The efficacy and tolerability of adriamycin, bleomycin, vinblastine, dacarbazine and Stanford V in older Hodgkin lymphoma patients: a comprehensive analysis from the North American intergroup trial E2496

Authors


  • E2496 was coordinated by the Eastern Cooperative Oncology Group (Robert L. Comis, M.D., Chair) and supported in part by Public Health Service Grants CA21115, CA23318, CA66636, CA17145, CA77440, CA11083, CA32102, CA46441, CA46282, CA38926, CA77202, CA21076, CA31946, CA13650 and from the National Cancer Institute, National Institutes of Health and the Department of Health and Human Services. Its contents are solely the responsibility of the authors and do not necessarily represent the official views of the National Cancer Institute. This study was listed on clinicaltrials.gov as NCT00003389.

Correspondence: Andrew M. Evens, Division of Hematology/Oncology, The University of Massachusetts Medical School, 55 Lake Avenue North, Worcester, MA 01655, USA.

E-mail: andrew.evens@umassmed.edu

Summary

There is a lack of contemporary prospective data examining the adriamycin, bleomycin, vinblastine, dacarbazine (ABVD) and Stanford V (SV; doxorubicin, vinblastine, mechlorethamine, vincristine, bleomycin, etoposide, prednisone) regimens in older Hodgkin lymphoma (HL) patients. Forty-four advanced-stage, older HL patients (aged ≥60 years) were treated on the randomized study, E2496. Toxicities were mostly similar between chemotherapy regimens, although 24% of older patients developed bleomycin lung toxicity (BLT), which occurred mainly with ABVD (91%). Further, the BLT-related mortality rate was 18%. The overall treatment-related mortality for older HL patients was 9% vs. 0·3% for patients aged <60 years (P < 0·001). Among older patients, there were no survival differences between ABVD and SV. According to age, outcomes were significantly inferior for older versus younger patients (5-year failure-free survival: 48% vs. 74%, respectively, P = 0·002; 5-year overall survival: 58% and 90%, respectively, P < 0·0001), although time-to-progression (TTP) was not significantly different (5-year TTP: 68% vs. 78%, respectively, P = 0·37). Furthermore, considering progression and death without progression as competing risks, the risk of progression was not different between older and younger HL patients (5 years: 30% and 23%, respectively, P = 0·30); however, the incidence of death without progression was significantly increased for older HL patients (22% vs. 9%, respectively, P < 0·0001). Altogether, the marked HL age-dependent survival differences appeared attributable primarily to non-HL events.

Survival rates for older patients with Hodgkin lymphoma (HL), typically defined as ≥60 years of age, have been shown to be significantly and disproportionately inferior compared with younger populations (Evens et al, 2008). The majority of studies examining older patients with HL have been retrospective analyses that were reported in the 1980s–90s; these analyses showed 5-year overall survival (OS) rates of approximately 30–45% (Mir et al, 1993; Levis et al, 1996; Roy et al, 2000; Stark et al, 2002; Weekes et al, 2002). A recent Surveillance, Epidemiology and End Results (SEER) Program report indicated that outcomes for HL in older patients had improved over time (Brenner et al, 2008). It is important to note, however, that survival rates in the earlier era (1980–84) were exceptionally low (c. 20%), while the 2000–04 survival rates remained significantly inferior compared with that seen in younger populations. Moreover, a recent retrospective analysis of older HL patients treated in the contemporary era showed continued overall modest outcomes (Evens et al, 2012).

It remains unclear to what extent the poor outcomes of older HL patients are due to potential biological differences in disease (i.e., higher relapse rate) versus treatment toxicity or other causes unrelated to progression of HL. Several studies have suggested that patients with older HL have biologically different and more aggressive disease compared with younger patients (Enblad et al, 1999; Stark et al, 2002; Gandhi et al, 2004; Keegan et al, 2005). However, most of these studies analysed disease-specific survival (DSS) without considering ‘competing risks’ as part of the analysis. Non-HL related events (e.g., early death due to toxicity) are not fully independent of HL-related events, as patients would have been at risk of relapse (or death) due to HL had the non-HL event not occurred.

