SEARCH

SEARCH BY CITATION

Keywords:

  • multiple myeloma;
  • haematology;
  • signalling;
  • cancer;
  • oncogenes

Summary

  1. Top of page
  2. Summary
  3. Design and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. Author contributions
  8. References
  9. Supporting Information

Constitutive phosphatidylinositide 3-kinase (PI3K) signalling has been implicated in multiple myeloma (MM) pathophysiology and is regarded as an actionable target for pharmacological intervention. Isoform-specific PI3K inhibition may offer the most focused treatment approach and could result in greater clinical efficacy and reduced side effects. We therefore performed isoform-specific knockdown of PIK3CA, PIK3CB, PIK3CD, and PIK3CG to analyse their individual contributions to MM cell survival and downstream signalling. In addition, we tested the effectivity of the novel PI3K isoform-specific inhibitors BYL-719 (PIK3CA), TGX-221 (PIK3CB), CAL-101 (PIK3CD), and CAY10505 (PIK3CG). We found the PIK3CA isoform to be of paramount importance for constitutive Akt activity in MM cells, and – in contrast to inhibition of other class I isoforms – only the blockade of PIK3CA was sufficient to induce cell death in a sizeable subgroup of MM samples. Furthermore, pharmacological PIK3CA inhibition in combination treatments of BYL-719 and established anti-myeloma agents resulted in strongly enhanced MM cell death. Our data thus clearly indicate therapeutic potential of PIK3CA inhibitors and support their clinical evaluation in multiple myeloma.

Multiple myeloma (MM) is an age-related incurable plasma cell cancer primarily located in the bone marrow. As the second most frequent haematological malignancy it is diagnosed in more than 40 000 patients per year in Western countries (Ferlay et al, 2013; Siegel et al, 2013), and due to aging populations its prevalence is expected to increase (Palumbo et al, 2011; Morgan et al, 2012). Over the past decade, significant advances in treatment options and patient outcome have been achieved with the introduction of proteasome inhibitors and immunomodulatory drugs (Palumbo & Anderson, 2011; Ludwig & Sonneveld, 2012; Kumar et al, 2013; Usmani et al, 2013). However, targeted molecular therapies against oncogenic drivers, which have been developed for the treatment of certain solid tumours and leukaemias have not yet been forthcoming for MM. Indeed, while advanced sequencing projects have now provided unprecedented insights into MM genetics and potential tumour-specific molecular targets, they have also highlighted the impressive molecular heterogeneity underlying this disease (Chapman et al, 2011; Chesi & Bergsagel, 2011; Kuehl & Bergsagel, 2012; Morgan et al, 2012; Leich et al, 2013). A thorough characterization of promising molecular targets for MM subgroups and the development of appropriate inhibitors for beneficial combination treatments are therefore required.

The multi-functional class I phosphatidylinositide 3-kinases (PI3Ks) represent a major hub for the regulation of cell growth and survival, relaying cell surface receptor signals to intracellular signalling cascades (Downward, 2004; Pollak, 2012). Upon activation, PI3Ks catalyse the generation of phosphoinositol lipid substrates which act as second messengers for downstream signalling effector proteins. PI3Ks are classified according to their catalytic isoforms as class IA (PIK3CA, PIK3CB, PIK3CD) and class IB (PIK3CG) (reviewed in Vanhaesebroeck et al, 2010), and their illegitimate activation has been implicated in a variety of cancers, including MM (Vivanco & Sawyers, 2002; Wetzker & Rommel, 2004; Bartholomeusz & Gonzalez-Angulo, 2012). However, genetic lesions that directly affect genes for PI3K isoforms do not occur in MM (Müller et al, 2007; Ismail et al, 2009; Chapman et al, 2011; Leich et al, 2013), although oncogenic signalling via the PI3K/Akt axis is a prominent feature in MM cells (Hsu et al, 2001; Zöllinger et al, 2008; Baumann et al, 2009; Steinbrunn et al, 2011; Ramakrishnan et al, 2012; Munugalavadla et al, 2014). Inhibition of PI3K activity may therefore represent a promising therapeutic strategy to target the disease in a large subgroup of MM patients, and we and others have previously demonstrated that abrogation of PI3K-dependent signalling impairs MM cell survival (Hsu et al, 2001; Pene et al, 2002; Zöllinger et al, 2008; Steinbrunn et al, 2011, 2012; Stengel et al, 2012; De et al, 2013; Azab et al, 2014; Munugalavadla et al, 2014). With the development of novel isoform-specific PI3K inhibitors, more selective targeting of the relevant isoforms has become possible, potentially permitting enhanced anti-tumour activity and a reduction of off-target effects. The aim of our study was therefore to assess the individual contributions of the PI3K isoforms to oncogenic signalling by PI3K in MM and their relevance for the survival of MM cells. We provide evidence that PIK3CA is the major mediator of PI3K-dependent effects in MM and that it should represent the foremost target for pharmacological PI3K isoform blockade. Moreover, combinations of the PIK3CA-specific inhibitor BYL-719 (Furet et al, 2013) with clinically established anti-MM drugs show synergistic modes of action arguing in favor of initiating clinical trials with PIK3CA inhibitors in this disease.

Design and methods

  1. Top of page
  2. Summary
  3. Design and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. Author contributions
  8. References
  9. Supporting Information

Cell culture

MM cell lines were purchased from the German Collection of Microorganisms and Cell Cultures (DSMZ, Braunschweig, Germany), except for MM.1S (LGC Biolabs, Wesel, Germany, ATCC-CRL-2974) and INA-6 (kindly provided by Martin Gramatzki, Kiel, Germany). Cell lines were cultured in RPMI-1640 medium, supplemented with 10% fetal bovine serum (PAA Laboratories, Cölbe, Germany), 2 mmol/l L-glutamine, 1 mmol/l Na-pyruvate, 100 U/ml penicillin, and 100 μg/ml streptomycin (PAN-Biotech, Aidenbach, Germany) at 37°C and 5% CO2. The medium for INA-6 cells was supplemented with 2 ng/ml of recombinant human interleukin-6. Every 3–4 months MM cell line cultures were freshly reconstituted from frozen aliquots of stock/working banks established from the originally purchased cell line sample. Testing for mycoplasma was regularly performed. Primary MM cells and bone marrow stromal cells (BMSCs) were obtained from bone marrow aspirates of MM patients after informed consent (for details see Stühmer et al, 2010). Permission was granted by the Ethics Committee of the Medical Faculty of the University of Würzburg, Germany (reference number 76/13).

