SEARCH

SEARCH BY CITATION

Keywords:

  • chronic myeloid leukaemia;
  • tyrosine kinase inhibition;
  • SALL4;
  • ABCA3

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Authorship and disclosures
  9. References
  10. Supporting Information

Although BCR-ABL1 tyrosine kinase inhibitors reliably induce disease remission for patients with chronic myeloid leukaemia (CML), unlimited extension of therapy is necessary to prevent relapse from persistent leukaemic cells. Here, we analysed model cell lines and primary CML cells for the expression and functions of the ABC transporter A3 (ABCA3) as well as the embryonic stem cell-associated transcription factor SALL4. ABCA3 protected leukaemic cells from the cytotoxic effects of the tyrosine kinase inhibitors imatinib, dasatinib, and nilotinib. In the surviving cells, exposure to tyrosine kinase inhibitors significantly enhanced ABCA3 expression in vivo and in vitro, and was associated with increased expression of SALL4, which binds the ABCA3 promoter. Inhibition of ABCA3 or SALL4 by genetic silencing or indomethacin, but not interferon gamma, interrupted SALL4-dependent regulation of ABCA3 and restored susceptibility of leukaemic cells to tyrosine kinase inhibition. Tyrosine kinase inhibitor exposure facilitates a protective loop of SALL4 and ABCA3 cooperation in persistent leukaemic cells.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Authorship and disclosures
  9. References
  10. Supporting Information

Targeting the disease-specific BCR-ABL1 translocation by tyrosine kinase inhibition (TKI) with imatinib, nilotinib, or dasatinib provides an efficient means to achieve haematological and molecular remission for most patients with chronic myeloid leukaemia (CML) (Druker et al, 2006; Kantarjian et al, 2010; Saglio et al, 2010). Cessation of treatment, however, is followed by disease recurrence for a high proportion of patients (Cortes et al, 2004; Mahon et al, 2010), and the subgroup of patients who relapse under imatinib therapy often harbour mutations in the ATP-binding site of BCR-ABL1 (Chu et al, 2005 Gorre et al, 2001). In the stem cell compartment of patients in remission, BCR-ABL1 positive leukaemia-initiating cells persist for several years (Bhatia et al, 2003; Chu et al, 2011). Experiments have indicated that CML stem cells are quiescent in nature and do not depend on BCR-ABL1 activity for survival (Holyoake et al, 1999; Graham et al, 2002; Corbin et al, 2011). These observations suggest that TKI effectively controls CML, but may not eradicate the leukaemic clone at the level of rare persistent cells with clonogenic capacity.

Dissecting the characteristic propensities of leukaemic progenitor cells with low Hoechst33342 vital dye staining as the side population phenotype, we previously found that the intracellular ABC transporter A3 (ABCA3) is strongly expressed in leukaemic side population cells from patients with acute myeloid leukaemia (AML) and CML (Wulf et al, 2001, 2004; Chapuy et al, 2008). ABCA3 has a crucial function in surfactant production and secretion from type 2 pneumocytes in the mammalian lung, leading to fatal respiratory distress syndrome in newborns carrying dysfunctional gene mutations (Shulenin et al, 2004). In CML cells, however, paraneoplastic ABCA3 expression modulates imatinib susceptibility, and subcellular sequestration is an efficient mechanism of cellular imatinib detoxification (Chapuy et al, 2008).

The human zinc-finger transcription factor SALL4, encoded by the SALL4 gene that maps to chromosome 20q13, critically regulates pluripotent and self-renewal properties in embryonic stem cells by interacting with NANOG and OCT4 (POUSF1) (Yang et al, 2008, 2010). Constitutive expression of SALL4 has been observed in haematopoietic stem cells, in the leukaemic cells of AML patients, and in cells in the blast crisis or accelerated phase of CML (Ma et al, 2006; Lu et al, 2011). Moreover, recent reports have documented the direct binding of SALL4 to the promoter of ABCA3, affecting the formation of leukaemic side population cells in AML (Jeong et al, 2011).

Here we explored the expression and function of ABCA3 and SALL4 in CML cells under exposure to TKI. We discovered that positive regulation of ABCA3 through SALL4 constituted an autoprotective loop protecting leukaemic stem cells from TKI.

Material and methods

  1. Top of page
  2. Summary
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Authorship and disclosures
  9. References
  10. Supporting Information

Patients, cells and in vitro assays

For the cohort of CML patients, the bone marrow specimens represented archival diagnostic material collected from adults before therapy and under surveillance during imatinib treatment or from patients with gastrointestinal stroma tumours (GIST) receiving imatinib in adjuvant indication at the University Hospital in Goettingen, Germany, and informed consents have been obtained. Approval for the study had been granted from the Ethics Committee of the University of Goettingen. As control samples, adult human bone marrow progenitor cells were isolated from routine diagnostic posterior iliac crest aspirates of individuals without marrow disease involvement. Mononuclear cells (MNC) were separated from whole bone marrow aspirates using density centrifugation with Ficoll (Pharmacia, Karlsruhe, Germany). K562, LAMA84, BV173 and HL60 cells [German Collection of Microorganisms and Cell Cultures (DSMZ), Braunschweig, Germany] were propagated in RPMI 1640 medium supplemented with 25 mmol/l HEPES, GlutaMAX I (Gibco-BRL, Eggenstein, Deutschland), penicillin/streptomycin (Sigma, Seelze, Germany; Biochrom, Berlin, Germany). K562, HL60 and Lama84 cultures were supplemented with 10% heat-inactivated fetal calf serum (FCS; Gibco-BRL); BV173 and Mo7 (Avanzi et al, 1988) were supplemented with 20% FCS. For all assays with stably transduced cell lines, the transfected cell lines were propagated without G418 for 4 passages, without losing transgene expression as evaluated routinely by fluorescence microscopy. For experiments including CD34 positive cells, murine OP9 cells were used as feeder cells. Three days before co-culture with CD34 positive cells, OP9 cells were propagated in MEM Alpha Medium without nucleosides (Gibco-BRL) supplemented with penicillin/streptomycin (Sigma, Biochrom), 20% heat-inactivated FCS (Gibco-BRL), 1x non-essential aminoacids (Gibco-BRL), and 1% L-glutamine (200 mmol/l stock solution). CD34-positive cells were seeded directly into the media over the OP9 cells feeder layer and co-cultured during the whole experiment. Cell viability was determined with the MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay as previously described (Denizot & Lang, 1986). The specific viability was expressed as the ratio of the absorbance with drug versus the absorbance of vehicle control. The half maximal effective concentration (EC50) was defined as the concentration of drug causing a 50% inhibition of cell growth, compared with the vehicle control. To analyse the clonogenicity, 500 cells (K562 or LAMA84) to 1000 cells (BV173) were seeded in triplicates into 1 ml methylcellulose medium supplemented with increasing amounts of imatinib as indicated. Cells were allowed to form colonies by incubating at 37°C, counted on day 14 of culture. Specific clonogenicity was expressed as fraction of vehicle control.

