseases Hospital, Chinese Academy of Medical Sciences & Peking Union Medical College, Tianjin, China
    Search for more papers by this author
  • Donglei Zhang,

    1. State Key Laboratory of Experimental Haematology, Institute of Haematology & Blood Diseases Hospital, Chinese Academy of Medical Sciences & Peking Union Medical College, Tianjin, China
    Search for more papers by this author
  • Jing Ge,

    1. State Key Laboratory of Experimental Haematology, Institute of Haematology & Blood Diseases Hospital, Chinese Academy of Medical Sciences & Peking Union Medical College, Tianjin, China
    Search for more papers by this author
  • Yanhui Yang,

    1. State Key Laboratory of Experimental Haematology, Institute of Haematology & Blood Diseases Hospital, Chinese Academy of Medical Sciences & Peking Union Medical College, Tianjin, China
    Search for more papers by this author
  • Min Xuan,

    1. State Key Laboratory of Experimental Haematology, Institute of Haematology & Blood Diseases Hospital, Chinese Academy of Medical Sciences & Peking Union Medical College, Tianjin, China
    Search for more papers by this author
  • Rongfeng Fu,

    1. State Key Laboratory of Experimental Haematology, Institute of Haematology & Blood Diseases Hospital, Chinese Academy of Medical Sciences & Peking Union Medical College, Tianjin, China
    Search for more papers by this author
  • Renchi Yang

    Corresponding author
    • State Key Laboratory of Experimental Haematology, Institute of Haematology & Blood Diseases Hospital, Chinese Academy of Medical Sciences & Peking Union Medical College, Tianjin, China
    Search for more papers by this author

  • HYL and HFZ contributed equally to this study.

Correspondence: Professor Renchi Yang, State Key Laboratory of Experimental Haematology, Institute of Haematology and Blood Diseases Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College, 288 Nanjing Road, Tianjin 300020, China.

E-mail: rcyang65@yahoo.com

Summary

Primary immune thrombocytopenia (ITP) is an acquired autoimmune disease with many immune dysfunctions. MicroRNAs (miRNAs) are a class of non-coding RNAs that post-transcriptionally regulate gene expression by messenger RNA degradation or translational repression. Accumulating evidence has demonstrated that miRNAs play a vital role in the regulation of immunological functions and prevention of autoimmunity. However, whether miRNAs are involved in the pathogenesis of ITP is still unknown. To illustrate the role of miRNAs in ITP, the expression profile of miRNAs from peripheral blood mononuclear cells (PBMCs) in ITP patients was investigated by miRNA microarray, and further validated by TaqMan real-time polymerase chain reaction. MIR409-3p expression was decreased in PBMCs of active ITP patients, but this recovered after effective therapy. IFNG was identified and validated as one of the targeted genes of MIR409-3p by bioinformatic prediction and reporter gene analysis. In addition, we found DGCR8 transcript was down-regulated in ITP patients and positively correlated with MIR409-3p. Thus, in ITP patients, decreased DGCR8 leads to down-regulation of MIR409-3p, which in turn results in up-regulation of IFNG (IFN-γ).

Primary immune thrombocytopenia (ITP) is an autoimmune disease characterized by a decreased platelet count due to autoantibodies mediating platelet destruction and insufficient platelet production (Wang et al, 2011). In addition to the secretion of antiplatelet antibodies by autoreactive B lymphocytes (Stasi et al, 2008), many other immune elements are also involved in ITP, such as T helper cells (Th), regulatory T cells and antigen-presenting cells (Panitsas et al, 2004; Catani et al, 2006; Ling et al, 2007; Liu et al, 2007; Sakakura et al, 2007). Among them, Th type 1/2 (Th1/Th2) imbalance plays an important role in ITP pathology. The T cell subsets are skewed to T1 polarization in ITP,and the Th1:Th2 ratio is closely related to the aetiology and disease status of ITP (Semple et al, 1996; Ogawara et al, 2003; Wang et al, 2005).