Incubation with drugs

Up to 5 × 104 cells/100 μl of medium per well were seeded in 96-well-plates. Primary MM cells were always seeded into wells containing primary bone marrow stromal cells. Drugs were dissolved in either dimethylsulfoxide (DMSO) or acidified ethanol (in the case of melphalan) and kept as frozen stock solutions of 10–50 mmol/l. Working dilutions in full-medium were always freshly prepared. In the case of bortezomib small volumes of single-thaw stock solution aliquots were prepared. Drug dilutions were added to MM cells as 100 μl of 2× the final concentration per well for single-drug treatments, and in appropriate volumes of higher concentrations for drug combinations. Solvent controls were always included. BYL-719 was obtained from Active Biochem (Bonn, Germany), TGX-221, CAL-101, CAY10505, carfilzomib, lenalidomide and pomalidomide were purchased from Selleck Chemicals (Houston, TX, USA). Bortezomib was obtained from LC Laboratories (Woburn, MA, USA), melphalan from Sigma-Aldrich (Deisenhofen, Germany), and dexamethasone from Calbiochem (Schwalbach, Germany).

Cell apoptosis and viability assays

To measure the induction of apoptosis, cells were washed with phosphate-buffered saline (PBS), stained with propidium iodide (PI) and either annexin V-fluorescein isothiocyanate (FITC) or annexin V-Promofluor647, and analysed using a FACSCanto II flow cytometer (FACSDiva software; Becton Dickinson, Heidelberg, Germany). Cell viability was analysed in a microplate reader using the alamarBlue colourimetric assay according to the manufacturer's protocol (MorphoSys, Oxford, UK). Results are presented as relative values compared to either solvent-treated controls (drug experiments) or empty pSUPER vector/scrambled siRNA controls (for siRNA experiments).

Electroporation of MM cells and isoform-specific knockdown of PI3K

MM.1S, L-363 and AMO-1 cells were transiently transfected by electroporation as previously described (Steinbrunn et al, 2011). RNAi-mediated specific knockdown of the human PI3K isoforms PIK3CA, PIK3CB, PIK3CD, and PIK3CG was performed either with pSUPER-based shRNA expression vectors (siPIK3CA, siPIK3CB) or with commercially obtained siRNA oligonucleotides (siPIK3CD, siPIK3CG). Effective concentrations used for electroporation cocktails were 20 μg/ml for shRNA expression plasmids, 3 μmol/l for individual oligonucleotide siRNAs and 2 μmol/l for commercial oligonucleotide siRNA pools. The DNA-target sequences for isoform-specific RNAi design were: siPIK3CA: GCCAGTACCTCATGGATTAG (human PIK3CA positions 1495-1514) (Irarrazabal et al, 2006), siPIK3CB: GCAAGTTCACAATTACCCA (human PIK3CB positions 183-201) (Barbieri et al, 2003), siPIK3CD: GTGAGAAATTTGAACGGTT (human PIK3CD position 3057-3075; GenomeRNAi identifier s10529) (Schmidt et al, 2013), siPIK3CG: ON-TARGETplus SMARTpool (Thermo Fisher Scientific, Schwerte, Germany, 5294, L-005274-00-0005).

Western analysis

Cell pellets were dissolved in lysis buffer (30 mmol/l Tris pH 7·0, 120 mmol/l NaCl, 10% glycerol, 1% Triton X-100) including complete protease inhibitor cocktail (1:25, 04693116001; Roche Pharma, Grenzach-Wyhlen, Germany) and phosphatase inhibitor cocktails 2 and 3 (1:50, P5726, P0044; Sigma-Aldrich). Protein concentrations were determined using a protein detection assay (500-113/-114/-115; BioRad, München, Germany) and equal quantities of protein lysates were mixed 1:1 with Laemmli buffer. Proteins were separated via sodium dodecyl sulfate/10%-polyacrylamide gel electrophoresis and subsequently blotted onto nitrocellulose membranes. The primary antibodies used were: anti-PIK3CA (no. 4249; Cell Signaling Technology, Frankfurt am Main, Germany), anti-PIK3CB (sc-7176, Santa Cruz Biotechnology, Heidelberg, Germany), anti-PIK3CD (sc-7176, Santa Cruz Biotechnology). The antibody against PIK3CG was produced in-house at the Institute of Molecular Cell Biology, Jena, Germany (Leopoldt et al, 1998). Antibodies detecting phospho-Akt (Ser473; 4058), and phospho-GSK-3β (9336) were from Cell Signaling Technology. The anti-α-tubulin antibody (03568) was from Biozol (Eching, Germany). Secondary antibodies specific for rabbit-IgG (111-036-045), mouse-IgG (115-036-003) and rat-IgG (112-036-062) were obtained from Jackson ImmunoResearch Laboratories, Newmarket, UK.

Drug combination analyses

Synergy assessments of BYL-719 and drugs relevant in MM therapy were performed along the guidelines detailed in Chou (2006). Dose effect curves for each single drug as well as for the respective combinations were generated using the alamarBlue assay in 96-well format (30 000 cells per well for L-363, 50 000 for MM.1S; three wells per concentration). The molar ratio for combination of BYL-719 with other drugs was set according to the pre-determined half maximal effective concentration (EC50) of each drug in this assay. In addition to the combination at EC50, at least six lower and four higher concentrations were also chosen [single ray – constant ratio design (Chou, 2006)]. Single-drug and combination treatments were then simultaneously performed (drug exposure for 3 d) and the results analysed with CalcuSyn software (version 2.1; Biosoft, Cambridge, UK). Only drug concentrations that resulted in effects exceeding 2% but not exceeding 98% (i.e. values that essentially determine the shape of the respective dose-effect curve) were included in the analysis and at least four values were required to represent this range. Combination experiments were only evaluated if the correlation coefficients for the three dose effect curves involved exceeded 0·95.

Statistical analysis

Statistical calculations were performed using a two-tailed Student's t-test of at least three independent experiments. At < 0·05 results were considered significant.