Enforced Expression and lentiviral shRNA knock down of ABCA3

For lentivirus-mediated silencing of ABCA3 and SALL4, pLKO.1 plasmids containing the following validated specific shRNA sequences [RNAi Consortium (TRC, http://www.broadinstitute.org/rnai/trc) were used: TRC clone ID TRCN0000059338 (referred to as shABCA3·38): 5′CCGG(GCTTGAAGATTCAGTCGGAAA)CTCGAG(TTTCCGACTGAATCTTCAAGC)TTTTTG-3′.

TRC clone ID TRCN0000059339 (referred to as shABCA3·39): 5′CCGG(GCCCAGCTCATTGGGAAATTT)CTCGAG(AAATTTCCCAATGAGCTGGGCTTTTTG)3′.

TRC clone ID TRCN0000021874 (referred to as shSALL4·74): 5′CCGG(CCGACCTATGTCAAGGTTGAA)CTCGAG(TTCAACCTTGACATAGGTCGGTTTTT)3′ and TRC clone ID TRCN0000021875 (referred to as shSALL4·75): 5′CCGG(GCAACATATTCGGATGCACAT)CTCGAG(ATGTGCATCCGAATATGTTGCTTTTT)3′.

Lentiviral particles were produced in the HEK293T producer cell line with the plasmids pCMV-ΔR8·91 (containing gag, pol, and rev genes) and pMD.G (VSV-G expressing plasmid) following standard protocols. Positive transfected cells were selected by media containing puromycin at minimum effective concentrations. The pEGFP-N1-ABCA3 plasmid was electroporated for overexpression as previously described (Chapuy et al, 2008).

Confocal fluorescence microscopy

For confocal microscopy, cells were spun onto a microscope slide using a cytospin centrifuge (Shandon, Frankfurt, Germany). Dried cytospins of cells were fixed at room temperature using 3·7% paraformaldehyde for 20 min, with the subsequent quenching of any unspecific binding using 50 mmol/l NH4Cl for 15 min and permeabilization with 0·05% Triton X-100 in phosphate-buffered saline (PBS) for 15 min. Primary antibodies were diluted 1:100 in PBS for 1 h. After washing twice with PBS and incubating with 10% goat serum, the primary antibodies were visualized using goat secondary antibodies at a dilution of 1:500 in PBS coupled to Cy3 and Cy2 (Dianova). All samples were mounted in Fluoromount with 4′,6-diamidino-2-phenylindole (DAPI; DAKO, Hamburg, Germany) and analysed with the Axio Imager Z1 AX10 (Zeiss, Jena, Germany) with a 63× inversion oil objective (Zeiss). The data were exported as TIFF files and arranged using Adobe PhotoShop without further modification of the primary image.

Sodium dodecyl sulfate polyacrylamide gel electrophoresis, Western Blot, and polymerase chain reaction

For sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), total cell lysates were prepared in CelLytic M (Sigma), supplemented with 1 mmol/l Na3VO4, 10 mmol/l Na2MoO4, and proteinase inhibitor mixture (Sigma), and 25μg of protein were run on standard SDS-PAGE gradient gels. Protein transfer was completed at 30 V for 60 min on Hyperbond-CExtra (Amersham Biosciences, Freiberg, Germany) and blocked with 5% bovine serum albumin (Sigma) in 0·1% Tris-buffered saline. After washing, membranes were probed against the indicated antigens following the manufacturer's recommendation for the antibodies. The polyclonal rabbit antibody against human ABCA3 was provided by N. Inagaki (Kyoto, Japan). Cross-reactivity to other ABC transporters of this antibody has not been observed (data not shown). Actin (ACTB) and GAPDH controls were run in parallel throughout with primary mouse antibodies (Sigma), secondary horseradish peroxidase conjugated antibodies against anti-rabbit or anti-mouse were purchased from Santa Cruz Biotechnology Inc. (Heidelberg, Germany). For chemoluminescence detection, standard enhanced chemiluminescence (ECL; Pierce, Rockford, IL, USA) was used. For quantification of mRNA, quantitative real time polymerase chain reaction (qRT-PCR) of ABCA3 and ACTB transcripts was performed in triplicate on a Taqman cycling machine (ABI Prism 7900HT Sequence Detection System, Applied Biosystem, Darmstadt, Germanys) following previously published protocols (Chapuy et al, 2008). Briefly, the SYBR green kit (Qiagen, Hilden, Germany) was used according to the manufacturer's protocols, with 40 cycles of denaturation (15 s at 95°C), annealing (45 s at 58°C), and elongation (60 s at 72°C) followed by a melting curve analysis. Subsequently, the threshold PCR cycle number (CT) was obtained when the increase in the fluorescence signal of the PCR product indicated exponential amplification. This value was normalized to the threshold PCR cycle number obtained for ACTB mRNA from a parallel sample. The ABCA3 primer (us 5′–TTCTTCACCTACATCCCCTAC–3′; ds 5′–CCTTTCGCCTCAAATTTCCC–3′) yielded an amplicon of 139 bp (10), the SALL4 primer (us 5′–TGCAGCAGTTGGTGGAGAAC–3′; ds 5′–TCGGTGGCAAATGAGACATTC–3′) yielded an amplicon of 68 bp and the ACTB primer (us 5′–CACACTGTGCCCATCTACGA–3′; ds 5′–TGAGGATCTTCATGAGCTAGTCAG-3′) yielded an amplicon of 99 bp. A dilution series of eGFP-N1 + ABCA3 (1 × 10−3–1 × 10−9 M) was run in parallel with all reactions to allow quantification.

