Reactive astrocytes and perivascular macrophages express NLRP3 inflammasome in active demyelinating lesions of multiple sclerosis and necrotic lesions of neuromyelitis optica and cerebral infarction

Authors


Abstract

Objective

Inflammasome, activated by pathogen-derived and host-derived danger signals, constitutes a multimolecular signaling complex that serves as a platform for caspase-1 (CASP1) activation and interleukin-1β (IL-1B) maturation. Mice deficient for NLRP3 inflammasome components are resistant to experimental autoimmune encephalomyelitis (EAE), suggesting a pro-inflammatory role of NLRP3 inflammasome. However, at present, a pathological role of NLRP3 inflammasome in multiple sclerosis (MS) brains remains unknown.

Methods

We studied the expression of NLRP3 inflammasome components in active demyelinating lesions of MS by immunohistochemistry.

Results

Reactive astrocytes and perivascular macrophages expressed all three components of NLRP3 inflammasome – NLRP3, ASC and CASP1 – along with IL-1B in active demyelinating lesions of MS, active necrotic lesions of neuromyelitis optica (NMO) and acute necrotic lesions of cerebral infarction. In contrast, the levels of expression of NLRP3, ASC, CASP1, and IL-1B were greatly reduced in chronic inactive lesions of MS and gliotic lesions of cerebral infarction. Furthermore, the great majority of ramified and amoeboid microglia did not express NLRP3 in active and inactive MS lesions.

Conclusions

NLRP3 inflammasome could be activated chiefly in reactive astrocytes and infiltrating macrophages under the condition of active destruction of brain tissues that potentially provides a danger signal.

Introduction

Inflammasome constitutes an intracellular multimolecular signaling complex that serves as a platform for caspase-1 (CASP1) activation, interleukin-1β (IL-1B) maturation and execution of pyroptosis, a lytic form of cell death with combined characteristics of both apoptosis and necrosis.[1, 2] Inflammasome formation is induced by various inflammation-inducing stimuli recognized by a cytosolic sensor called the NOD-like receptors (NLR). Inflammasome-activating signals include both microbe-derived pathogen-associated molecular patterns (PAMP) and host- or environment-derived danger-associated molecular patterns (DAMP), indicating that inflammasome acts as a master regulator of inflammation against infection and stressful insults.[1, 2] Inflammasome is constructed in the cellular cytoplasm by ordered assembly of self-oligomerizing components and degraded by autophagy after ubiquitination.[3]

Among various classes of inflammasome, the nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3 (NLRP3) inflammasome represents the most extensively characterized inflammasome. It is composed of NLRP3, the adaptor molecule named apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC) and CASP1.[1, 2] NLRP3 contains a central nucleotide-binding and oligomerization (NACHT) domain essential for activation of the signaling complex through adenosine 5′-triphosphate (ATP)-dependent oligomerization, flanked by a C-terminal leucine-rich repeat (LRR) pivotal for ligand sensing and autoregulation, and a N-terminal pyrin (PYD) domain involved in a homotypic protein–protein interaction between NLRP3 and ASC. The molecular interaction of NLRP3 with ASC recruits procaspase-1 by a homotypic interaction of caspase activation and recruitment (CARD) domains between ASC and procaspase-1. Subsequently, the proximity-induced procaspase-1 oligomerization causes autocatalytic activation of CASP1, followed by processing of pro-IL-1B or pro-IL-18 into biologically active IL-1B and IL-18. These cytokines act as a central regulator for induction of pro-inflammatory cytokines and chemokines that amplify inflammation by recruiting immune effector cells.

The activation of NLRP3 inflammasome is tightly regulated by two-step signals.[4] The first priming signal, such as lipopolysaccharide (LPS), enhances the expression of inflammasome components and target proteins through activation of transcription factor NF-κB. The second activation signal promotes the assembly of inflammasome components. The second signal involves three major mechanisms, including generation of reactive oxygen species (ROS), lysosomal damage and the potassium efflux.[1, 2] Mitochondria serve as the principal source of ROS. Blockade of mitophagy induces accumulation of ROS-generating mitochondria that activates NLRP3 inflammasome.[5] Oxidized mitochondrial DNA directly activates NLRP3 inflammasome after induction of apoptosis.[6]