MicroRNAs (miRNAs) are a class of -21 nucleotide non-coding RNAs that are evolutionarily conserved and function as a negative regulator of gene expression after transcription. Like conventional protein encoding mRNA, miRNAs are transcribed by RNA polymerase II with a 5′ 7mG cap and a 3′ poly-A tail (primary miRNA, pri-miRNA) (Cai et al, 2004; Lee et al, 2004). The pri-miRNA is then processed into a 60–70-nucleotide RNA known as precursor miRNA (pre-miRNA) with a stem-loop structure by the nuclear RNase III DROSHA and its cofactor DiGeorge syndrome critical region gene 8 (DGCR8). The resulting pre-miRNA is exported from the nucleus into cytoplasm by exportin 5 in a Ran-GTP-dependent manner (Yi et al, 2003), where it is cleaved to a 21–24 bp duplex miRNA by DICER1. Subsequently, the guide strand was loaded into the RNA-induced silencing complex (RISC) containing EIF2C2 (Diederichs & Haber, 2007). Finally, the RISC binds to the 3′ UTR of target gene mRNAs, leading to either mRNA degradation or inhibition of translation depending on the degree of complementarity between the miRNA and its target mRNA (Valencia-Sanchez et al, 2006).

MiRNAs have an important regulating effect on gene expression, as they play pivotal roles in diverse biological processes, from differentiation and proliferation to apoptosis, which are associated with human diseases. DICER1 deficiency in B and T-cell results in a reduced number of T and B cells and, consequently, antibody production (Cobb et al, 2005; Muljo et al, 2005; Corbeil et al, 2009), indicating that miRNAs are involved in immunity. Further research has found that miRNA is involved in the development of immune cells (Fazi et al, 2005; Wu et al, 2007; Zhou et al, 2007), establishment of immunological tolerance (Li et al, 2007; Liston et al, 2008), B-cell terminal differentiation and IgG class switch (Thai et al, 2007; Vigorito et al, 2007). Accordingly, based on these pleiotropic roles of miRNAs in immunity regulation, it also plays an important role in autoimmune disease (Li et al, 2010; Wang et al, 2010).

Therefore, to evaluate the role of miRNAs in the pathogenesis of ITP, we determined the miRNA profile of peripheral blood mononuclear cells (PBMCs) in ITP patients, and found that the expression of MIR409-3p was decreased in ITP patients compared with that of normal controls. Further experiments verified that the target gene of MIR409-3p was IFNG, and decreased expression of MIR409-3p maybe due to the down-regulation of DGCR8.

Materials and methods

Patients and controls

A total of 30 ITP patients and 14 age- and sex-matched healthy donors were enrolled in this study. The diagnosis of ITP was based on the recently reported criteria (Rodeghiero et al, 2009). Of the 30 ITP patients, 3 (Patients P1-3, Table 1 )were studied by miRNA array, 19 (Patients P4-22, Table 1 )had their MIR409-3p expression measured by Taqman real-time polymerase chain reaction (PCR), and 22 patients(Patients P1-22, Table 1 )had the expression of related enzymes determined by real-time PCR. In addition, another eight patients (Patients P23-30, Table 2) were monitored for dynamic changes of MIR409-3p. This study was approved by the hospital-based ethics committee and informed consents were obtained from the patients or their parents as guardian.

Table 1. Clinical characteristics of ITP patients studied for expression of MIR409-3p and related enzymes
PatientSexAge, yearsCourse, monthsPlatelet count, × 109/lTherapy before enrollment
  1. F, female; M, male; –, No prior treatment; GC, glucocorticoid; IVIG, intravenous immunoglobulin.

MicroRNA array samples
P1F522456GC
P2M82413GC, IVIG
P3F3517
Taqman real-time PCR samples
P4F28119
P5M32226GC, IVIG
P6F27143GC
P7F1825GC
P8F21111
P9F561566GC
P10F241208GC, IVIG
P11F61426
P12F32116GC, IVIG
P13M106016GC, IVIG
P14M4212010GC
P15F712
P16F72364
P17F29622GC
P18F6122GC, IVIG
P19F672165GC
P20M29160
P21F15714GC, IVIG
P22M7120GC, IVIG
Table 2. Clinical characteristics of ITP patients monitored for dynamic changes of MIR409-3p
PatientSexAge, yearsCourse, monthsPre-treatment platelet count, × 109/lTherapy during hospital-izationPost-treatment platelet count, ×109/l
  1. F, female; M, male; GC, glucocorticoid; IVIG, intravenous immunoglobulin.