The Study of Hodgkin lymphoma In the Elderly/Lymphoma Database (SHIELD) recently reported phase II data using the vinblastine, cyclophosphamide, procarbazine, etoposide, mitoxantrone, bleomycin, prednisolone (VEPEMB) regimen; they reported 3-year progression-free survival (PFS) and OS of 58% and 66%, respectively, for advanced-stage patients (Proctor et al, 2012). Despite these recent data, there remains a paucity of prospective clinical trial data examining the outcomes or toxicity of adriamycin, bleomycin, vinblastine, dacarbazine (ABVD) for older HL patients in the modern era. Furthermore, there are minimal available data studying the Stanford V regimen (doxorubicin, vinblastine, mechlorethamine, vincristine, bleomycin, etoposide, prednisone) in older patients. We analysed herein patient characteristics, treatment received, tolerability including detailed analysis of toxicity, and outcomes for older HL patients treated on E2496, a recent phase III study that randomized HL patients to ABVD versus Stanford V. Additionally, we compared patient and disease characteristics and survival of older versus younger HL patients treated on E2496 including survival analyses with competing risks.

Methods

Study eligibility

Eligibility for E2496 included classical HL with previously untreated, advanced-stage (III/IV) disease or bulky Stage II disease (Gordon et al, 2012). The latter was defined by a mass over one-third the maximum intrathoracic diameter on a standing posterior-anterior chest x-ray. Histology was determined using central review when available, then local pathology review. Concordance rate was assessed in patients with both central and local pathology review. Patients were randomized to ABVD or Stanford V as was recently reported (Gordon et al, 2012). Of 794 eligible patients, 45 (6%) were aged ≥60 years (n = 23 ABVD and n = 22 Stanford V). A detailed quality assurance review was performed for all cases; one additional subject was deemed ineligible due to baseline computed tomography (CT) scans that were not completed in the required time frame. This patient was included in the toxicity analysis. Baseline procedures included assessment of ejection fraction (EF) and pulmonary function testing (PFTs) with diffusing lung capacity for carbon monoxide (DLCO) and forced vital capacity (FVC). Bleomycin lung toxicity (BLT) was defined as the combination of (i) lower-respiratory tract symptoms (e.g., cough, shortness of breath), (ii) bilateral infiltrates on chest X-ray or CT and (iii) absence of infection (Sleijfer, 2001; Martin et al, 2005; Evens et al, 2007).

Treatment

Adriamycin, bleomycin, vinblastine, dacarbazine was given for six or eight cycles (every 28 d), depending on response by CT scan, while Stanford V was administered for 12 weeks (Gordon et al, 2012). Patients treated on Stanford V received prophylactic antibiotics, which included oral trimethoprim/sulfamethoxazole and ketoconazole while those on ABVD did not. Radiation therapy (RT) was delivered to all patients with bulky mediastinal adenopathy and was scheduled to begin 2 weeks after completion of chemotherapy. RT fields included mediastinum, bilateral hilar and bilateral supraclavicular areas, which were treated at 36 Gy. In addition, for patients who received Stanford V, 36 Gy was delivered to any pretreatment site >5 cm and for macroscopic splenic disease (by CT).

Epstein–Barr virus (EBV) methods

For EBV small RNA (EBER) in situ hybridization (ISH), a tissue microarray was constructed from available formalin-fixed, paraffin-embedded tissue blocks. The array included duplicate 1·5 mm diameter cores of tumour specimens. In situ hybridization for EBER was performed using the INFORM EBER probe (Ventana, Tucson, AZ, USA). Slides were stained on an automated stainer (Ventana Benchmark XT; Ventana) using the Ventana ISH/iView Blue detection kit. A known positive control was used. Specimens with Hodgkin-Reed-Sternberg cells with nuclear staining were considered positive.