Statistical evaluations

The indicated statistical tests were performed, using GraphPad Prism version 4.03 for Windows (GraphPad Software, http://www.graphpad.com), and differences with P < 0·05 were considered significant, as marked by asterisks in the respective figures. Error bars represent the standard deviations (SDs) of samples.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Authorship and disclosures
  9. References
  10. Supporting Information

ABCA3 protects CML cells from TKI-mediated cytotoxicity

Previously, we documented ABCA3 expression in myeloid leukaemias and detected the intracellular sequestration of imatinib in CML stem cells, which affected leukaemia cell susceptibility to this drug (Chapuy et al, 2008). To extend these observations, here we applied lentiviral shRNA technology for effective silencing of ABCA3 in the BCR-ABL1 positive cell lines BV173, K562, and LAMA84 and in primary material (Figs 1A and B). While suppression of ABCA3 function did not alter the growth rate of cell lines in non-perturbed suspension cultures, silencing of ABCA3 reduced the clonogenicity of BCR-ABL1 positive cells, both in the cell line models and in clonal growth from primary leukaemia samples under exposure to imatinib (Figs 11C–E). Thus, ABCA3 expression is critical for the susceptibility of CML cells to growth inhibition via TKI.

image

Figure 1. Silencing ABCA3 reduces clonogenic capacity of BCR-ABL1-positive cells. Transduction with lentiviral ABCA3 silencing constructs significantly reduced levels of ABCA3 expression in the cell lines BV173, K562 and LAMA84 at transcript levels (A, qRT-PCR, unpaired two-tailed t-test) and protein levels (B, Western blot). Cells were seeded in semisolid methylcellulose supplemented with imatinib at the concentrations indicated, and colonies were counted on day 14. Loss of clonogenicity with increasing doses of TKI was significantly pronounced following ABCA3 silencing for all cell lines, with an example of diminished colony formation shown for cell line K562 (C and D, two-way anova with Bonferroni post-test; complete loss of clonogenicity marked by asterix). Similarly, primary CD34-positive cells from untreated CML patients were transduced with the shABCA3-TRN59339 silencing construct or mock control (scrbl). While spontaneous colony formation did not differ between such variants, clonogenicity from ABCA3-silenced variants was completely lost under exposure to 2 μmol/l imatinib (E, comparison to mock controls [scrbl] by unpaired two-tailed t-test).

Download figure to PowerPoint

TKI induces ABCA3 expression

The effect of ABCA3 on susceptibility to TKI raised our interest in the expression levels of the transporter in the clinical setting. We first used qRT-PCR to confirm our previous observation of significantly increased ABCA3 transcript levels in peripheral blood and bone marrow samples from patients with active CML (Figs 2A). Looking for the effect of oncogenic BCR-ABL1 on ABCA3 expression, we analysed stably transfected variants with BCR-ABL1 in HEK293 model cells as well as the leukaemic cell lines HL60 and Mo7, and discovered a significant increase in transporter expression (Fig S1a). Surprisingly, however, we also detected elevated ABCA3 transcript abundance in peripheral blood samples from patients in haematological complete remission (CR) under imatinib maintenance therapy, as well as – at lower levels – patients with GIST under imatinib maintenance therapy (Fig 2A). Seeking the source of these ABCA3 transcripts, we first measured transcript levels in BCR-ABL1 positive leukaemia cell lines, and identified a dose-dependent induction of ABCA3 transcription by imatinib, dasatinib, and nilotinib (Figs 2B and C). Of note, these ABCA3 transcripts originated from the viable cells in the suspension cultures, as confirmed with sorted cell preparations (Figure S1c). We also exposed CD34-positive BCR-ABL1 positive leukaemic cells to 2 μmol/l imatinib, dasatinib, or nilotinib in stroma-supported in vitro culture, and consistently observed induction of ABCA3 expression in these cells (Fig 2D), an effect which we also detected in BCR-ABL1 negative CD34 positive cells as the main source of ABCA3 transcripts in non-transformed bone marrow samples (Figs S2a and b). Notably, the TKI-mediated increase in ABCA3 expression occurred in cultures supported by stroma cell micromilieu, indicating that this regulation is effective under conditions mimicking the bone marrow niche. Thus, BCR-ABL1 expression is associated with increased ABCA3 expression, and targeting BCR-ABL1 with TKI enhances transporter expression in leukaemic and non-transformed haematopoietic stem cells, increasing the detoxification effects mediated by this transporter.