Results

  1. Top of page
  2. Summary
  3. Design and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. Author contributions
  8. References
  9. Supporting Information

PI3K isoforms are expressed in the majority of MM cell lines and primary MM cells

To estimate protein expression levels of the different class I PI3K isoforms in MM cell lines (n = 10) and primary MM samples (n = 8), we performed Western analyses with whole cell lysates using isoform-specific antibodies against PIK3CA, PIK3CB, PIK3CD and PIK3CG (Fig 1; see Fig 2 for an appraisal of the isoform specificity of the chosen antibodies). We found that the PIK3CA and PIK3CB isoforms were uniformly expressed in all MM cell lines and that they could also be detected in all primary MM samples, although with stronger individual variation, if differences in the α-tubulin loading control are taken into account (Fig 1B). These results are in line with recent observations (Munugalavadla et al, 2014), and thus also confirm the assessment concerning expression of PIK3CA (Ikeda et al, 2010), but suggest much broader expression of PIK3CB than shown in the latter paper. On the other hand, the PIK3CD and PIK3CG isoforms displayed pronounced differences in expression between samples, and they appeared virtually absent in some MM cell lines as well as in some primary MM samples (Fig 1). Our results confirm that PIK3CD expression is missing in a sizeable number of MM cell lines, but appeared more frequent than shown by Munugalavadla et al (2014). Similar to Ikeda et al (2010) we found this subunit expressed in most primary MM samples. Expression of PIK3CG has been described as either ‘missing’ (Munugalavadla et al, 2014) or was shown for 10/11 MM cell lines (Ikeda et al, 2010), respectively. We were unable to consistently verify the PIK3CG specificity of three commercial anti-PIK3CG antibodies in Western blots of MM cells transfected with siRNAs against this isoform (no clear staining for sc-7177 by Santa Cruz, no confirmation of PIK3CG knockdown for 5405 by Cell Signaling and 04-402 by Millipore, Schwalbach, Germany). The antibody finally chosen for this study was produced at the Institute for Molecular Cell Biology (Jena, Germany) (Leopoldt et al, 1998), which revealed a variable pattern of PIK3CG expression in MM cell lines (8/10) and primary MM samples (5/8) (Fig 1). Even though at first glance this result resembled the PIK3CG expression in MM cell lines reported by Ikeda et al (2010), any actual concordance between cell lines used in both studies appears rather coincidental (similar results for MM.1S and RPMI-8226, different results for INA-6, OPM-2 and U266).

image

Figure 1. Expression of class I PI3K isoforms in MM cells. (A) Protein expression in MM cell lines. Western blotting was performed using the same amount of total protein (as determined by the Lowry method) for each cell lysate and different blots were used for PI3K staining of each isoform. The representative α-tubulin loading control corresponds to the blot on which PIK3CA was stained. Specific and non-specific (n.s.) bands for the doublets generated by the antibodies against PIK3CB and PIK3CD are indicated (see also Fig 2A). Whereas PIK3CA and PIK3CB are rather uniformly expressed, strong differences between samples exist for PIK3CG and PIK3CD, which were hardly or not at all expressed in some MM cell lines. (B) Protein expression in primary MM cells. Pellets of 400 000–500 000 CD138-positive selected primary MM cells were lysed and the material used for a total of three Western blots. The staining of PIK3CG (mouse monoclonal antibody) was performed on the same strip on which PIK3CA (rabbit polyclonal antibody) had previously been stained. The representative α-tubulin control corresponds to the blot on which PIK3CB was stained.

Download figure to PowerPoint

image

Figure 2. Knockdown of class I PI3K isoforms in MM cells. MM cell lines L-363, MM.1S and AMO-1 were transiently transfected by electroporation. (A) Isoform-specificity of the siRNAs targeting PIK3CA (siPIK3CA), PIK3CB (siPIK3CB), PIK3CG (siPIK3CG) or PIK3CD (siPIK3CD), as well as the functionality and specificity of the antibodies used, was verified by Western blotting and extensive cross-staining (performed in cell line L-363). Staining for different PI3K isoforms was always performed on different blots, representative α-tubulin stains are shown as loading controls. (B-D) Survival of MM cells relative to transfection controls after PI3K isoform-specific knockdown as determined by annexin V/PI staining and FACS analysis up to 5 d post-transfection. Depletion of PIK3CA led to significantly impaired cell survival in cell lines L-363 and MM.1S. *P < 0·05.

Download figure to PowerPoint

PI3K isoform-specific siRNA-mediated knockdown identifies PIK3CA as mediator of MM cell survival

The major aim of our study was to determine the individual contribution of each class I PI3K isoform for PI3K-mediated MM cell survival. We initially used RNAi approaches to perform functional molecular analyses after selective knockdown of each specific PI3K isoform. Either commercial oligonucleotides or pSUPER-based shRNA expression vectors were used (see 'Design and methods' section for the target sequences and reagents eventually selected). Knockdown efficiency and isoform-specificity of the siRNAs as well as of the chosen antibodies was established and confirmed across the board using the MM cell line L-363, which expresses all four PI3K proteins (Fig 2A).

The complete analysis was performed with MM cell lines MM.1S, L-363 and AMO-1 because (i) they are efficiently transfectable by electroporation and permit isolation of strongly transfected and viable cells (Steinbrunn et al, 2011), (ii) they display good expression levels of most PI3K isoforms (although PIK3CD expression is missing in MM.1S), and (iii) MM.1S and L–363 show high constitutive levels of phospho-Akt as readout for PI3K/Akt pathway activity (of note: AMO-1 cells did not display appreciable constitutive Akt activation).

Knockdown of PIK3CA significantly reduced survival of L-363 and MM.1S cells to about 45% and 60% relative to their respective controls (Fig 2B, C), whereas this treatment had no effect on the survival of AMO-1 cells (Fig 2D). Knockdown of PIK3CB, PIK3CG or PIK3CD did not substantially impair the survival of any of these three cell lines (Fig 2B–D). The same preparations were further used to determine the consequences of single PI3K isoform knockdown on the phosphorylation levels of signalling components further downstream of PI3K, namely Akt and GSK-3β (Downward, 2004). Depletion of PIK3CA led to strong decreases of activated Akt in cell lines L-363 and MM.1S, as determined by phosphorylation levels at Ser473. Likewise, a decline in the levels of phospho-GSK-3β was noted in these cell lines. These effects were not observed for knockdown of any of the other PI3K isoforms, suggesting that PIK3CA is the major mediator of oncogenic Akt activation in these MM cell lines.

Pharmacological inhibition of PIK3CA impairs survival of MM cell lines and primary MM cells

With the development of small molecule inhibitors that specifically or predominantly target individual PI3K isoforms, knowledge about the functional relevance of the different PI3K proteins might have therapeutic implications. We therefore tested the pharmacological PI3K inhibitors BYL-719 (targeting PIK3CA), TGX-221 (PIK3CB), CAL-101 (PIK3CD), and CAY10505 (PIK3CG) on an extended panel of MM cell lines and freshly isolated primary MM samples. MM cells were drug-treated for 3 d (MM cell lines) or 5 d (primary MM cells) respectively, and survival was analysed by flow cytometry (annexin V-FITC/PI staining) (Fig 3). Treatment with the PIK3CA inhibitor BYL-719 resulted in substantial apoptosis induction in about half of the MM cell lines tested (Fig 3B), with MM.1S (EC50: 2 μmol/l), NCI-H929 (EC50: 1·1 μmol/l) and L-363 (EC50: 1·4 μmol/l) the most sensitive. AMO-1 cells, in contrast, were not substantially affected by BYL-719 treatment (Fig 3A, B), and thus mimicking the effects of PIK3CA knockdown. The inhibitors of PIK3CB, PIK3CD and PIK3CG at concentrations of up to 20 μmol/l, i.e. at doses significantly higher than required to inhibit their respective targets according to the literature (Pomel et al, 2006; Guillermet-Guibert et al, 2008; Foukas et al, 2010; Ikeda et al, 2010; Lannutti et al, 2011) did not result in relevant induction of apoptosis in any of the MM cell lines tested (Fig 3A, B). Additionally, complementing PIK3CA blockade with all other isoform-specific inhibitors (each drug at 10 μmol/l) did not lead to superior activity against either L363 or AMO-1 cells than treatment with BYL-719 alone (Fig 3C).