P23M501040IVIG80
P24F451207GC, IVIG51
P25M251047GC, IVIG113
P26M3723GC, IVIG136
P27F221829GC210
P28M23822GC, IVIG98
P29F54127GC, IVIG76
P30F21222GC42

Isolation of PBMCs and cell culture

Peripheral blood was collected into EDTA-anticoagulated vacuum tubes. Plasma samples were collected after a short centrifugation and were stored at −80°C until analysis. PBMCs were isolated using Lymph prep density gradient centrifugation (Haoyang, Tianjin, China). The isolated PBMCs were cultured in RPMI 1640 medium(Gibco, Grand Island, NY, USA)supplemented with 10% fetal bovine serum, 100 units/ml of penicillin, and 100 units/ml of streptomycin. In addition, the HEK293T cells used for reporter gene assay were cultured in Dulbecco's Modified Eagle Medium (DMEM; Gibco) supplemented with 10% fetal bovine serum, 100 units/ml of penicillin, and 100 units/ml of streptomycin.

MicroRNA array analysis

The differential miRNA expression in ITP patients was assayed in PBMCs from 3 ITP patients and 3 healthy donors using the miRCURY LNA Array (version 11.0) system, performed as previously described (Li et al, 2011). Total RNA was extracted from PBMCs (1 × 106) using Trizol reagent (Invitrogen, Carlsbad, CA, USA). The RNA samples were then labelled with the Exiqon miRCURY Hy3/Hy5 power labelling kit (Exiqon, Vedbaek, Denmark) and hybridized on the miRCURY LNA Array (version 11.0) station. Scanning was performed with the Axon GenePix 4000B microarray scanner (Molecular Devices, Sunnyvale, CA, USA). GenePix pro version 6.0 (molecular devices) was used to read the image raw intensity. The intensity of the green signal was calculated after background subtraction, and replicated spots on the same slide were averaged to obtain the mean intensity. The threshold value for significance used to define upregulation or downregulation of miRNAs was a fold change of >1·5, with a value of < 0·05 calculated by the t-test.

TaqMan real-time PCR for quantification of mature miRNAs

Total RNA was extracted using TRIzol reagent (Invitrogen) according to the manufacturer's protocol. Ten ng total RNA was then used to synthesis complementary DNAs using miRNA-specific primers and a reverse transcriptional kit (Applied Biosystems, Warrington, UK). Quantitative RT-PCR assays were performed using a TaqMan® MicroRNA Assays kit (Applied Biosystems) for the mature miRNA according to manufacturer's instructions. RNU6-2 small nuclear RNA was quantified as a control to normalize differences in total RNA levels.

PCR amplification reaction was performed on an ABI PRISM-7500 Sequence Detection System (Applied Biosystems). An initial denaturation at 94°C for 10 min was followed by 40 cycles of denaturation at 94°C for 15 s, and extension at 60°C for 1 min. The relative quantity of gene expression was obtained by comparing with the relative expression of RNU6-2 using the inline image method (Ct,target miRNA − Ct,RNU6-2).

Bioinformatics

Target prediction of the differentially expressed miRNAs was performed by TARGETSCAN (http://www.targetscan.org/vert_50/), MIRANDA(http://www.microrna.org), and PICTAR software(http://pictar.mdc-berlin.de/). We then chose the target genes that were associated with Th1 polarization in ITP patients.

Preparation of constructs

To create 3′ UTR luciferase reporter constructs, fragments of 3′ UTR from the IFNG gene harbouring the predicted MIR409-3p binding sites were cloned into psiCHECK2 vector at the 3′ end of the Renilla luciferase reporter gene. Primers used were as follows: 5′ CTCGAGTGTCCTGCCTGCAATATTTG 3′ (forward) and 5′ GCGGCCGCAAAGC-ACTGGCTCAGATTGC 3′ (reverse). The construct was sequenced, and named IFNG 3′UTR-psiCHECK2. The constructed vectors were then prepared with the Plasmid miniprep kit (Biomiga, Agoura Hills, CA, USA).