For DNA extraction and quantitative real-time polymerase chain reaction (PCR), plasma was separated by centrifugation and DNA was isolated from 250 μl of plasma using the QIAamp DNA blood mini kit (Qiagen Inc, Valencia, CA, USA) according to manufacturer instructions. A primer pair and probe corresponding to the BamH-W region of the EBV genome (5′-CCCAACACTCCACCACACC-3′, 5′-TCTTAGGAGCTGTCCGAGGG-3′, 5′-(6-FAM) CACACACTACACACACCCACCCGTCTC (BHQ-1)-3′) were used. Namalwa DNA (Namalwa cell line genomic DNA, ATCC #CRL-1432) was used for calibration.

Statistical analysis

The primary endpoint of E2496 was failure-free survival (FFS), defined as time from randomization to the earlier of progression or relapse, or death. OS was measured from randomization to death of any cause. Time-to-progression (TTP) was defined as the time of randomization to progression, censored at last known progression-free; for death without documented progression, censor at death time. Comparisons were conducted according to intent-to-treat principles among eligible patients with a stratified log-rank test (localized versus extensive; International Prognostic Score (IPS) 0–2 vs. 3–7), between treatment groups or age groups (<60 vs. ≥60). Toxicity was evaluated on all patients regardless of eligibility. A receiver operating characteristic (ROC) curve was used to determine the cut-off for plasma EBV with optimal sensitivity, specificity, and concordance with EBV status by EBER-ISH. Fishers' exact and Wilcoxson rank sum tests were used to compare proportions and medians, respectively. Kaplan–Meier and Cox proportional regression models were used to estimate failure rates and hazard ratios. Progression and death without progression were identified as competing risks, and were compared between age groups using the method of cumulative incidence, as implemented in the cmprsk package in R (Gray, 1988; Kim, 2007). The cumulative incidence of HL-related death (including acute treatment-related toxicity) was similarly estimated considering death due to other cause as a competing risk (Kim, 2007).

Results

Demographics and characteristics

Patient characteristics for older HL patients were balanced between ABVD and Stanford V chemotherapy arms (Table 1). Median age for older HL patients was 65 years (range, 60–83), 47% had presence of B symptoms, while 18% had an IPS ≥ 4. There were several differences comparing older patient (n = 44) characteristics with patients aged <60 years (n = 750). This included increased frequency of mixed cellularity HL (25% vs. 10%, respectively, P = 0·0005) and inferior Eastern Cooperative Oncology Group (ECOG) performance status (PS) (PS 0: 34% vs. 58%, respectively, P = 0·003) for older versus younger patients. There was no difference in number of IPS factors (0–2 vs. ≥3) between age groups (despite all older patients having at least one criterion being age >45 years).

Table 1. Baseline demographic data of older HL patients
 Treatment arms
ABVD (n = 23)Stanford V (n = 21)
N % N %
  1. HL, Hodgkin lymphoma; NA, not available; ECOG, Eastern Cooperative Oncology Group; PS, performance status; NOS, not otherwise specified; IPS, International Prognostic Score; ABVD, adriamycin, bleomycin, vinblastine, dacarbazine.

Age (years)
Median6664
Range61–8360-83
Gender
Male11491363
Female1252838
ECOG PS
0626943
116701257
214
B symptoms
No12521152
Yes11481048
Disease Stage
II1429
III17741362
IV522629
Cell type
NA29
Nodular sclerosis11481152
Lymphocyte-rich15
Mixed cellularity730419
Classical HL, NOS313524
No. extra-nodal sites
018781571
1313419
229
415
515
Lung involvement
No21911886
Yes29314
Liver involvement
No21911991
Yes2929
Bone marrow involvement
No22961991
Yes1429
Mediastinal involvement
No1044419
Yes13561781
IPS risk factors
NA15
141729
210441048
373029
42915
5419
615

We compared baseline levels of EBV viral load and frequency of EBV(+) tumour between older and younger HL patients. There was an increased percentage of older patients with EBV(+) detected in tumour compared with younger patients, however this difference was not significant (29% and 15%, respectively, P = 0·12). Additionally, plasma EBV viral load was detected in 29% of older patients at baseline compared with 19% of younger patients (P = 0·34).