image

Figure 3. Pharmacological inhibition of class I PI3K isoforms in MM cells. MM cells were incubated for either 3 (cell lines) or 5 d (primary MM cells) with the small molecule inhibitors BYL-719 (targeting PIK3CA), TGX-221 (PIK3CB), CAY10505 (PIK3CG), or CAL-101 (PIK3CD). Cell survival was measured by flow cytometry after annexin V-FITC/PI staining and calculated relative (rel.) to DMSO-treated controls. (A) Exemplary dose-effect curves. (B) EC50 values for BYL-719 in MM cell lines. TGX-221, CAY10505 and CAL-101 did not significantly impair survival in any of these cell lines at concentrations of up to 20 μmol/l. (C) Pharmacological blockade of all 4 PI3K isoforms did not increase the level of cell death beyond the effects seen for the PIK3CA inhibitor alone in L-363 and AMO-1 cells. (D) Box plots showing the results of primary MM cell treatment (n = 22; in co-culture with BMSCs) with PI3K inhibitors (10 μmol/l each). BYL-719 exerted the strongest anti-myeloma effects of the four isoform-specific inhibitors. The mean survival value is indicated by a horizontal bar and the end of the whiskers show the values of the most sensitive and most resistant sample, respectively. (E) Treatment of PBMCs (n = 5) for 5 d with PI3K isoform-specific inhibitors (10 μmol/l each).

Download figure to PowerPoint

Analysis of the effects of isoform-specific PI3K blockade on the phosphorylation levels of Akt and GSK-3β after 24 h incubation with 10 μmol/l of the respective inhibitors showed that again only blockade of PIK3CA consistently and persistently abrogated the constitutive phospho-Akt signal of MM cells and entailed downregulation of phospho-GSK3β (Fig 4B and Figure S1). Although the PIK3CD inhibitor CAL-101 also voided the phospho-Akt signal in cell line L-363 at shorter incubation times (6 h), this effect was not sustained and largely abolished at longer treatments (24 h; Figure S1). This effect was not recapitulated in cell line MM.1S, where treatment with CAL-101, similar to treatment with the PIK3CB inhibitor TGX–221, actually led to temporary increases in the levels of phospho-Akt (Figure S1). Collectively, these experiments again confirmed the paramount importance of the PIK3CA subunit for sustenance of constitutive Akt activity in MM cells and for apoptosis induction of MM cells susceptible to isoform-specific PI3K blockade.

image

Figure 4. Effects of isoform-specific PI3K blockade on downstream effectors. (A) Knockdown of PIK3CA, but not of PIK3CB, PIK3CG or PIK3CD resulted in down-regulation of Akt and GSK-3β phosphorylation in MM cell lines (note: no constitutive phospho-Akt signal was detectable in AMO-1 cells). Western blotting performed with purified transfected cells up to 4 d post-transfection. (B) Only incubation with the PIK3CA inhibitor BYL-719 entailed sustained down-regulation of phospho-Akt and phospho-GSK3β signals in MM cells. Western blotting was performed with MM cells treated for 24 h with isoform-specific inhibitors (10 μmol/l).

Download figure to PowerPoint

Treatment of BMSC-co-cultured primary MM samples with the PIK3CA inhibitor BYL-719 resulted on average in significantly larger anti-survival effects than treatment with any of the other isoform-specific inhibitors (mean survival relative to DMSO-treated controls: BYL-719: 52 ± 19%, TGX-221: 74 ± 15%, CAY10505: 84 ± 14%, CAL-101: 73 ± 17%; each drug tested at 10 μmol/l) (Fig 3D). As the treatment of peripheral blood mononuclear cells (PBMCs) with these drugs yielded survival rates of between 85% and 90% only PIK3CA blockade appeared therefore relevant for apoptosis induction in a broader set of primary MM samples (Fig 3D, E).

Combination of BYL-719 with clinically established anti-MM drugs

Because our experiments identified PIK3CA as the only class I PI3K isoform whose blockade initiated cell death in at least a subset of MM, we tested BYL-719 in combination with other compounds currently being used for the treatment of MM patients. Treatment of MM.1S or L–363 cells for 3 d with BYL-719 in combination with either dexamethasone, lenalidomide or pomalidomide produced additive (lenalidomide, pomalidomide) to more than additive (dexamethasone) levels of MM cell death (Fig 5A) [note: the effects of dexamethasone, lenalidomide and pomalidomide as single drugs in in vitro MM cell culture showed very little change with rising concentrations. Using different concentrations resulted in approximately the same additional effect when combined with a specific concentration of BYL-719 (data not shown)]. As proper kill curves can be generated for the DNA-alkylating agent melphalan and the proteasome inhibitors bortezomib and carfilzomib, these drugs were chosen for formal assessment of their combination relationship with BYL-719 in MM.1S and L-363 cells according to the median effect principle of Chou & Talalay (Chou, 2006) (see 'Design and methods' for the actual experimental settings). The combination of BYL-719 with carfilzomib was additive to increasingly synergistic at higher effect levels in both cell lines, whereas the combination with bortezomib was about additive at all effect levels. The combination with melphalan was mostly additive in MM.1S, and synergistic in L-363 (Fig 5B).

image

Figure 5. Combination of PIK3CA inhibitor BYL-719 with established anti-MM drugs. (A) Fixed-concentration experiments showing essentially additive reductions of viability in the combinations of BYL-719 and either dexamethasone, lenalidomide or pomalidomide with respect to the single-drug effects in MM cell lines L-363 and MM.1S. Data are represented relative to respective DMSO-treated controls. Results from three independent experiments using the alamarBlue viability assay are shown. (B) Combination index values for the combinations of BYL-719 and either carfilzomib or melphalan are shown for three effect levels (50%, 75%, 90%) in cell lines MM.1S and L-363. The actual values, as calculated from three independent experiments (4 for BYL-719+ carfilzomib), indicate the level of inter-experimental variability. Combination index values <1 indicate synergy. The chosen ratios, based on the concentrations of the single drugs at their EC50s, were for L363: BYL-719 to melphalan = 1–10 μmol/l = 1:10; BYL-719 to bortezomib = 1000–4·2 nmol/l = 238: 1; BYL-719 to carfilzomib = 1000–4·5 nmol/l = 222:1, and for MM.1S: BYL-719 to melphalan = 0·9–6·5 μmol/l = 1:7·2; BYL-719 to bortezomib = 900–2 nmol/l = 450: 1; BYL-719 to carfilzomib = 900–2·3 nmol/l = 391:1. See 'Design and methods' section for further details.