A diverse range of danger signals having DAMP, such as amyloid-β (Aβ), α-synuclein, prion fibrils, uric acid, cholesterol crystals, asbestos, silica, alum, hyaluronan and ATP, and those with PAMP, such as Listeria monocytogenes, Candida albicans and influenza A virus, effectively activate the NLRP3 inflammasome.[1, 2, 7-10] The pattern-recognition receptor, CD36, plays a key role in activation of NLRP3 inflammasome by priming transcription of IL-1B and facilitating the assembly of the NLRP3 inflammasome complex.[11]

Deregulated activation of NLRP3 inflammasome contributes to the pathological processes of gout, atherosclerosis, type 2 diabetes, Crohn's disease, viral encephalitis, bacterial meningitis, traumatic brain injury and Alzheimer's disease (AD).[1, 2, 12-15] A lack of NLRP3 inflammasome components skews microglial cells to an anti-inflammatory M2 phenotype with an enhanced capacity of Aβ clearance in a mouse model of AD.[15] Furthermore, several gain-of-function mutations in the NLRP3 gene cause a panel of dominantly inherited diseases named cryopyrin-associated period syndromes (CAPS), composed of Muckle–Wells syndrome (MWS), familial cold autoinflammatory syndrome (FACS) and chronic infantile cutaneous neurological articular syndrome (CINCA).[1, 2] They are characterized by skin rashes, episodic fever, multiple sclerosis (MS)-like inflammatory demyelinating lesions in the brain and effectiveness of anti-IL-1B therapy.[16, 17]

At present, a pathological role of NLRP3 inflammasome in MS brains remains largely unknown. A previous study showed that CASP1 is expressed in both macrophages/microglia and oligodendrocytes in acute and chronic MS lesions.[18] In a cuprizone-induced demyelination model of MS, mice lacking the NLRP3 gene showed delayed neuroinflammation and demyelination, indicating that NLRP3 exacerbates inflammatory demyelination in the central nervous system (CNS).[19] NLRP3 expression levels were elevated in the spinal cord during myelin oligodendrocyte glycoprotein (MOG)-induced experimental autoimmune encephalomyelitis (EAE), a mouse model of MS; and on induction of EAE, NLRP3-knockout mice showed a delayed clinical course and reduced severity of the disease, accompanied by substantial attenuation of inflammation, demyelination and astrogliosis.[20] Furthermore, mice deficient for ASC or CASP1 are also resistant to EAE, suggesting a pro-inflammatory role of NLRP3 inflammasome.[21] Interferon-β (IFNβ) inhibits NLRP3 inflammasome activation by inducing undefined molecules through STAT1 signaling.[22] Monocytes derived from IFNβ-treated MS patients showed decreased IL-1B production in response to inflammasome-activating stimuli.[22] All of these observations suggest that NLRP3 inflammasome might play a crucial role in the immunopathogenesis of MS.

The present study for the first time attempts to characterize the expression of NLRP3 inflammasome components in active demyelinating lesions of MS by immunohistochemistry.

Methods

Human brain tissues

For immunohistochemistry, 10 micron-thick serial sections of the cerebral cortex were prepared from autopsied brains of four MS patients and nine non-MS subjects. All four MS cases were clinically diagnosed as chronic progressive MS, composed of three cases of secondary progressive MS (SPMS) and one case of primary progressive MS (PPMS). Non-MS cases included a previously reported case of neuromyelitis optica (NMO),[23] four neurologically normal control (NC) subjects and four patients with cerebral infarction. Their clinical characteristics are shown in Table S1. Autopsies were carried out at the National Center Hospital, National Center of Neurology and Psychiatry (NCNP), Kohnodai Hospital, National Center for Global Health and Medicine (NCGM) or the Nishitaga National Hospital. The comprehensive examination by three established neuropathologists (KA, YS, TI) validated the pathological diagnosis. Written informed consent was obtained from all the cases. The ethics committee of the corresponding institutions approved the present study.