image

Figure 2. Exposure to tyrosine kinase inhibitors induces expression of ABCA3. ABCA3 transcript levels were measured by qRT-PCR in peripheral blood samples from patients at different stages of CML disease (BC-blast crisis, AP-accelerated phase, CP-chronic phase, CR-haematological complete remission under imatinib therapy), as well as from samples of normal bone marrow (BM), normal peripheral blood (PB) and PB from patients with gastrointestinal stroma tumours (GIST) (A). ABCA3 transcripts were normalized to ACTB transcripts, and expressed relative to transcript levels in leukaemia cell line HL60 with the value of 1. Compared to the situation of disease- and treatment-free haematopoietic tissues (BM, PB), ABCA3 levels were significantly elevated in the situation of untreated CML (BC, AP, CP), and in CML patients in complete haematological remission receiving imatinib treatment (CR; one-way anova Kruskal–Wallis test with Dunn post-test). Transcript levels for ABCA3 were measured by qRT-PCR in BV173, K562 and LAMA84 cells by qRT-PCR following exposure to imatinib, dasatinib and nilotinib at the respective effective concentration (EC50 at 24 h). TKI treatment induced the expression of ABCA3 in all cell lines (B, unpaired two-tailed t-test), as confirmed at the protein level by Western blot (C). Purified CD34 positive cells from bone marrow from patients with untreated CML were seeded on murine OP9 mesenchymal feeder cells, and exposed to 2 μmol/l imatinib, nilotinib and dasatinib (D). ABCA3 transcripts were measured following 48 h continuous exposure to TKI. Similarly to the situation in the leukaemic cell lines, TKI exposure increased ABCA3 expression (d, unpaired two-tailed t-test).

Download figure to PowerPoint

SALL4 regulates ABCA3 expression

Given the induction of TKI-mediated ABCA3 expression and its consequences for leukaemia cell resistance to TKI-based therapy, we focused on the regulation of ABCA3 expression. Jeong et al (2011) recently documented binding of the transcription factor SALL4 to the ABCA3 promoter, resulting in increased ABCA3 expression and resistance to anthracyclins in AML. Therefore, we evaluated the transcript levels of SALL4 and ABCA3 in a cohort of patients with untreated CML. The abundances of ABCA3 transcript correlated significantly with the transcript abundances of SALL4 in this cohort (r = 0·9222, P < 0·0001; Fig 3A). This observation was mirrored at the protein level, where we detected co-expression of nuclear SALL4 and cytoplasmic ABCA3 in our cell line models as well as in the leukaemic cells from CML patients (Figs 3B and C). Similarly to ABCA3, we also detected elevated SALL4 transcript levels in the peripheral blood (PB) of patients receiving imatinib therapy (Fig 3D). These findings were supported by findings in vitro, where exposure of normal primary CD34 positive cells to 2 μmol/l imatinib led to significant increases of both ABCA3 and SALL4 transcripts (Figs S1a and S1b). ShRNA-mediated silencing of SALL4 led to a significant reduction in ABCA3 expression in the K562, BV173, and LAMA84 model cell lines (Fig 4; Fig S2). The reduction of ABCA3 expression secondary to loss of SALL4 expression was associated with increased susceptibility to imatinib, dasatinib and nilotinib, yet not as efficient as direct silencing of ABCA3 (Fig S3). Importantly, silencing of SALL4 also diminished, but did not completely abolish, the increased expression of ABCA3 secondary to TKI exposure (Fig 5A). Taken together, our observations suggest that SALL4 is a critical regulator of ABCA3 expression and function in CML cells, coupling its roles in gene expression in early haematopoietic progenitor cells to ABCA3-associated TKI resistance.

image

Figure 3. Transcript levels of ABCA3 correlate to the expression of transcription factor SALL4. Transcript levels of ABCA3 and SALL4 were measured by qRT-PCR in PB and BM samples of patients with untreated CML, normalized to housekeeping gene expression, and corresponding transcript abundances visualized for each patient (a, n = 28). The expression levels correlated at an ABCA3/SALL4 coefficient of 0·9222 (A, two-tailed Pearson Correlation, P < 0·0001). Coexpression of cytoplasmatic ABCA3 and nuclear SALL4 expression were documented by immunofluorescence staining and confocal microscopy in cell line K562 (B) and whole bone marrow cells from a patient with untreated CML (C). SALL4 transcript levels were also measured by RT-PCR in peripheral blood and bone marrow from patients with CML treated with imatinib. In patients receiving imatinib, SALL4 transcript levels were found significantly elevated compared to untreated controls (D, one-way anova Kruskal–Wallis test with Dunn post-test).

Download figure to PowerPoint

image

Figure 4. Loss of ABCA3 expression through suppression of SALL4 transcription. SALL4 expression levels were silenced by lentiviral shSALL4 constructs in cells of the cell lines BV173, K562, and LAM84 (Fig S7), leading to reductions in ABCA3 expression measured by qRT-PCR and western blot (third columns, unpaired two tailed t-test). Ectopic expression of ABCA3 in shSALL4-variants of the cell lines restored ABCA3 transcript levels (fourth columns). Expression in wild-type (wt) cells as controls is shown in the first column).

Download figure to PowerPoint

image

Figure 5. Suppression of SALL4 partially abrogates TKI-associated increase in ABCA3 expression and schematic overview. Cells transduced either with SALL4 silencing construct or mock control were exposed for 24 h–2 μmol/l TKI as indicated (IM-imatinib, NI-nilotinib, DA-dasatinib) or inbibitors (IN-indomethacin, RA-rapamycin), and ABCA3 transcript levels were measured by RT-PCR (A). Compared to the strong increase in ABCA3 levels measured in the controls (grey columns), the increase in ABCA3 expression levels associated with TKI exposure was lower in the variants with SALL4 suppression (black columns). Both indomethacin and rapamycin blocked the increase in ABCA3 expression (far right grey and black columns). Schematically, TKI therapy leads to increased expression of SALL4 in a subset of CML cells, which in consequence up-regulate ABCA3. High ABCA3 levels facilitate detoxification of TKI, protecting such leukaemic stem cells against TKI effects (B). While eliminating most cells of the CML clone, activation of the SALL4/ABCA3 pathway by TKI protects CML stem cells from the lytic activity of the TKI (C). The inducible SALL4/ABCA3 pathway of CML stem cell stabilization can be interrupted by agents such as indomethacin (compare Fig S7).