Download figure to PowerPoint

We have previously shown that combination blockade of the PI3K/mTOR and MEK/MAPK modules in MM cells can strongly enhance cell death induction compared to single-agent treatment, and that this effect is not necessarily dependent on the presence of constitutively activated Akt (Steinbrunn et al, 2012). In keeping with a predominant role of the PIK3CA subunit in mediating survival signals in MM, this effect was replicated by the combination of BYL-719 with the allosteric MEK inhibitor PD0325901 (Figure S2A), and was also well pronounced in primary MM cells co-cultured with BMSCs (n = 11; Figure S2C). Conversely, no cell death enhancing effect was seen when TGX-221, CAL-101 or CAY10505 were combined with PD0325901 [tested for the phospho-Akt-positive cell lines L-363 and MM.1S, and for the phospho-Akt-negative cell line AMO-1 (Figure S2B and data not shown)].

Discussion

  1. Top of page
  2. Summary
  3. Design and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. Author contributions
  8. References
  9. Supporting Information

In our study, we functionally dissected the relevance of the class I PI3K isoforms for MM cell survival using RNAi-mediated specific knockdown in transiently transfected MM cells as well as isoform-specific pharmacological inhibitors. Both approaches identified the PIK3CA isoform as the principal mediator of PI3K-dependent MM cell survival – a result that was valid in PI3K isoform inhibition-sensitive MM cell lines as well as in primary MM samples. In keeping with this result was the observation that only blockade of PIK3CA – whether by RNAi or pharmacological inhibition – led to sustained abrogation of constitutively activated Akt, a major downstream effector of PI3K which has previously been identified as important mediator of MM cell survival (Hsu et al, 2001; Pene et al, 2002; Zöllinger et al, 2008; Steinbrunn et al, 2011; Munugalavadla et al, 2014). Genetic lesions of PI3K, which as point mutations or amplifications of PIK3CA have been implicated as oncogenic drivers in some PI3K-dependent solid tumours (Samuels & Waldman, 2010), have not been found in MM suggesting an indirect mode of aberrant PI3K activation, e.g. through mutated receptor tyrosine kinases upstream of PI3K (Müller et al, 2007; Ismail et al, 2009; Chapman et al, 2011; Leich et al, 2013). Within that context, our data suggest that the ubiquitously expressed PIK3CA isoform might preferentially be recruited by oncogenic receptor tyrosine kinases to mediate Akt activation and prosurvival effects in a sizeable subgroup of MM.

However, we also recognized variations on this theme. Treatment of JJN–3 and KMS–11 cells with the PIK3CA inhibitor BYL-719 blocked Akt activation (Figure S1B) but still failed to induce cell death. Nevertheless, the strong apoptotic effects in combination with MEK/MAPK blockade – even in phospho-Akt-negative AMO-1 cells – suggest broader therapeutic utility of PIK3CA inhibitors than indicated by sensitivity to blockade of this isoform alone. Convergence of the MEK/MAPK and PI3K/Akt pathways to regulate common downstream effectors as well as crosstalk between these pathways are well described in the cancer literature (She et al, 2010; Mendoza et al, 2011). However, it is currently unclear which and to what extent signalling pathways downstream of PIK3CA might account for Akt-independent survival mechanisms in MM. Other members of the AGC kinase group [e.g. serum and glucocorticoid-inducible kinase 3 (SGK-3)] or polo-like-kinase 1 (PLK-1), have been suggested as potential functional alternatives to Akt (Bruhn et al, 2013; Tan et al, 2013). Such combination effects were not observed for inhibitors of the other class I PI3K isoforms, but they are in good agreement with our previous results on dual pathway blockade with the pan-PI3K/mTOR inhibitor PI103 and MEK inhibitors (Steinbrunn et al, 2012). These results could therefore provide a rationale for the combination of PIK3CA with MEK inhibition in MM – a strategy currently being clinically explored in solid tumours (clinicaltrials.gov identifier: NCT01449058).

Although our studies showed that each PI3K isoform was expressed in a majority of MM samples [an issue that was hitherto controversial, especially for PIK3CG (Ikeda et al, 2010; Munugalavadla et al, 2014)] we found no evidence for substantial prosurvival activity of PIK3CB, PIK3CD or PIK3CG in MM. Whereas this leaves open the possibility that isoform-specific blockade of these proteins could still be important for other aspects of MM therapy that were not measured in our assays, such as proliferation or motility (Ikeda et al, 2010), our data do not lend particular weight to developing these isoforms as therapeutic targets in this disease.

In early stage clinical trials in solid tumours, PI3K inhibition was less effective than expected, owing at least in parts to potential feedback-loops and/or cross-activation/cross-inhibition of additional signalling pathways (Markman et al, 2013; Rodon et al, 2013). Consequently, these observations led to the notion that PI3K inhibitors will probably play a role as combination partners in suitable patient subgroups (Brana & Siu, 2012; Markman et al, 2013; Martini et al, 2013). Isoform-specific PI3K blockade in human cancer cells is therapeutically warranted because it may provide a more focused targeted approach with less off-target effects than pan-PI3K inhibition (Courtney et al, 2010; Vadas et al, 2011; Brana & Siu, 2012; Maira et al, 2012; Pal & Mandal, 2012; Vanhaesebroeck et al, 2012; Martini et al, 2013; Rodon et al, 2013). Given that we only found substantial pro-survival activity for the PIK3CA isoform, we restricted our analyses of combination effects with established MM treatments to the PIK3CA inhibitor BYL–719. Our data underscore the potential for synergistic to additive activity when PIK3CA inhibition is combined with established mainstays of MM therapy, such as melphalan, bortezomib or dexamethasone. They also indicate that this capacity should extend to upcoming drugs, such as the proteasome inhibitor carfilzomib and the IMiD pomalidomide. These data confirm and extend assessments recently made for broader PI3K inhibitors (Glassford et al, 2012; Munugalavadla et al, 2014) and for BYL-719 (Azab et al, 2014), highlighting PIK3CA inhibition as the most promising means to achieve effective PI3K blockade while restricting the pharmacological effect to as specific a target as possible. Although it remains to be seen if comprehensive genetic information as will be available through modern sequencing techniques can stratify PIK3CA-dependent versus -independent MM subgroups, the clinical testing of such inhibitors in combination with standard-of-care therapies appears highly warranted.