Immunohistochemistry

Immunohistochemical studies were carried out according to the methods described previously.[24] In brief, after deparaffination, tissue sections were heated in 10 mM citrate sodium buffer, pH 6.0 by autoclave at 110°C for 15 min in a temperature-controlled pressure chamber (Biocare Medical, Concord, CA, USA). They were treated at room temperature for 15 min with 3% hydrogen peroxide-containing methanol to block the endogenous peroxidase activity. The tissue sections were then incubated with phosphate-buffered saline (PBS) containing 10% normal goat serum at room temperature for 15 min to block non-specific staining. They were incubated in a moist chamber at 4°C overnight with a rabbit antibody against the peptide mapping to the N-terminus of the human NLRP3 protein (1:300; HPA012878; Sigma, St. Louis, MO, USA), a rabbit antibody against a mixture of the peptides mapping at amino acid residues 31–46 and 94–110 of the human ASC protein (1:100; ab113225; Abcam, Cambridge, England), a rabbit antibody against the C-terminal peptide of the human CASP1 p10 protein (1:500; sc-515; Santa Cruz Biotechnology, Santa Cruz, CA, USA) and a rabbit antibody against the peptide mapping at amino acid residues of 117–269 of the human IL-1B protein (1:50; sc-7884; Santa Cruz Biotechnology). After washing with PBS, the tissue sections were labeled at room temperature for 30 min with horseradish peroxidase (HRP)-conjugated secondary antibodies (Nichirei, Tokyo, Japan), followed by incubation with diaminobenzidine tetrahydrochloride (DAB) substrate (Vector, Burlingame, CA, USA). They were processed for a counterstain with hematoxylin. Negative controls underwent all the steps except for exposure to primary antibody. We classified chronic demyelinating lesions of MS into either “chronic active”, defined as a lesion with a hypocellular center and a hypercellular rim, or “chronic inactive”, defined as a hypocellular lesion.[25]

For double labeling, tissue sections were initially stained with anti-NLRP3 antibody HPA012878. After autoclaving, they were labeled with prediluted mouse antibodies against GFAP (GA5; Nichirei) or CD68 (KP1; Dako, Tokyo, Japan), followed by incubation with alkaline phosphatase (AP)-conjugated secondary antibodies (Nichirei) and colorized with a Warp Red chromogen (Biocare Medical, Concord, CA, USA).

Reverse transcription polymerase chain reaction analysis

Total RNA was isolated from a panel of human cell lines described previously.[26] Total RNA of the human frontal cerebral cortex (Clontech, Mountain View, CA, USA) was also processed in parallel for reverse transcription polymerase chain reaction (RT–PCR). DNase-treated total RNA was processed for cDNA synthesis using oligo(dT)12–18 primers and SuperScript II reverse transcriptase (Invitrogen, Carlsbad, CA, USA). Then, cDNA was amplified by PCR using HotStar Taq DNA polymerase (Qiagen, Valencia, CA, USA), and the following panel of sense and antisense primer sets: 5′ agtgctgaaacagcagagctgcct3′ and 5′ccgtttccactcctaccaagaagg3′ for a 151 bp product of NLRP3; 5′agtttcacaccagcctggaactgg3′ and 5′ggatgatttggtgggattgccagg3′ for a 153 bp product of ASC; 5′tggagacatcccacaatgggctct3′ and 5′cactctttcagtggtgggcatctg3′ for an 159 bp product of CASP1; 5′tgcccagttccccaactggtacat3′ and 5′ aggactctctgggtacagctctct3′ for a 145 bp product of IL-1B; and 5′ccatgttcgtcatgggtgtgaacca3′ and 5′gccagtagaggcagggatgatgttc3′ for a 251 bp product of the glyceraldehyde-3-phosphate dehydrogenase (G3PDH) gene that serves as an internal control. The amplification program consisted of an initial denaturing step at 95°C for 15 min, followed by a denaturing step at 94°C for 1 min, an annealing step at 60°C for 40 s and an extension step at 72.9°C for 50 s for 35 cycles, except for G3PDH amplified for 28 cycles.

Transient expression of NLRP3, ASC, and CASP1 in HEK293 cells

Open reading frames (ORF) of the human NLRP3 gene (GenBank NM_004895), the human ASC gene (GenBank NM_013258) and the human CASP1 gene (GenBank NM_033292) were amplified by PCR using PfuTurbo DNA polymerase (Stratagene, La Jolla, CA, USA), and the following sense and antisense primer sets: 5′gcaagcacccgctgcaagctggcc3′ and 5′ctaccaagaaggctcaaagacgac3′ for NLRP3, 5′ gggcgcgcgcgcgacgccatcctg3′ and 5′tcagctccgctccaggtcctccac3′ for ASC, and 5′ gccgacaaggtcctgaaggagaag3′ and 5′ttaatgtcctgggaagaggtagaa3′ for CASP1. Then, they were cloned in a mammalian expression vector named pcDNA4/HisMax-TOPO (Invitrogen). Then, the vectors were transfected into HEK293 cells by using Lipofectamine 2000 reagent (Invitrogen). At 24 h after transfection, the cells were processed for western blot analysis.