Download figure to PowerPoint

Indomethacin inhibits ABCA3 expression

The impact of ABCA3 function on TKI susceptibility motivated us investigate regulators of ABCA3 expression, with the goal of interrupting the increase in transporter expression under imatinib exposure. In aggressive lymphoma, we recently demonstrated the interference with ABCA3 expression and function by small molecules, such as the COX2 inhibitor indomethacin (Aung et al, 2011). Exposure of the model cell lines to indomethacin led to a reduction in ABCA3 and, to a lesser degree, SALL4 transcript levels (Fig 5 and Fig S4). Cells exposed to the combination of indomethacin and TKI in viability assays exhibited significantly increased susceptibility to TKI (Fig S5). Of note, the combination of interferon gamma with TKI did not alter the cytotoxic efficacy in our cell line models (Fig S6). Thus indomethacin interferes with the self-induced ABCA3-mediated resistance mechanisms against TKI, suggesting that the combination potentiates the cytotoxic efficacy of TKI therapy (Fig 5B).

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Authorship and disclosures
  9. References
  10. Supporting Information

CML is a disease of the haematopoietic stem cell, and although specific inhibitors readily induce complete haematological and cytogenetic remission in most chronic-phase patients, evidence for persistent leukaemic cells has been observed in the majority of cases (Bhatia et al, 2003; Chu et al, 2011). The leukaemic cells resisting TKI are quiescent in nature, possess multiple cell biological features for innate TKI resistance, and may eventually give rise to relapse upon treatment cessation (Holyoake et al, 1999; Graham et al, 2002; Mahon et al, 2010). Here, we found that exposure to currently available TKI induces the increased expression of the resistance-mediating transporter ABCA3, together with one of its main regulators, the stem cell transcription factor SALL4. Thus, in leukaemic cells with an intrinsic, a priori-activated ABCA3/SALL4-based resistance mechanism, TKI sustains and strengthens this protective propensity, ultimately contributing to the persistence of such cells. These data are in agreement with reports on the expression and function of SALL4 in leukaemia. SALL4, which had been originally been described as a key regulator of the maintenance and self-renewal of embryonic stem cells, was recently found to be highly expressed in the blast cells of AML and CML (Yang et al, 2008; Lu et al, 2011). The expression of SALL4 was associated with increased proliferative capacity and reduced apoptosis of the leukaemic cells, and with drug resistance through expression of ABCA3 in AML blast cells (Yang et al, 2008; Jeong et al, 2011). Functionally, enhanced expression of the transporter protein originated from transcriptional regulation by SALL4, which binds the ABCA3 promoter and modulates the intra-leukaemic proportion of leukaemic side population cells (Jeong et al, 2011).

This finding may have several implications for the pathobiology and potential clinical management of CML. TKI-mediated stabilization of stem cell features in leukaemic progenitors may challenge assumptions in systems biology approaches to CML stem cell eradication. Current models assume quiescence in leukaemic progenitor subsets in which cells are inert to TKI, but undergo – stochastically and at a certain rate – proliferative activation and differentiation, rendering such cells susceptible to TKI again (Roeder et al, 2006; Horn et al, 2008). These models are in accordance with the clinical observation of a biphasic decline in the detection of BCR-ABL1 transcripts, as well as the rapid relapse that follows cessation of imatinib treatment (Roeder et al, 2006). Our findings here, however, suggest that TKI consolidates CML stem cells in their primitive state, slowing the transition to the susceptible state. The mechanism of the TKI-mediated, leukaemia-initiating cell persistence presented here provides additional information as to why, under continuous TKI, an initial rapid elimination of susceptible cells is followed by a very prolonged elimination phase (if at all) of all CML progenitor cells. We speculate that the second phase of CML decline may be significantly shortened by targeted interference of the ABCA3/SALL4 pathway.

While documenting the pivotal role of SALL4 in ABCA3 expression, we observed that increased ABCA3 expression under TKI also occurred under conditions of SALL4 silencing. Therefore transcriptional regulators other than SALL4 may also be involved in the TKI-responsive surge in ABCA3 expression. Promoter sequence analysis predicts the involvement of a set of transcription factors in the regulation of ABCA3 expression (Besnard et al, 2007; Fernández de Mattos et al, 2004; Jeong et al, 2011). Thus, we expect SALL4 and additional transcription factors to contribute to a network of regulators in ABCA3-mediated and other TKI-mediated resistance mechanisms, including the transcription factor FOXO3 (Fernández de Mattos et al, 2004). We have focused here on ABCA3 as a leukaemia stem cell-associated ABC transporter. For completeness, we also examined other transporters described to be involved in TKI resistance, such as ABCG2 and ABCB1 (Burger et al, 2004; Houghton et al, 2004; Nakanishi et al, 2006; Davies et al, 2009; Hiwase et al, 2010; Dohse et al, 2010), and we found no relevant changes in transcript abundances (data not shown). Importantly, the regulatory mechanisms described here are not directly connected to BCR-ABL1 function. We observed that the TKI-induced increase in ABCA3 expression occurred in BCR-ABL1 positive leukaemic cells following exposure to imatinib, as wells as in peripheral blood cells of patients with GIST in vivo and in non-transformed CD34 positive haematopoietic stem cells in vitro. We speculate that the three tyrosine kinase inhibitors tested here share kinase targets beyond BCR-ABL1, with SALL4 and/or ABCA3 as downstream targets of positive regulation. The SALL4/ABCA3 axis is preferentially active in CD34 positive progenitors, thus meeting the criteria for BCR-ABL1 independent TKI resistance mechanism intrinsic to CML stem cells, for which experimental and clinical evidences have been recently reported (Corbin et al, 2011; Hamilton et al, 2011).