Acknowledgements

  1. Top of page
  2. Summary
  3. Design and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. Author contributions
  8. References
  9. Supporting Information

This work was supported by the Deutsche Forschungsgemeinschaft (KFO 216), the Interdisziplinäres Zentrum für Klinische Forschung of the Universitätsklinikum Würzburg (B–159 and B–188), and the Wilhelm Sander-Stiftung (2011.114.1).

Author contributions

  1. Top of page
  2. Summary
  3. Design and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. Author contributions
  8. References
  9. Supporting Information

C.H. designed, performed and analysed experiments, wrote paper, N.S. performed experiments, R.W. provided essential reagents, M.C. provided MM patient material and wrote paper, J.Z. and H.E. provided MM patient material, A.M. and A.R. provided analyses of primary MM samples, C.L. provided MM cell lines, R.C.B. analysed experiments and wrote paper, T.Stü. and T.Ste. designed, supervised and analysed experiments, wrote paper.

References

  1. Top of page
  2. Summary
  3. Design and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. Author contributions
  8. References
  9. Supporting Information
  • Azab, F., Vali, S., Abraham, J., Potter, N., Muz, B., de la Puente, P., Fiala, M., Paasch, J., Sultana, Z., Tyagi, A., Abbasi, T., Vij, R. & Azab, A.K. (2014) PI3KCA plays a major role in multiple myeloma and its inhibition with BYL719 decreases proliferation, synergizes with other therapies and overcomes stroma-induced resistance. British Journal of Haematology, 165, 89101.
  • Barbieri, C.E., Barton, C.E. & Pietenpol, J.A. (2003) Delta Np63 alpha expression is regulated by the phosphoinositide 3-kinase pathway. Journal of Biological Chemistry, 278, 5140851414.
  • Bartholomeusz, C. & Gonzalez-Angulo, A.M. (2012) Targeting the PI3K signaling pathway in cancer therapy. Expert Opinion on Therapeutic Targets, 16, 121130.
  • Baumann, P., Mandl-Weber, S., Oduncu, F. & Schmidmaier, R. (2009) The novel orally bioavailable inhibitor of phosphoinositol-3-kinase and mammalian target of rapamycin, NVP-BEZ235, inhibits growth and proliferation in multiple myeloma. Experimental Cell Research, 315, 485497.
  • Brana, I. & Siu, L.L. (2012) Clinical development of phosphatidylinositol 3-kinase inhibitors for cancer treatment. BMC Medicine, 10, 161.
  • Bruhn, M.A., Pearson, R.B., Hannan, R.D. & Sheppard, K.E. (2013) AKT-independent PI3-K signaling in cancer – emerging role for SGK3. Cancer Management and Research, 5, 281292.
  • Chapman, M.A., Lawrence, M.S., Keats, J.J., Cibulskis, K., Sougnez, C., Schinzel, A.C., Harview, C.L., Brunet, J.P., Ahmann, G.J., Adli, M., Anderson, K.C., Ardlie, K.G., Auclair, D., Baker, A., Bergsagel, P.L., Bernstein, B.E., Drier, Y., Fonseca, R., Gabriel, S.B., Hofmeister, C.C., Jagannath, S., Jakubowiak, A.J., Krishnan, A., Levy, J., Liefeld, T., Lonial, S., Mahan, S., Mfuko, B., Monti, S., Perkins, L.M., Onofrio, R., Pugh, T.J., Rajkumar, S.V., Ramos, A.H., Siegel, D.S., Sivachenko, A., Stewart, A.K., Trudel, S., Vij, R., Voet, D., Winckler, W., Zimmerman, T., Carpten, J., Trent, J., Hahn, W.C., Garraway, L.A., Meyerson, M., Lander, E.S., Getz, G. & Golub, T.R. (2011) Initial genome sequencing and analysis of multiple myeloma. Nature, 471, 467472.
  • Chesi, M. & Bergsagel, P.L. (2011) Many multiple myelomas: making more of the molecular mayhem. Hematology/The Education Program of the American Society of Hematology. American Society of Hematology. Education Program, 2011, 344353.
  • Chou, T.C. (2006) Theoretical basis, experimental design, and computerized simulation of synergism and antagonism in drug combination studies. Pharmacological Reviews, 58, 621681.
  • Courtney, K.D., Corcoran, R.B. & Engelman, J.A. (2010) The PI3K pathway as drug target in human cancer. Journal of Clinical Oncology, 28, 10751083.
  • De, P., Dey, N., Terakedis, B., Bergsagel, P.L., Li, Z.H., Mahadevan, D., Garlich, J.R., Trudel, S., Makale, M.T. & Durden, D.L. (2013) An integrin-targeted, pan-isoform, phosphoinositide-3 kinase inhibitor, SF1126, has activity against multiple myeloma in vivo. Cancer Chemotherapy and Pharmacology, 71, 867881.
  • Downward, J. (2004) PI 3-kinase, Akt and cell survival. Seminars in Cell & Developmental Biology, 15, 177182.
  • Ferlay, J., Steliarova-Foucher, E., Lortet-Tieulent, J., Rosso, S., Coebergh, J.W., Comber, H., Forman, D. & Bray, F. (2013) Cancer incidence and mortality patterns in Europe: estimates for 40 countries in 2012. European Journal of Cancer, 49, 13741403.
  • Foukas, L.C., Berenjeno, I.M., Gray, A., Khwaja, A. & Vanhaesebroeck, B. (2010) Activity of any class IA PI3K isoform can sustain cell proliferation and survival. Proceedings of the National Academy of Sciences of the United States of America, 107, 1138111386.
  • Furet, P., Guagnano, V., Fairhurst, R.A., Imbach-Weese, P., Bruce, I., Knapp, M., Fritsch, C., Blasco, F., Blanz, J., Aichholz, R., Hamon, J., Fabbro, D. & Caravatti, G. (2013) Discovery of NVP-BYL719 a potent and selective phosphatidylinositol-3 kinase alpha inhibitor selected for clinical evaluation. Bioorganic & Medicinal Chemistry Letters, 23, 37413748.
  • Glassford, J., Kassen, D., Quinn, J., Stengel, C., Kallinikou, K., Khwaja, A. & Yong, K.L. (2012) Inhibition of cell cycle progression by dual phosphatidylinositol-3-kinase and mTOR blockade in cyclin D2 positive multiple myeloma bearing IgH translocations. Blood Cancer J, 2, e50.