Reporter gene assay

HEK293T cells were seeded at 1 × 104 cells/well in a 24-well plate. A mixture of 100 ng of constructed 3′ UTR psiCHECK2 vector was co-transfected into HEK293T cells by using Lipofectamine 2000 (Invitrogen) on the following day along with pre-MIR409-3p or scramble MIR409-3p (Applied Biosystems) at a final concentration of 25 nmol/l. After 24 h, cells were lysed, and luciferase activity was measured by using a Dual-Luciferase Reporter Assay system (Promega, Madison, WI, USA). Firefly luciferase was used to normalize the Renilla luciferase.

Real-time PCR

To detect the mRNA expression of DROSHA, DICER1, DGCR8 and EIF2C2 in PBMCs of ITP patients, we performed real-time PCR on an ABI PRISM-7900 Sequence Detection System. The primer sequences are listed in Table 3. For PCR amplification, an initial denaturation at 94°C for 10 min was followed by 40 cycles of 94°C for 15 s, and 60°C for 1 min. After PCR, a melting curve analysis was performed by increasing the temperature from 60 to 95°C with a temperature transition rate of 0·10°C/s. The relative gene expression was obtained by comparing with the relative expression of ACTB using inline image (Ct,target gene  − Ct,ACTB).

Table 3. Primers for real-time PCR
GeneSense primersAnti-sense primers
ACTB 5′ GGCACCCAGCACAATGAAG 3′5′ CGTCATACTCCTGCTTGCTG 3′
DICER1 5′ TTCCAGAGTGTTTGAGGGATAGT 3′5′ GTGTGGAATCTGAGGTATGGGT 3′
DROSHA 5′ GCAGCCCAAATACGGAGAC 3′5′ TCAACAACAGCATCACCCAG 3′
DGCR8 5′ TGAATGTGAGAACCCAAGTGA 3′5′ GCAGCTTTATTCTTCGCAAG 3′
EIF2C2 5′ AGTGGGTGTCCTGCGTGAG 3′5′ CCGCCAAGAGGGTTAGAGC 3′

ELISA assay for cytokines

Plasma γ-interferon (IFNG) was measured by enzyme-linked immunosorbent assay (ELISA) kits according to the manufacturer's instructions (NeoBioscience Technology Co., Ltd, Shenzhen, China).

Statistics

Unless otherwise indicated, data were expressed as mean ± standard error of the mean (SEM). The relative expression levels of miRNAs between patients with ITP and normal controls were analysed by the nonparametric Mann–Whitney U-test. The other results were determined by 2-related samples Wilcoxon Signed rank test. < 0·05 was considered statistically significant.

Results

Decreased expression level of MIR409-3p in PBMCs of patients with ITP

The result of miRNA microarray indicated that there were 20 aberrant miRNAs in PBMCs from ITP patients compared with that of normal controls. We validated the miRNA array results by TaqMan real-time PCR in 19 active ITP patients(Patients P4-22, Table 1 ), and found that just 3 miRNAs were abnormally expressed in PBMCs from ITP patients (data not shown). We then selected MIR409-3p for further study. The miRNA microarray data showed that the expression level of MIR409-3p in PBMCs from ITP patients was 0·665-fold of that of normal controls. The TaqMan real-time PCR result demonstrated that MIR409-3p expression was significantly decreased in ITP patients compared with that of normal controls (0·80 ± 0·25 vs. 4·15 ± 1·65, = 0·01) (Fig 1).

Figure 1.

The relative expression of MIR409-3p in PBMCs of ITP patients (n = 19) and normal controls (n = 14). The relative expression of MIR409-3p was measured by TaqMan real-time RT-PCR. Data are relative to the amount of RNU6-2. The bars indicate the relative mRNA levels of MIR409-3p (mean ± SEM).