Treatment and toxicity

Adjunctive RT on E2496 was delivered to the mediastinum for all patients with bulky mediastinum on the ABVD arm and for any pretreatment site >5 cm or macroscopic splenic disease detected by CT for patients treated with Stanford V (Gordon et al, 2012). Among older HL patients, 8·7% who received ABVD received RT vs. 42·7% of younger patients (P = 0·0007), while 43% of older Stanford V patients received RT vs. 77% of younger patients (P = 0·002). This likely reflects the lower incidence of bulky stage I-II disease in older HL patients as compared with the whole population (7% vs. 35%). There were no differences in RT quality scores between older and younger patients (data not shown).

Chemotherapy dose modifications, as required by protocol, were common with 84% of older HL patients having at least one dose reduction. There were no differences in frequency of dose modifications according to chemotherapy regimen or between older and younger patients (data not shown). Relative dose-intensity for older HL patients was 73%; dose-intensity was not available for patients aged <60 years. Overall, adverse events (AEs) were relatively common among older HL patients (Table 2). Besides BLT (discussed below), there were no significant differences in haematological or non-haematological AEs between chemotherapy regimens for older HL patients.

Table 2. Adverse event data for older HL patients
Toxicity typeTreatment arms
ABVD (n = 24)Stanford V (n = 21)
GradeGrade
3 (%)4 (%)5 (%)3 (%)4 (%)5 (%)
  1. HL, Hodgkin lymphoma; PRBC, packed red blood cells; DLCO, diffusion capacity of the lung for carbon monoxide.

Haemoglobin13433
Leucocytes50172448
Lymphopenia7186
Neutrophils8792948
Platelets85
Transfusion (PRBCs)410
Hypertension4
Cardiac-other4
Fatigue17
Fever5
Constipation45
Dehydration8
Dysphagia-esophageal (radiation)5
Nausea45
Stomatitis4
Vomiting8
Alkaline phosphatase8
Hypoalbuminemia4
Infection with grade 3 or 4 neutropenia44105
Gastrointestinal haemorrhage5
Hyperglycaemia810
Muscle weakness10
Neuropathy-motor814
Neuropathy-sensory48
Syncope4
Abdominal pain5
Arthralgia4
Chest pain4
Myalgia85
Deep vein thrombosis4
Pain-other45
DLCO decrease4
Dyspnea413
Hypoxia44
Pneumonitis/pulmonary infiltrates8
Pulmonary-other8
Worst degree13798335710

Severe haematological AEs (grade 3–4) were more frequent in older versus younger patients, especially neutropenia (grade 4 or higher: 64% vs. 38%, respectively, P = 0·0005). The frequency of non-haematological grade 3–4 toxicities on E2496 were not different among older compared with younger patients (Table 3). However, the treatment-related mortality (TRM) was significantly higher for older compared with younger HL patients treated on E2496 (9% vs. 0·3%, respectively, P < 0·001). Among the grade 5 treatment-related toxicities for older patients, two (10%) occurred in the Stanford V group (gastrointestinal bleed/renal failure and colitis/sepsis) and two (8%) with ABVD (both due to BLT/pulmonary fibrosis).

Table 3. Severe toxicities on E2496 according to agea
Toxicity typeAge ≥ 60 years (n = 45)Age < 60 years (n = 789)
GradebGradeb
345345
n (%)n (%)n (%)n (%)n (%)n (%)
  1. a

    Grade 3, 4, and 5 adverse events (includes all patients who received any protocol treatment, regardless of eligibility status).

  2. b

    Worst degree.