  • Guillermet-Guibert, J., Bjorklof, K., Salpekar, A., Gonella, C., Ramadani, F., Bilancio, A., Meek, S., Smith, A.J., Okkenhaug, K. & Vanhaesebroeck, B. (2008) The p110beta isoform of phosphoinositide 3-kinase signals downstream of G protein-coupled receptors and is functionally redundant with p110gamma. Proceedings of the National Academy of Sciences of the United States of America, 105, 82928297.
  • Hsu, J., Shi, Y., Krajewski, S., Renner, S., Fisher, M., Reed, J.C., Franke, T.F. & Lichtenstein, A. (2001) The AKT kinase is activated in multiple myeloma tumor cells. Blood, 98, 28532855.
  • Ikeda, H., Hideshima, T., Fulciniti, M., Perrone, G., Miura, N., Yasui, H., Okawa, Y., Kiziltepe, T., Santo, L., Vallet, S., Cristea, D., Calabrese, E., Gorgun, G., Raje, N.S., Richardson, P., Munshi, N.C., Lannutti, B.J., Puri, K.D., Giese, N.A. & Anderson, K.C. (2010) PI3K/p110{delta} is a novel therapeutic target in multiple myeloma. Blood, 116, 14601468.
  • Irarrazabal, C.E., Burg, M.B., Ward, S.G. & Ferraris, J.D. (2006) Phosphatidylinositol 3-kinase mediates activation of ATM by high NaCl and by ionizing radiation: role in osmoprotective transcriptional regulation. Proceedings of the National Academy of Sciences of the United States of America, 103, 88828887.
  • Ismail, S.I., Mahmoud, I.S., Msallam, M.M. & Sughayer, M.A. (2009) Hotspot mutations of PIK3CA and AKT1 genes are absent in multiple myeloma. Leukemia Research, 34, 824826.
  • Kuehl, W.M. & Bergsagel, P.L. (2012) Molecular pathogenesis of multiple myeloma and its premalignant precursor. J Clin Invest, 122, 34563463.
  • Kumar, S.K., Dispenzieri, A., Lacy, M.Q., Gertz, M.A., Buadi, F.K., Pandey, S., Kapoor, P., Dingli, D., Hayman, S.R., Leung, N., Lust, J., McCurdy, A., Russell, S.J., Zeldenrust, S.R., Kyle, R.A. & Rajkumar, S.V. (2013) Continued improvement in survival in multiple myeloma: changes in early mortality and outcomes in older patients. Leukemia, doi: 10.1038/leu.2013.313.
  • Lannutti, B.J., Meadows, S.A., Herman, S.E., Kashishian, A., Steiner, B., Johnson, A.J., Byrd, J.C., Tyner, J.W., Loriaux, M.M., Deininger, M., Druker, B.J., Puri, K.D., Ulrich, R.G. & Giese, N.A. (2011) CAL-101, a p110delta selective phosphatidylinositol-3-kinase inhibitor for the treatment of B-cell malignancies, inhibits PI3K signaling and cellular viability. Blood, 117, 591594.
  • Leich, E., Weißbach, S., Klein, H.U., Grieb, T., Pischimarov, J., Stühmer, T., Chatterjee, M., Steinbrunn, T., Langer, C., Eilers, M., Knop, S., Einsele, H., Bargou, R. & Rosenwald, A. (2013) Multiple myeloma is affected by multiple and heterogeneous somatic mutations in adhesion- and receptor tyrosine kinase signaling molecules. Blood Cancer J, 3, e102.
  • Leopoldt, D., Hanck, T., Exner, T., Maier, U., Wetzker, R. & Nürnberg, B. (1998) Gbetagamma stimulates phosphoinositide 3-kinase-gamma by direct interaction with two domains of the catalytic p110 subunit. Journal of Biological Chemistry, 273, 70247029.
  • Ludwig, H. & Sonneveld, P. (2012) Disease control in patients with relapsed and/or refractory multiple myeloma: what is the optimal duration of therapy? Leukemia Research, 36, S27S34.
  • Maira, S.M., Pecchi, S., Huang, A., Burger, M., Knapp, M., Sterker, D., Schnell, C., Guthy, D., Nagel, T., Wiesmann, M., Brachmann, S., Fritsch, C., Dorsch, M., Chene, P., Shoemaker, K., De Pover, A., Menezes, D., Martiny-Baron, G., Fabbro, D., Wilson, C.J., Schlegel, R., Hofmann, F., Garcia-Echeverria, C., Sellers, W.R. & Voliva, C.F. (2012) Identification and characterization of NVP-BKM120, an orally available pan-class I PI3-kinase inhibitor. Molecular Cancer Therapeutics, 11, 317328.
  • Markman, B., Tao, J.J. & Scaltriti, M. (2013) PI3K pathway inhibitors: better not left alone. Current Pharmaceutical Design, 19, 895906.
  • Martini, M., Ciraolo, E., Gulluni, F. & Hirsch, E. (2013) Targeting PI3K in cancer: any good news? Front Oncol, 3, 108.
  • Mendoza, M.C., Er, E.E. & Blenis, J. (2011) The Ras-ERK and PI3K-mTOR pathways: cross-talk and compensation. Trends in Biochemical Sciences, 36, 320328.
  • Morgan, G.J., Walker, B.A. & Davies, F.E. (2012) The genetic architecture of multiple myeloma. Nature Reviews Cancer, 12, 335348.
  • Müller, C.I., Miller, C.W., Hofmann, W.K., Gross, M.E., Walsh, C.S., Kawamata, N., Luong, Q.T. & Koeffler, H.P. (2007) Rare mutations of the PIK3CA gene in malignancies of the hematopoietic system as well as endometrium, ovary, prostate and osteosarcomas, and discovery of a PIK3CA pseudogene. Leukemia Research, 31, 2732.
  • Munugalavadla, V., Mariathasan, S., Slaga, D., Du, C., Berry, L., Del Rosario, G., Yan, Y., Boe, M., Sun, L., Friedman, L.S., Chesi, M., Leif Bergsagel, P. & Ebens, A. (2014) The PI3K inhibitor GDC-0941 combines with existing clinical regimens for superior activity in multiple myeloma. Oncogene, 33, 316325.
  • Pal, I. & Mandal, M. (2012) PI3K and Akt as molecular targets for cancer therapy: current clinical outcomes. Acta Pharmacologica Sinica, 33, 14411458.
  • Palumbo, A. & Anderson, K. (2011) Multiple myeloma. New England Journal of Medicine, 364, 10461060.
  • Palumbo, A., Bringhen, S., Ludwig, H., Dimopoulos, M.A., Blade, J., Mateos, M.V., Rosinol, L., Boccadoro, M., Cavo, M., Lokhorst, H., Zweegman, S., Terpos, E., Davies, F., Driessen, C., Gimsing, P., Gramatzki, M., Hajek, R., Johnsen, H.E., Leal Da Costa, F., Sezer, O., Spencer, A., Beksac, M., Morgan, G., Einsele, H., San Miguel, J.F. & Sonneveld, P. (2011) Personalized therapy in multiple myeloma according to patient age and vulnerability: a report of the European Myeloma Network (EMN). Blood, 118, 45194529.