IFNG is the direct target of MIR409-3p

Based on the complementarity between miRNAs and the 3′-UTR sequences of their target,we identifed the putative target genes of MIR409-3p by using three independent target prediction algorithms including TARGETSCAN, MIRANDA and PICTAR. IFNG was identified as one of the putative target genes of MIR409-3p (Fig 2A). Due to the important role of IFNG in ITP physiology, we selected it for further study.

Figure 2.

Identification of IFNG as a target of MIR409-3p. (A): A schematic representation of the conserved sequences of MIR409-3p binding sites in the 3′ untranslated region (3′UTR) of IFNG. (B): A schematic diagram of constructed reporter vector. In this vector, Renilla luciferase was used as a primary reporter gene, and firefly luciferase was used to normalize transfections. (C): Luciferase activity in HEK-293 cells co-transfected with pre-MIR409-3p and luciferase report vectors. Controls were transfected with both luciferase report vectors and scramble MIR409-3p. The bars indicate the relative luciferase activity (mean ± SEM, n = 5).

To determine a direct interaction between the 3′ UTR of IFNG and MIR409-3p, The IFNG 3′ UTR-psiCHECK2 was co-transfected into HEK293T cells with pre-MIR409-3p or pre-MIR409-3p negative control, and luciferase activity was measured 24 h later. The result showed that a 30–40% inhibition of luciferase activity was obtained with MIR409-3p compared to that with the non-targeting scramble miRNA (Fig 2C).

Transcription levels of DROSHA, DICER1, DGCR8 and EIF2C2 in PBMCs

As the expression of MIR409-3p in ITP patients was lower than those found in healthy controls, mechanisms potentially causing down-regulation of MIR409-3p were addressed by comparing DROSHA, DICER1, DGCR8 and EIF2C2 transcripts in PBMCs from 22 ITP patients(Patients P1-22, Table 1 ) and 14 healthy controls. As shown in Fig 3, DGCR8 transcript level was significantly lower in the PBMCs from ITP patients than those in healthy controls (= 0·045). The transcription levels of DROSHA, DICER1 and EIF2C2 in ITP patients were not significantly different from those of normal controls.

Figure 3.

Relative mRNA expression of processing enzymes associated with miRNAs. The relative mRNA expression of DICER1 (A), DROSHA (B), DGCR8 (C) and EIF2C2 (D) of miRNAs processing enzymes were measured by real time PCR in active ITP patients (n = 22) and normal controls (n = 14).

Correlations between MIR409-3p expression level and mRNA levels of microRNA processing-related enzymes

We speculated that the decreased expression level of MIR409-3p might be attributed to the dysregulated expressions of microRNA processing-related enzymes, thus we analysed the correlation between MIR409-3p and mRNA expressions of DROSHA, DICER1, DGCR8 and EIF2C2. There was a positive correlation between MIR409-3p and DGCR8 (r = 0·570, = 0·005) (Fig 4A). Other enzymes had no correlations with MIR409-3p (data not shown). In addition, each enzyme showed significant correlation with the other enzymes in PBMCs of ITP patients (Fig 4B).

Figure 4.

Correlation between (A) MIR409-3p and DGCR8 transcript expressions (B) each pair of DROSHA, DICER1, DGCR8 and EIF2C2 transcripts.

MIR409-3p expression is associated with the status of disease

As mentioned above, we demonstrated that MIR409-3p played an important role in ITP pathogenesis by regulating the IFNG gene. The question is whether its expression is associated with disease status ? We studied the expressions of MIR409-3p in PBMCs and IFNG in plasma from 8 ITP patients(Patients P23-30, Table 2 )before and after treatment. The result showed that after treatment, MIR409-3p expression was upregulated (0·76 ± 0·64 vs. 4·43 ± 1·10, = 0·025), but the plasma IFNG concentration had not changed (14·52 ± 2·88 vs. 14·50 ± 3·47, > 0·05) (Fig 5).

Figure 5.

The dynamic analysis of MIR409-3p expression and its target gene in ITP patients before and after treatment. We collected the blood samples of the same patients before and after treatment. The expression of MIR409-3p (A) was followed by TaqMan real-time PCR, and plasma IFNG levels (B) by ELISA (n = 8).