Haematological11 (24)31 (69)372 (47)308 (39)
Non-haematological14 (31)6 (13)4 (9)322 (41)53 (7)2 (<1)

Bleomycin lung toxicity

Among the n = 45 older HL patients enrolled on E2496, 11 (24%) developed BLT, of whom 2/11 (18%) died due to acute pulmonary fibrosis/respiratory failure (Table 4). Furthermore, 10/11 (91%) BLT cases occurred with/during ABVD (BLT incidence: 43% with ABVD vs. 5% Stanford V, P = 0·04). This toxicity appeared to occur later in the chemotherapy course, however, the two BLT-related deaths occurred during cycle 3 of ABVD. We did not identify any factors that predicted the development of BLT or death due to BLT. Granulocyte growth factor was given to the vast majority of patients, thus it was not analysed as a risk factor. Additionally, as detailed in Table 4, the median age and baseline/pre-treatment levels of EF, FVC, and DLCO in the 11 older HL patients who developed BLT (69, 65%, 89%, 83%, respectively) were not significantly different than the 34 patients who did not (64, 61%, and 85% respectively).

Table 4. Bleomycin lung toxicity characteristics
CaseAge (years)/sexTreatmentTobacco history (status at entry)Baseline EF, FVC, and DLCO (%)Timing of BLTInitial CTCAE codeDeath due to BLTHL disease status
  1. M, male; F, female; FVC, forced vital capacity; DLCO, diffusion of lung capacity of carbon monoxide; EF, ejection fraction; CTCAE, Common Terminology Criteria for Adverse Events; BLT, bleomycin lung toxicity; HL, Hodgkin lymphoma; SOB, shortness of breath; AWOD, alive without disease; DOD, dead as a result of disease; DWOD, dead without disease; PI, pulmonary infiltrates.

  2. a

    Death due to lung cancer.

  3. b

    Death due to acute pulmonary fibrosis (during chemotherapy).

172/MABVD46 pack-years (active)72, 84, and 47Cycle 5Grade 3 hypoxiaNoDWODa
261/FABVDNone49, 66, and 54Cycle 5Grade 2 SOBNoDOD
366/MABVD40 pack-years (none in 20 years)55, 74, and 84Cycle 5Grade 2 coughNoAWOD
464/FABVDNone45, 102, and 87Cycle 5Grade 1 cough, Grade 1 PINoAWOD
569/MStanford V50-pack years (active)62, 89, and 90Month 3Grade 4 dyspneaNoAWOD
666/MABVDNone67, 92, and 24Cycle 4Grade 2 coughNoAWOD
772/FABVDNone78, 95, and 83Cycle 6Grade 2 coughNoAWOD
878/FABVDNone73, 75, and 77Cycle 3Grade 4 pulmonaryYesDWODb
962/FABVD60-pack years (none in 20 years)NA, 72, and 63Cycle 6Grade 2 coughNoAWOD
1077/FABVD5 pack-years (none in 40 years)79, 106, and 92Cycle 4Grade 1 cough, Grade 1 PINoAWOD
1169/MABVDNone55, 104, and 115Cycle 3Grade 3 pulmonaryYesDWODb

Outcomes for older patients

The overall response (ORR) and complete response (CR) rates for older HL patients were 68% and 64%, respectively. As noted in Table 5, ORR did not differ between the two chemotherapy arms for older patients. The 3-year FFS and OS rates were 56% and 70%, respectively, while the 5-year FFS and OS rates were 48% and 58%, respectively (Fig 1). FFS and OS did not significantly differ by chemotherapy regimen. Outcomes for older HL patients were also analysed according to the IPS. There was no significant difference between two IPS groups for FFS or OS among older patients (Fig 2); this included analysing IPS as a continuous variable (0–7; FFS P = 0·17 and OS P = 0·29). Nevertheless, this analysis may be underpowered.

Table 5. Response data
ResponseOlder HL treatment arms
ABVDStanford V
N % N %
Complete response626419
Clinical complete response939943
Partial response29
No change/stable417210
Progression210
Unevaluable29314
Missing14
ResponseHL age group
<60 years≥60 years
N % N %
  1. HL, Hodgkin lymphoma; N, number; ABVD, adriamycin, bleomycin, vinblastine, dacarbazine.

Complete response122161023
Clinical complete response411551841
Partial response58824
No change/stable699614
Progression7125
Unevaluable618511
Missing22312
Figure 1.