Our findings suggest that interfering with the SALL4/ABCA3 pathway may be of clinical benefit, and may contribute to the current search for adjunctive agents to TKI aimed at the definitive eradication of persistent leukaemic cells (Heaney et al, 2010; Zhang et al, 2010; Preudhomme et al, 2010). Pharmacological interference with SALL4 or ABCA3 should restore TKI susceptibility not only in vitro as documented here, but also in the clinical setting. Indomethacin might be a candidate substance for this purpose, as it was previously reported to exert anti-proliferative and pro-apoptotic effects of its own, in association with the inhibition of STATs/ BCL2L1[Bcl-X(L)] signal transduction pathway components (Zhang & Fu, 2006). It remains to be shown how the effects of indomethacin on ABCA3 and SALL4 transcription contribute to the overall effects of treatment. Interferon gamma had no impact on SALL4 or ABCA3 expression and function and thus did not interfere with the resistance mechanisms analysed here. Interferon gamma may, however, still be an effective synergistic agent based on its well-established immunomodulatory properties (Preudhomme et al, 2010).

In conclusion, while abrogating the major leukaemia cell mass, TKI sustains an autoprotective loop of SALL4 and ABCA3 cooperation in resistant leukaemia cell subsets. Interference with this mechanism may be developed into a strategy to increase the efficacy of TKI, eventually eliminating CML.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Authorship and disclosures
  9. References
  10. Supporting Information

We thank Sabrina Becker of the flow cytometry core facility at the University of Goettingen. Financial support for this research was provided to GW from the Deutsche Krebshilfe (DKH 108727) and Deutsche Forschungsgemeinschaft (DFG Wu310/3-1).

Authorship and disclosures

  1. Top of page
  2. Summary
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Authorship and disclosures
  9. References
  10. Supporting Information