Western blot analysis

To prepare the total protein extract, the cells were homogenized in RIPA lysis buffer (Sigma) and a cocktail of protease inhibitors, followed by centrifugation at 13 400 rpm for 5 min at room temperature. The supernatant was separated on a 12% sodium dodecylsulfate polyacrylamide gel electrophoresis gel. After gel electrophoresis, the protein was transferred onto nitrocellulose membranes, and immunolabeled at room temperature overnight with the aforementioned primary antibodies. Then, the membranes were incubated at room temperature for 30 min with HRP-conjugated secondary antibodies (Santa Cruz Biotechnology). The specific reaction was visualized by using a chemiluminescent substrate (Pierce, Rockford, IL, USA). After the antibodies were stripped by incubating the membranes at 50°C for 30 min in a stripping buffer composed of 62.5 mM Tris-HCl, pH 6.7, 2% sodium dodecylsulfate and 100 mM 2-mercaptoethanol, the membranes were relabeled with a goat anti-heat shock protein HSP60 antibody (sc-1052; Santa Cruz Biotechnology) to assess an internal control for protein loading.

Results

Expression of NLRP3 inflammasome components in human neural cell lines

First, we studied NLRP3, ASC, CASP1 and IL-1B mRNA expression in a panel of human neural cell lines by RT–PCR. The complete set of NLRP3, ASC, CASP1 and IL-1B mRNA were expressed at variable levels in human cerebral (CBR) brain tissues, astrocytes (AS), neural progenitor (NP) cells, NTera2-deived differentiated neurons (NTera2N), T98G glioblastoma and HMO6 microglia, where the levels of G3PDH, a housekeeping gene, were almost constant (Fig. 1a–e; lanes 1, 3–5, 9, 10). When omitting the RT step, no PCR products were amplified (Fig. 1a–e; lane 2). The highest levels of NLRP3 and IL-1B were identified in NTera2N, whereas the highest levels of ASC and CASP1 were found in T98G. These results showed that the levels of the constitutive expression of NLRP3 inflammasome components are highly variable among distinct neural cell types.

Figure 1.

The expression of NLRP3 inflammasome components in human neural cell lines. The mRNA expression of (a) NLRP3, (b) ASC, (c) caspase-1 (CASP1), and (d) interleukin (IL)-1B, and (e) glyceraldehyde-3-phosphate dehydrogenase (G3PDH) was studied by reverse transcription (RT) polymerase chain reaction in human brain tissues and neural cell lines in culture. The lanes represent (1) cerebral (CBR) brain tissues with inclusion of RT step, (2) CBR without inclusion of RT-step, (3) astrocytes (AS), (4) neural progenitor (NP) cells, (5) NTera2-deived differentiated neurons (NTera2N), (6) SK-N-SH neuroblastoma, (7) IMR-32 neuroblastoma, (8) U-373MG astrocytoma, (9) T98G glioblastoma and (10) HMO6 microglia.

Expression of NLRP3 inflammasome components in reactive astrocytes and perivascular macrophages in chronic active demyelinating lesions of MS, active necrotic lesions of NMO, and acute infarct lesions

Next, to verify the specificity of anti-NLRP3 antibody (HPA012878), anti-ASC antibody (ab113225) and anti-CASP1 antibody (sc-515) utilized in the present study, the human NLRP3, ASC and CASP1 genes cloned in the mammalian expression vector were expressed in HEK293 cells for western blot analysis. HPA012878, ab113225 and sc-515 reacted individually with the corresponding recombinant proteins of NLRP3, ASC or CASP1, but not with protein extract isolated from non-transfected cells (Fig. S1a–c). These results validated the specificity of the antibodies tested.