Discussion

Recently, miRNAs have attracted attention due to their crucial roles in human diseases and are shaping up to be new therapeutic targets. It has gradually become clear that aberrant expression of miRNAs is implicated in the pathogenesis of autoimmune diseases (Li et al, 2010; Wang et al, 2010). However, ITP was poorly investigated in regard to its association with miRNAs. Through preliminary screening by miRNA micro array analysis and further validation by Taqman real-time PCR, we found 3 miRNAs were decreased in PBMCs from ITP patients. We found that MIR409-3p was decreased in PBMCs from ITP patients. Further monitoring of MIR409-3p dynamic changes showed that the expression of MIR409-3p was increased post-remission compared with that in active disease, suggesting that MIR409-3p may play a crucial role in the pathogenesis of ITP.

Until now, although deregulation of miRNA expression has been observed in many human autoimmune diseases, it is still largely unclear how miRNAs affect autoimmune pathogenesis in patients. To reveal the function of MIR409-3p in ITP, we predicted the target genes of MIR409-3p by predicted algorithms, and found IFNG was one of the putative target genes of MIR409-3p and the reporter gene analysis validated that MIR409-3p could directly inhibit IFNG expression.

IFNG is produced predominantly by natural killer (NK) and natural killer T (NKT) cells as part of the innate immune response, and by CD4 Th1 and CD8 cytotoxic T lymphocyte (CTL) effector T cells once antigen-specific immunity develops (Schoenborn & Wilson, 2007). Aberrant IFNG expression is associated with a number of autoinflammatory and autoimmune diseases and IFNG was found to be elevated in plasma of ITP patients (Semple et al, 1996). Increased IFNG may be attributed to increased Th1 polarization and T cell-mediated cytotoxicity (Olsson et al, 2003; Wang et al, 2005; Zhang et al, 2009). In this study, we found that MIR409-3p was decreased in PBMCs of ITP patients and MIR409-3p could negatively regulate IFNG expression, thus increased IFNG can at least be partially explained by decreased MIR409-3p in ITP patients. However, decreased expression of MIR409-3p is not a major mechanism of increased IFNG, because after treatment, the expression of MIR409-3p was increased but IFNG expression was not changed.

In order to ascertain whether decreased MIR409-3p was regulated by enzymes involved in miRNAs processing, real time PCR assays were applied to quantitate the relative transcript levels of DROSHA, DICER1, DGCR8 and EIF2C2 in PBMCs. The results showed that DGCR8 expression was decreased in ITP. Further correlation analysis demonstrated that there was a positive correlation between expression of MIR409-3p and DGCR8 transcript, which indicated that the decreased DGCR8 leads to impaired miRNA processing from pri-miRNAs to pre-miRNAs, finally resulting in decreased MIR409-3p.

In summary, we found decreased MIR409-3p in active ITP patients, which recovered after therapy. Further studies showed that MIR409-3p could negatively regulate IFNG gene expression, which indicated that MIR409-3p was involved in ITP pathogenesis by regulating IFNG. In addition, DGCR8 transcript was decreased in PBMCs of ITP patients, and it was positively correlated with MIR409-3p. Thus, in ITP patients decreased DGCR8 leads to down-regulation of MIR409-3p, which in turn results in up-regulation of IFNG. It is known that an individual miRNA has the ability to modulate multiple genes, so the function of MIR409-3p in ITP may be more complex than imagined. The relationship between abnormally expressed MIR409-3p and ITP pathology should be further explored.

Acknowledgements

This work was supported by grants of National Natural Science Foundation of China (81100337, 81070397, and 81170474), Ministry of Science and Technology (2011ZX09302-007-04), Ministry of Health (201202017) and Tianjin Municipal Science and Technology Commission (09JCYBJC10900, 10JCZDJC19700).

Author contributions

HY Li, HF Zhao, DL Zhang, J Ge, X Zhang, YH Yang, M Xuan and RF Fu performed research; HY Li and F Xue analysed data; HY Li, HF Zhao and RC Yang designed the research and wrote the manuscript.

Declaration of interest

The authors report no conflicts of interest.

Ancillary