Older Hodgkin lymphoma (HL) patient survival. The (A) failure-free survival (FFS) and (B) overall survival (OS) for all older HL patients with confidence intervals. The (C) 3- and 5-year FFS for older patients who received ABVD was 58% and 53%, respectively, which compared with 54% and 42%, respectively, for patients who received Stanford V (P = 0·99); while the (D) 3- and 5-year OS for older patients who received ABVD was 73% and 64%, respectively, which compared with 67% and 51%, respectively, for patients who received Stanford V (P = 0·90).

Figure 2.

Survival for older Hodgkin lymphoma (HL) patients based on International Prognostic Score (IPS) and including competing risk analysis. There were no significant differences in (A) failure-free survival and (B) overall survival according to IPS for older HL patients. The (C) cumulative incidence of death due to HL/progression and death due to HL treatment/toxicity (i.e., treatment-related mortality) versus death incidence rate due to all other causes. The associated cumulative incidence of death at 3 and 5 years for older HL patients was 23% and 30%, respectively vs. 7% and 12%, respectively, for all other causes. The (D) cumulative incidence of death due to HL treatment/toxicity was plotted separately. The associated 3- and 5-year incidences of death was 16% and 21%, respectively, due to HL/progression, 7% and 9%, respectively, due to toxicity, and 7% and 12%, respectively, due to other causes.

Outcomes by age

Treatment arms were pooled and stratified for exploratory analyses. When analysing all deaths due to HL and HL-related therapy (i.e., death due to disease/progression and TRM combined), the cumulative incidence of death at 3 and 5 years for older HL patients was 23% and 30%, respectively, considering death due to other causes as a competing risk (Fig 2C); this compared with 7% and 10%, respectively, for HL patients aged <60 years. The 3- and 5-year incidences of death directly due only to HL (i.e., disease progression) for older patients were 16% and 21%, respectively (Fig 2D).

In further comparing outcomes by age, there was a trend for improved response in younger compared with older HL patients, though this was not significant (ORR: 79% vs. 68%, respectively, P = 0·13; CR rates: 71% vs. 64%, respectively, P = 0·31). Three-year and 5-year FFS and OS were significantly inferior for the older HL population (Table 6 and Fig 3). As part of this sub-group analysis (i.e., older versus younger HL patients), there was no significant interaction between age and treatment for FFS (P = 0·95) or OS (P = 0·56). Interestingly, the rates of TTP were not different according to age (Fig 3C). Further, a ‘competing risk’ survival analyses considering death without progression as a competing risk for progression showed no differences in risk of progression by age groups. However, the incidence rate of death without progression was significantly higher for older compared with younger HL patients (Fig 3D).

Table 6. Outcomes according to age
 Age < 60 years, %Age ≥ 60 years, %P-value (log-rank)
  1. FFS, failure-free survival; OS, overall survival.

FFS 
3-year76560·002
5-year7448
MedianNot reached4·7 years
OS 
3-year9370<0·0001
5-year9058
MedianNot reachedNot reached
Figure 3.

Outcomes comparing older HL with younger patients. The (A) 3- and 5-year failure-free survival for patients aged ≥60 years was 56% and 48%, respectively, which compared with 76% and 74%, respectively, for patients aged <60 years (P = 0·002); while (B) the 3- and 5-year overall survival for patients aged ≥60 years was 70% and 58%, respectively, which compared with 93% and 90%, respectively, for patients aged <60 years (P < 0·0001). (C) The 2- and 5-year time-to-progression (TTP) for patients aged ≥60 years was 80% and 68%, respectively; this compared with 81% and 78%, respectively, for patients aged <60 years (P = 0·37). (D) The rates of progression were determined with competing risk analysis because death without progression is a competing risk for disease progression. The incidence rates of progression including competing risks for patients aged ≥60 years at 2 and 5 years were 19% and 30%, respectively, compared with 19% and 23%, respectively, for patients aged <60 years (P = 0·30); however, the incidence rates of death without progression for patients aged ≥60 years at 2 and 5 years were 13% and 22%, respectively, compared with 2% and 9%, respectively, for patients aged <60 years (≤ 0·0001).