T.H. designed and performed research, analysed data and wrote part of the paper; R.K., M.B., C.V. and V.S, performed research; B.C. and S.C. performed research, provided essentials reagents and contribute essential discussion; P.L., D.H. and L.T. contributed support and detailed discussions; G.G.W. designed research, analysed data and wrote the paper. We declare that none of the authors have any financial interest related to this work.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Authorship and disclosures
  9. References
  10. Supporting Information
  • Aung, T., Chapuy, B., Vogel, D., Wenzel, D., Oppermann, M., Lahmann, M., Weinhage, T., Menck, K., Hupfeld, T., Koch, R., Trümper, L., Wulf, G.G., Lahmann, M., et al (2011) Exosomal evasion of humoral immunotherapy in aggressive B-cell lymphoma modulated by ATP-binding cassette transporter A3. Proc Natl Acad Sci U S A, 108, 1533615341.
  • Avanzi, G.C., Lista, P., Giovinazzo, B., Miniero, R., Saglio, G., Benetton, G., Coda, R., Cattoretti, G. & Pegoraro, L. (1988) Selective growth response to IL-3 of a human leukaemic cell line with megakaryoblastic features. British Journal of Haematology, 69, 359366.
  • Besnard, V., Xu, Y. & Whitsett, J.A. (2007) Sterol response element binding protein and thyroid transcription factor-1 (Nkx2.1) regulate Abca3 gene expression. Am J Physiol Lung Cell Mol Physiol, 293, L1395L1405.
  • Bhatia, R., Holtz, M., Niu, N., Gray, R., Snyder, D.S., Sawyers, C.L., Arber, D.A., Slovak, M.L., Forman, S.J., et al (2003) Persistence of malignant haematopoietic progenitors in chronic myelogenous leukaemia patients in complete cytogenetic remission following imatinib mesylate treatment. Blood, 101, 47014707.
  • Burger, H., van Tol, H., Boersma, A.W., Brok, M., Wiemer, E.A., Stoter, G., Nooter, K., et al (2004) Imatinib mesylate (STI571) is a substrate for the breast cancer resistance protein (BCRP)/ABCG2 drug pump. Blood, 104, 29402942.
  • Chapuy, B., Koch, R., Radunski, U., Corsham, S., Cheong, N., Inagaki, N., Ban, N., Wenzel, D., Reinhardt, D., Zapf, A., Schweyer, S., Klapper, W., Truemper, L., Wulf, G.G., et al (2008) Intracellular ABC transporter A3 confers multidrug resistance in leukaemia cells by lysosomal drug sequestration. Leukaemia, 22, 15761586.
  • Chu, S., Xu, H., Shah, N.P., Snyder, D.S., Forman, S.J., Sawyers, C.L. & Bhatia, R. (2005) Detection of BCR-ABL kinase mutations in CD34+ cells from chronic myelogenous leukaemia patients in complete cytogenetic remission on imatinib mesylate treatment. Blood, 105, 20932098.
  • Chu, S., McDonald, T., Lin, A., Chakraborty, S., Huang, Q., Snyder, D.S., Bhatia, R., et al (2011) Persistence of leukaemia stem cells in chronic myelogenous leukaemia patients in prolonged remission with imatinib treatment. Blood, 118, 55655572.
  • Corbin, A.S., Agarwal, A., Loriaux, M., Cortes, J., Deininger, M.W. & Druker, B.J. (2011) Human chronic myeloid leukaemia stem cells are insensitive to imatinib despite inhibition of BCR-ABL activity. J Clin Invest, 121, 396409.
  • Cortes, J., O'Brien, S. & Kantarjian, H. (2004) Discontinuation of imatinib therapy after achieving a molecular response. Blood, 104, 22042205.
  • Davies, A., Jordanides, N.E., Giannoudis, A., Lucas, C.M., Hatziieremia, S., Harris, R.J., Jørgensen, H.G., Holyoake, T.L., Pirmohamed, M., Clark, R.E., Mountford, J.C., Harris, R.J., et al (2009) Nilotinib concentration in cell lines and primary CD34(+) chronic myeloid leukaemia cells is not mediated by active uptake or efflux by major drug transporters. Leukaemia, 23, 19992006.
  • Denizot, F. & Lang, R. (1986) Rapid colorimetric assay for cell growth and survival. Modifications to the tetrazolium dye procedure giving improved sensitivity and reliability. Journal of Immunological Methods, 89, 271277.
  • Dohse, M., Scharenberg, C., Shukla, S., Robey, R.W., Wolmann, T., Deeken, J.F., Brendel, C., Ambudkar, S.V., Neubauer, A., Bates, S.E., Deeken, J.F., et al (2010) Comparison of ATP-binding cassette transporter interactions with the tyrosine kinase inhibitors imatinib, nilotinib, and dasatinib. Drug Metabolism and Disposition, 38, 13711380.
  • Druker, B.J., Guilhot, F., O'Brien, S.G., Gathmann, I., Kantarjian, H., Gattermann, N., Deininger, M.W., Silver, R.T., Goldman, J.M., Stone, R.M., Cervantes, F., Hochhaus, A., Powell, B.L., Gabrilove, J.L., Rousselot, P., Reiffers, J., Cornelissen, J.J., Hughes, T., Agis, H., Fischer, T., Verhoef, G., Shepherd, J., Saglio, G., Gratwohl, A., Nielsen, J.L., Radich, J.P., Simonsson, B., Taylor, K., Baccarani, M., So, C., Letvak, L., Larson, R.A., et al (2006) Five-year follow-up of patients receiving imatinib for chronic myeloid leukaemia. N Engl J Med, 355, 24082417.
  • Fernández de Mattos, S., Essafi, A., Soeiro, I., Pietersen, A.M., Birkenkamp, K.U., Edwards, C.S., Martino, A., Nelson, B.H., Francis, J.M., Jones, M.C., Brosens, J.J., Coffer, P.J., Lam, E.W., Fernandez de, M.S., Essafi, A., Soeiro, I., Pietersen, A.M., Birkenkamp, K.U., Edwards, C.S., et al (2004) FoxO3a and BCR-ABL regulate cyclin D2 transcription through a STAT5/BCL6-dependent mechanism. Mol Cell Biol, 24, 1005810071.
  • Gorre, M.E., Mohammed, M., Ellwood, K., Hsu, N., Paquette, R., Rao, P.N., Sawyers, C.L., et al (2001) Clinical resistance to STI-571 cancer therapy caused by BCR-ABL gene mutation or amplification. Science, 293, 876880.
  • Graham, S.M., Jorgensen, H.G., Allan, E., Pearson, C., Alcorn, M.J., Richmond, L., Holyoake, T.L., et al (2002) Primitive, quiescent, Philadelphia-positive stem cells from patients with chronic myeloid leukaemia are insensitive to STI571 in vitro. Blood, 99, 319325.
  • Hamilton, A., Helgason, G.V., Schemionek, M., Zhang, B., Myssina, S., Allan, E.K., Nicolini, F.E., Müller-Tidow, C., Bhatia, R., Brunton, V.G., Koschmieder, S., Holyoake, T.L., et al (2011) Chronic myeloid leukaemia stem cells are not dependent on Bcr-Abl kinase activity for their survival. Blood, 119, 15011510.
  • Heaney, N.B., Pellicano, F., Zhang, B., Crawford, L., Chu, S., Kazmi, S.M., Allan, E.K., Jorgensen, H.G., Irvine, A.E., Bhatia, R., Holyoake, T.L., et al (2010) Bortezomib induces apoptosis in primitive chronic myeloid leukaemia cells including LTC-IC and NOD/SCID repopulating cells. Blood, 115, 22412250.
  • Hiwase, D.K., White, D.L., Powell, J.A., Saunders, V.A., Zrim, S.A., Frede, A.K., Guthridge, M.A., Lopez, A.F., D'Andrea, R.J., To, L.B., Melo, J.V., Kumar, S., Hughes, T.P., et al (2010) Blocking cytokine signaling along with intense Bcr-Abl kinase inhibition induces apoptosis in primary CML progenitors. Leukaemia, 24, 771778.
