SEARCH

SEARCH BY CITATION

FilenameFormatSizeDescription
bph12436-sup-0001-si.doc797K

Figure S1 U73343, the inactive analogue of U73122, does not interfere with the riluzole-mediated TRPC5 activation. Whole cell patch clamp recording of T-RExTRPC5 (Tet+) cells pretreated with U73343 (5 μM). (A) Representative whole cell recording. Data were extracted from voltage ramps and represent current densities at +100 mV (upper trace) and −100 mV (lower trace) in response to Amix, riluzole (50 μM), and 2-APB (75 μM). (B) I/V curves for basal (1), Amix (2)-, and riluzole (3)-induced currents. (C) Statistical analysis of several experiments such as in A (*P < 0.05, n.s.: no significant difference). Data represent means and SEM of 5 independent experiments.

bph12436-sup-0002-si.doc1001K

Figure S2 Riluzole activates TRPC5 in cell-attached patches. Examples of cell-attached recordings on tetracycline induced T-RExTRPC5 (Tet+; upper trace) and non-induced T-RExTRPC5 (Tet-; lower trace) cells at −80 mV. Pipette and bath solution consist of standard extracellular buffer, the pipette solution was additionally supplemented with 100 μM riluzole or with 100 μM riluzole together with 75 μM 2-APB as indicated. (Right-hand figure) The NPo was averaged for 30s intervals and represent means and SEM of several independent experiments. Numbers of individual experiments are stated in the figure.

bph12436-sup-0003-si.doc384K

Figure S3 Gene expression of TRPC1, TRPC5 and GAPDH in U87 cells, which were transiently transfected with TRPC5-specific siRNA (100 pmol, si C5) or unspecific scrambled siRNA (100 pmol, si sc). Untreated U87 cells served as a control. Total RNA was isolated by using RNeasy Mini Kit purchased from Qiagen. The RNA (1 μg) was reverse transcribed to obtain cDNA by using M-MuLV Reverse Transcriptase according to the manufacturer's instructions (NEB: Ipswich, MA, USA). The PCRs were carried out on PTC-200 DNA Engine Cycler (Bio-Rad: Hercules, CA, USA) by using GoTaq DNA Polymerase Kit obtained from Promega (Madison, WI, USA). The following primers were used: TRPC1 forward primer: AGTGACGAGCCTCTTGACAAAC, reverse primer: GGGCTTGCGTCGGTAAC. TRPC5 forward primer: AACTCCCTCTACCTGGCAACTA, reverse primer: GGATATGAGACGCAACGAACTT. GAPDH forward primer: CTCATTTCCTGGTATGAC, reverse primer: GAGCACAGGGTACTTTAT. The cDNA was amplified for 35 cycles (TRPC1, TRPC5) or 22 cycles (GAPDH) and PCR products (5 μL) were subjected to 1% agarose gel electrophoresis.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.