Discussion

The proportion of HL patients age ≥ 60 years in population studies has ranged between 15–35% (Yarnold et al, 1982; Enblad et al, 1991; Levis et al, 1994; Roy et al, 2000; Stark et al, 2002), however, the ratio of older patients in HL clinical trials has been lower (i.e., <5% of participants) (Mir et al, 1993; Roy et al, 2000; Engert et al, 2005). Thus, data describing characteristics and outcomes for older patients with HL have been derived primarily from registry and retrospective population-based series. In these series, older age has been a consistent significant adverse prognostic factor for survival in HL (Guinee et al, 1991; Erdkamp et al, 1992; Mir et al, 1993; Roy et al, 2000; Stark et al, 2002; Engert et al, 2005). The associated chemotherapy regimens in these reports have been heterogeneous, while the last prospective studies of older HL patients that examined ABVD were reported nearly 20 years ago (Mir et al, 1993; Levis et al, 1994). Furthermore, to our knowledge, there are no existing data studying Stanford V in older patients with HL. In the randomized trial E2496 that compared ABVD and Stanford V therapy, we identified a high incidence of BLT in older patients treated with ABVD (i.e., 43%), while the tolerability appeared otherwise similar between these regimens. Furthermore, response rates and survival were similar. We found, however, that TRM was significantly increased in older compared with younger HL patients, as was FFS and OS. In interpreting these observations, several factors should be considered.

The last prospective clinical trial that reported results using ABVD in advanced-stage older HL patients was the Cancer and Leukemia Group B (CALGB) 8251 study (Mir et al, 1993). In that analysis, the 5-year OS for patients aged ≥ 60 years was 31% vs. 63% for patients aged 40–59 years, and 79% for age <40 years (P < 0·0001). Further, the median disease-free survival rates for ages 16–45 years was 8·9 years, 3·5 years for 46–55 years, 1·5 years for 56–65 years, and 0·7 years for >65 years (P < 0·0001). Levis et al (1994) analysed the outcome of 65 patients aged ≥65 years who had received a ‘registry-recommended’ protocol of ABVD, mechlorethamine, vincristine, procarbazine, prednisone (MOPP) or ABVD/MOPP therapy. The 8-year EFS and OS was 41% and 46%, respectively, both significantly worse compared with patients aged <65 years. An important factor associated with the inferior survival of older patients in that study was the 23% acute TRM rate associated with ABVD-based therapy.

Treatment-related toxicity is a significant concern for older patients, particularly the risk of infection, pulmonary, and cardiac toxicity. Among older HL patients in the HD-9 randomized study of the German Hodgkin Study Group (GHSG), a TRM rate of 9% for cyclophosphamide, oncovin, procarbazine, prednisone (COPP)-ABVD combination therapy and 21% for bleomycin, etoposide, doxorubicin, cyclophosphamide, vincristine, procarbazine, prednisone (BEACOPP)-baseline therapy was noted (Ballova et al, 2005). In a sub-group of patients treated off trial (on a registration study) in the SHIELD analysis, Proctor et al (2012) noted a TRM of 18% for advanced-stage older HL patients who were treated with ABVD; this compared with a TRM of 4% for patients on the prospective VEPMB trial (TRM due to BLT of 1%) (Proctor et al, 2012). In a retrospective study, the GHSG showed that severe toxicity (grade 4) was significantly more common in older versus younger patients (Engert et al, 2005). The frequency of non-haematological grade 3–4 toxicities on E2496 was not different among older patients compared with those aged <60 years, however haematological toxicities were increased and the TRM of older patients was increased 35-fold compared with HL patients aged <60 years. A contributing factor to TRM in E2496 was BLT.