  • Holyoake, T., Jiang, X., Eaves, C. & Eaves, A. (1999) Isolation of a highly quiescent subpopulation of primitive leukaemic cells in chronic myeloid leukaemia. Blood, 94, 20562064.
  • Horn, M., Loeffler, M. & Roeder, I. (2008) Mathematical modeling of genesis and treatment of chronic myeloid leukaemia. Cells Tissues Organs, 188, 236247.
  • Houghton, P.J., Germain, G.S., Harwood, F.C., Schuetz, J.D., Stewart, C.F., Buchdunger, E., Traxler, P., et al (2004) Imatinib mesylate is a potent inhibitor of the ABCG2 (BCRP) transporter and reverses resistance to topotecan and SN-38 in vitro. Cancer Research, 64, 23332337.
  • Jeong, H.W., Cui, W., Yang, Y., Lu, J., He, J., Li, A., Song, D., Guo, Y., Liu, B.H., Chai, L., et al (2011) SALL4, a stem cell factor, affects the side population by regulation of the ATP-binding cassette drug transport genes. PLoS One, 6, e1837.
  • Kantarjian, H., Shah, N.P., Hochhaus, A., Cortes, J., Shah, S., Ayala, M., Moiraghi, B., Shen, Z., Mayer, J., Pasquini, R., Nakamae, H., Huguet, F., Boqué, C., Chuah, C., Bleickardt, E., Bradley-Garelik, M.B., Zhu, C., Szatrowski, T., Shapiro, D., Baccarani, M., et al (2010) Dasatinib versus imatinib in newly diagnosed chronic-phase chronic myeloid leukaemia. N Engl J Med, 362, 22602270.
  • Lu, J., Ma, Y., Kong, N., Alipio, Z., Gao, C., Krause, D.S., Silberstein, L.E., Chai, L., et al (2011) Dissecting the role of SALL4, a newly identified stem cell factor, in chronic myelogenous leukaemia. Leukaemia, 25, 12111213.
  • Ma, Y., Cui, W., Yang, J., Qu, J., Di, C., Amin, H.M., Lai, R., Ritz, J., Krause, D.S., Chai, L., et al (2006) SALL4, a novel oncogene, is constitutively expressed in human acute myeloid leukaemia (AML) and induces AML in transgenic mice. Blood, 108, 27262735.
  • Mahon, F.X., Réa, D., Guilhot, J., Guilhot, F., Huguet, F., Nicolini, F., Legros, L., Charbonnier, A., Guerci, A., Varet, B., Etienne, G., Reiffers, J., Rousselot, P., et al (2010) Discontinuation of imatinib in patients with chronic myeloid leukaemia who have maintained complete molecular remission for at least 2 years: the prospective, multicentre Stop Imatinib (STIM) trial. Lancet Oncol, 11, 10291035.
  • Nakanishi, T., Shiozawa, K., Hassel, B.A. & Ross, D.D. (2006) Complex interaction of BCRP/ABCG2 and imatinib in BCR-ABL-expressing cells: BCRP-mediated resistance to imatinib is attenuated by imatinib-induced reduction of BCRP expression. Blood, 108, 678684.
  • Preudhomme, C., Guilhot, J., Nicolini, F.E., Guerci-Bresler, A., Rigal-Huguet, F., Maloisel, F., Coiteux, V., Gardembas, M., Berthou, C., Vekhoff, A., Rea, D., Jourdan, E., Allard, C., Delmer, A., Rousselot, P., Legros, L., Berger, M., Corm, S., Etienne, G., Roche-Lestienne, C., Eclache, V., Mahon, F.X., Guilhot FPreudhomme, C., Guilhot, J., Nicolini, F.E., Guerci-Bresler, A., Rigal-Huguet, F., Maloisel, F., et al (2010) Imatinib plus peginterferon alfa-2a in chronic myeloid leukaemia. N Engl J Med, 363, 25112521.
  • Roeder, I., Horn, M., Glauche, I., Hochaus, A., Mueller, M.C. & Loeffler, M. (2006) Dynamic modeling of imatinib-treated chronic myeloid leukaemia: functional insights and clinical implications. Nat Med, 12, 11811184.
  • Saglio, G., Kim, D.W., Issaragrisil, S., le Coutre, P., Etienne, G., Lobo, C., Pasquini, R., Clark, R.E., Hochhaus, A., Hughes, T.P., Gallagher, N., Hoenekopp, A., Dong, M., Haque, A., Larson, R.A., Kantarjian HMSaglio, G., Kim, D.W., Issaragrisil, S., Le Coutre, P., Etienne, G., Lobo, C., et al (2010) Nilotinib versus imatinib for newly diagnosed chronic myeloid leukaemia. N Engl J Med, 362, 22512259.
  • Shulenin, S., Nogee, L.M., Annilo, T., Wert, S.E., Whitsett, J.A. & Dean, M. (2004) ABCA3 gene mutations in newborns with fatal surfactant deficiency. N Engl J Med, 350, 12961303.
  • Wulf, G.G., Wang, R.Y., Kuehnle, I., Weidner, D., Marini, F., Brenner, M.K., Andreeff, M. & Goodell, M.A. (2001) A leukaemic stem cell with intrinsic drug efflux capacity in acute myeloid leukaemia. Blood, 98, 11661173.
  • Wulf, G.G., Modlich, S., Inagaki, N., Reinhardt, D., Schroers, R., Griesinger, F., Trumper, L., et al (2004) ABC transporter ABCA3 is expressed in acute myeloid leukaemia blast cells and participates in vesicular transport. Haematologica, 89, 13951397.
  • Yang, J., Chai, L., Gao, C., Fowles, T.C., Alipio, Z., Dang, H., Xu, D., Fink, L.M., Ward, D.C., Ma, Y., et al (2008) Genome-wide analysis reveals Sall4 to be a major regulator of pluripotency in murine-embryonic stem cells. Proc Natl Acad Sci U S A, 105, 1975619761.
  • Yang, J., Gao, C., Chai, L. & Ma, Y. (2010) A novel SALL4/OCT4 transcriptional feedback network for pluripotency of embryonic stem cells. PLoS One, 5, e10766.
  • Zhang, G. & Fu, Y. (2006) Antiproliferative effect of indomethacin on CML cells is related to the suppression of STATs/Bcl-XL signal pathway. Ann Hematol, 85, 443449.
  • Zhang, B., Strauss, A.C., Chu, S., Li, M., Ho, Y., Shiang, K.D., Snyder, D.S., Huettner, C.S., Shultz, L., Holyoake, T., Bhatia, R., et al (2010) Effective targeting of quiescent chronic myelogenous leukaemia stem cells by histone deacetylase inhibitors in combination with imatinib mesylate. Cancer Cell, 17, 427442.

Supporting Information

  1. Top of page
  2. Summary
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Authorship and disclosures
  9. References
  10. Supporting Information
FilenameFormatSizeDescription
bjh12246-sup-0001-FigS1-S7.docWord document178K

Fig S1. Enforced BCR-ABL expression is associated with ABCA3 expression, and ABCA3 transcripts arise from viable cells in from bcr-abl positive cell lines exposed to imatinib.

Fig S2. Silencing of SALL4 expression in BCR-ABL positive cell lines.

Fig S3. Silencing of SALL4 increases susceptibility of cell lines to cytotoxicity of tyrosine kinase inhibition.

Fig S4. Treatment with indomethacin reduces ABCA3 and SALL4 transcription.

Fig S5. Treatment with indomethacin sensitizes BCR-ABL positive cell lines to the cytotoxic effects of tyrosine kinase inhibition with imatinib, dasatinib and nilotinib.

Fig S6. Treatment with interferon gamma does not interfere with the cytotoxic effects of tyrosine kinase inhibition in BCR-ABL positive cell lines to.

Fig S7. Expression of ABCA3 in non-transformed hematopoietic cells, naive and under exposure to imatinib.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.