  • Pene, F., Claessens, Y.E., Muller, O., Viguie, F., Mayeux, P., Dreyfus, F., Lacombe, C. & Bouscary, D. (2002) Role of the phosphatidylinositol 3-kinase/Akt and mTOR/P70S6-kinase pathways in the proliferation and apoptosis in multiple myeloma. Oncogene, 21, 65876597.
  • Pollak, M. (2012) The insulin and insulin-like growth factor receptor family in neoplasia: an update. Nature Reviews Cancer, 12, 159169.
  • Pomel, V., Klicic, J., Covini, D., Church, D.D., Shaw, J.P., Roulin, K., Burgat-Charvillon, F., Valognes, D., Camps, M., Chabert, C., Gillieron, C., Francon, B., Perrin, D., Leroy, D., Gretener, D., Nichols, A., Vitte, P.A., Carboni, S., Rommel, C., Schwarz, M.K. & Ruckle, T. (2006) Furan-2-ylmethylene thiazolidinediones as novel, potent, and selective inhibitors of phosphoinositide 3-kinase gamma. Journal of Medicinal Chemistry, 49, 38573871.
  • Ramakrishnan, V., Kimlinger, T., Haug, J., Painuly, U., Wellik, L., Halling, T., Rajkumar, S.V. & Kumar, S. (2012) Anti-myeloma activity of Akt inhibition is linked to the activation status of PI3K/Akt and MEK/ERK pathway. PLoS ONE, 7, e50005.
  • Rodon, J., Dienstmann, R., Serra, V. & Tabernero, J. (2013) Development of PI3K inhibitors: lessons learned from early clinical trials. Nat Rev Clin Oncol, 10, 143153.
  • Samuels, Y. & Waldman, T. (2010) Oncogenic mutations of PIK3CA in human cancers. Current Topics in Microbiology and Immunology, 347, 2141.
  • Schmidt, E.E., Pelz, O., Buhlmann, S., Kerr, G., Horn, T. & Boutros, M. (2013) GenomeRNAi: a database for cell-based and in vivo RNAi phenotypes, 2013 update. Nucleic Acids Research, 41, D1021D1026.
  • She, Q.B., Halilovic, E., Ye, Q., Zhen, W., Shirasawa, S., Sasazuki, T., Solit, D.B. & Rosen, N. (2010) 4E-BP1 is a key effector of the oncogenic activation of the AKT and ERK signaling pathways that integrates their function in tumors. Cancer Cell, 18, 3951.
  • Siegel, R., Naishadham, D. & Jemal, A. (2013) Cancer statistics, 2013. CA: A Cancer Journal for Clinicians, 63, 1130.
  • Steinbrunn, T., Stühmer, T., Gattenlöhner, S., Rosenwald, A., Mottok, A., Unzicker, C., Einsele, H., Chatterjee, M. & Bargou, R.C. (2011) Mutated RAS and constitutively activated Akt delineate distinct oncogenic pathways, which independently contribute to multiple myeloma cell survival. Blood, 117, 19982004.
  • Steinbrunn, T., Stühmer, T., Sayehli, C., Chatterjee, M., Einsele, H. & Bargou, R.C. (2012) Combined targeting of MEK/MAPK and PI3K/Akt signalling in multiple myeloma. British Journal of Haematology, 159, 430440.
  • Stengel, C., Cheung, C.W., Quinn, J., Yong, K. & Khwaja, A. (2012) Optimal induction of myeloma cell death requires dual blockade of phosphoinositide 3-kinase and mTOR signalling and is determined by translocation subtype. Leukemia, 26, 17611770.
  • Stühmer, T., Arts, J., Chatterjee, M., Borawski, J., Wolff, A., King, P., Einsele, H., Leo, E. & Bargou, R.C. (2010) Preclinical anti-myeloma activity of the novel HDAC-inhibitor JNJ-26481585. British Journal of Haematology, 149, 529536.
  • Tan, J., Li, Z., Lee, P.L., Guan, P., Aau, M.Y., Lee, S.T., Feng, M., Lim, C.Z., Lee, E.Y., Wee, Z.N., Lim, Y.C., Karuturi, R.K. & Yu, Q. (2013) PDK1 signaling toward PLK1-MYC activation confers oncogenic transformation, tumor-initiating cell activation, and resistance to mTOR-targeted therapy. Cancer Discov, 3, 11561171.
  • Usmani, S.Z., Crowley, J., Hoering, A., Mitchell, A., Waheed, S., Nair, B., AlSayed, Y., Vanrhee, F. & Barlogie, B. (2013) Improvement in long-term outcomes with successive Total Therapy trials for multiple myeloma: are patients now being cured? Leukemia, 27, 226232.
  • Vadas, O., Burke, J.E., Zhang, X., Berndt, A. & Williams, R.L. (2011) Structural basis for activation and inhibition of class I phosphoinositide 3-kinases. Sci Signal, 4, re2.
  • Vanhaesebroeck, B., Guillermet-Guibert, J., Graupera, M. & Bilanges, B. (2010) The emerging mechanisms of isoform-specific PI3K signalling. Nature Reviews Molecular Cell Biology, 11, 329341.
  • Vanhaesebroeck, B., Stephens, L. & Hawkins, P. (2012) PI3K signalling: the path to discovery and understanding. Nature Reviews Molecular Cell Biology, 13, 195203.
  • Vivanco, I. & Sawyers, C.L. (2002) The phosphatidylinositol 3-Kinase AKT pathway in human cancer. Nature Reviews Cancer, 2, 489501.
  • Wetzker, R. & Rommel, C. (2004) Phosphoinositide 3-kinases as targets for therapeutic intervention. Current Pharmaceutical Design, 10, 19151922.
  • Zöllinger, A., Stühmer, T., Chatterjee, M., Gattenlöhner, S., Haralambieva, E., Müller-Hermelink, H.K., Andrulis, M., Greiner, A., Wesemeier, C., Rath, J.C., Einsele, H. & Bargou, R.C. (2008) Combined functional and molecular analysis of tumor cell signaling defines 2 distinct myeloma subgroups: Akt-dependent and Akt-independent multiple myeloma. Blood, 112, 34033411.

Supporting Information

  1. Top of page
  2. Summary
  3. Design and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. Author contributions
  8. References
  9. Supporting Information
FilenameFormatSizeDescription
bjh12920-sup-0001-FigS1-S2.pdfapplication/PDF2042K

Fig S1. Effect of isoform-specific PI3K inhibitors on downstream signaling components.

Fig S2. Combination effects of PIK3CA inhibitor BYL-719 and MEK1,2 inhibitor PD0325901 in MM cells.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.