The incidence of BLT in the literature is variable, up to 46% in some reports (Sleijfer, 2001; Coiffier et al, 2002). Among all older HL patients in E2496, the incidence of BLT was 24%, although most cases occurred in patients who received ABVD (BLT rate with ABVD of 43%). Reported risk factors for BLT include older age, renal insufficiency, baseline lung function, pulmonary radiation, tobacco, and granulocyte colony-stimulating factor (G-CSF) (Sleijfer, 2001; Azambuja et al, 2005). We could not identify any predictive factors for BLT including detailed analysis of pre-treatment lung and cardiac function. It is important to note that most older patients in E2496 received G-CSF (according to protocol); thus it is not known how much this contributed to the development of BLT. It should also be highlighted that the common terminology criteria AE (CTCAE) did not reliably capture the diagnosis of BLT; as detailed in Table 4, the initial diagnostic coding was heterogeneous in depicting BLT (e.g., dyspnea, cough, hypoxia, pneumonitis, etc). Most diagnoses of BLT were based on further detailed physician workup.

The outcomes for older patients in E2496 were significantly inferior compared with younger patients. Inadequate treatment delivery of chemotherapy has been shown to be an adverse prognostic factor in HL (Yarnold et al, 1982; Levis et al, 1994; Landgren et al, 2003). There were no apparent differences in frequency of dose reductions in E2496 among older and younger patients, however a formal comparison of dose intensity could not be performed. Several series have proposed that HL in older patients is biologically different compared with younger HL patient populations (Klimm et al, 2007). Prior reports in older HL patients have shown an increased frequency of mixed cellularity HL subtype (Mir et al, 1993; Levis et al, 1994; Engert et al, 2005) and poorer PS (Engert et al, 2005) compared with younger HL populations, while others have noted less frequent bulky mediastinal disease in older HL patients (Levis et al, 1994). We confirmed the findings of increased mixed cellularity and poorer PS in the older population, however, there were no differences detected in risk of disease progression when competing risk analyses were utilized. Including competing risk analysis was critical as a straightforward Kaplan–Meier method would result in incorrect and biased estimates of the risk of progression (Gray, 1988; Kim, 2007). The bias arises because the Kaplan–Meier method assumes that all events are independent, and thus, censors all events other than the event of interest (Kim, 2007). Progression and death without progression are not independent since patients who experienced death before progression cannot be at further risk of progression of disease.

Altogether, ABVD and Stanford V produced comparable survivals in advanced-stage older patients with HL, despite a significantly increased risk of BLT with ABVD. Further, despite a TRM rate of 9%, the survival rates for older HL patients in E2496 compared favourably with the VEPEMB regimen from the recent SHIELD study (Proctor et al, 2012) (3-year PFS and OS for E2496: 56% and 70%, respectively; SHIELD: 58% and 66%, respectively). And compared with historical controls (Enblad et al, 1991; Mir et al, 1993; Levis et al, 1994), survival of older HL patients in the modern era indeed appears improved over the past several decades. However, despite this apparent progress, older patients continue to have a markedly inferior survival compared with younger HL patients. The age-related survival disparity we observed appears to be related primarily to non-progression causes including markedly higher TRM experienced by older patients. This underscores the continued critical need for new therapeutic approaches for older HL patients, especially regimens that maintain efficacy, but with improved tolerability. It will be important to study the integration of novel therapeutic agents, such as brentuximab vedotin (NCT01476410 and NCT01716806) and lenalidomide (NCT01056679), into the first-line treatment of older patients with HL.

Acknowledgement

We acknowledge the ECOG core-coordinating centre for their work.

Conflict of interest disclosure

All authors have no conflict of interest to disclosure.

Author contributions

A.M.E., B.S.K., S.J.H.: designed research, performed research, analysed data, and wrote the paper. F.H. designed research, analysed data, and wrote the paper. L.I.G., H.W., R.A.: designed research, performed research, and wrote the paper. R.I.F., N.L.B., B.D.C., T.P.M.: designed research and wrote the paper. J.C., P.J.S.: designed research. R.D.G., M.G., R.T.H.: designed research and performed research.

Ancillary