Then, we studied the expression of three components of NLRP3 inflammasome, along with IL-1B, in the cerebral cortex sections of four MS and nine non-MS cases by immunohistochemistry using the aforementioned antibodies. In the brains of neurologically normal control (NC) subjects, NLRP3 expression was restricted in a rare population (less than 0.01% of total cells) that represent a specified subset of ramified microglial cells often located in deep cortical layers and the white matter (Fig. S2a). All neurons, oligodendrocytes, astrocytes and the great majority of ramified microglia did not express discernible levels of NLRP3. In NC brains, ASC and CASP1 were undetectable except for a small subset (less than 0.1%) of ramified microglia (Fig. S2b,c). In contrast, IL-1B was expressed in many neurons with the location in the cytoplasm and in a small population (less than 1%) of ramified microglia (Fig. S2d).

Notably, numerous reactive astrocytes accumulating in chronic active demyelinating lesions of MS expressed intense immunoreactivities for NLRP3, ASC, CASP and IL-1B with the location in the cytoplasm (Fig. 2a–d, Fig. 3e). In contrast, the levels of expression of NLRP3, ASC, CASP, and IL-1B were much lower in reactive astrocytes and glial scars in chronic inactive lesions of MS. Furthermore, a large number of perivascular foamy macrophages expressed NLRP3, ASC, CASP and IL-1B at variable intensities in chronic active demyelinating lesions of MS (Fig. 3a–d,f). In contrast, the great majority of amoeboid and ramified microglia did not express NLRP3 in chronic active and inactive MS lesions (Fig. 3g). In the edge of active necrotic lesions of NMO, only hypertrophic reactive astrocytes and foamy macrophages intensely expressed the full set of NLRP3, ASC, CASP, and IL-1B (Fig. 4a–d). These results showed that reactive astrocytes and infiltrating macrophages engulfing tissue debris are the major cell types that express the complete set of NLRP3 components in active MS and NMO lesions.

Figure 2.

The expression of NLRP3 inflammasome components in reactive astrocytes in chronic active demyelinating lesions of multiple sclerosis. The expression of (a) NLRP3, (b) ASC, (c) caspase-1 and (d) interleukin-1B was studied in the serial sections of chronic active lesions of multiple sclerosis by immunohistochemistry. Reactive astrocytes intensely expressed all three components and interleukin -1B with the location of the cytoplasm.

Figure 3.

The expression of NLRP3 inflammasome components in perivascular macrophages in chronic active demyelinating lesions of multiple sclerosis. The expression of (a) NLRP3, (b) ASC, (c) caspase-1 and (d) interleukin-1B was studied in the serial sections of chronic active lesions of multiple sclerosis by immunohistochemistry. Perivascular macrophages expressed variable intensities of all three components and interleukin-1B in the cytoplasm. (e–g) Double immunolabeling of (e) NLRP3 (brown) and GFAP (red), (f) NLRP3 (brown) and CD68 (red), and (g) NLRP3 (brown) and CD68 (red). The arrows indicate CD68-positive NLRP3-negative ameboid microglial cells.

Figure 4.

The expression of NLRP3 inflammasome components in reactive hypertrophic astrocytes and infiltrating macrophages in active necrotic lesions of neuromyelitis optica (NMO). The expression of (a) NLRP3, (b) ASC, (c) caspase-1 and (d) interleukin-1B was studied in the serial sections of active necrotic lesions of NMO by immunohistochemistry. Hypertrophic reactive astrocytes in the right upper half and foamy macrophages in the left lower half intensely expressed all three components and interleukin-1B with the location in the cytoplasm.

In acute lesions of cerebral infarction, reactive astrocytes surrounding ischemic cores and foamy macrophages accumulating in necrotic lesions moderately expressed NLRP3, ASC, CASP, and IL-1B (Fig. 5a–d). In contrast, the levels of expression of NLRP3, ASC, CASP and IL-1B were low in any cell types in chronic gliotic lesions of cerebral infarction. These results showed that NLRP3 inflammasome could be activated chiefly in astrocytes and macrophages under the condition of active destruction of brain tissues, regardless of the etiology, such as MS, NMO and cerebral infarction.

Figure 5.

The expression of NLRP3 inflammasome components in reactive astrocytes and infiltrating macrophages in acute necrotic lesions of cerebral infarction. The expression of (a) NLRP3, (b) ASC, (c) caspase-1 and (d) interleukin-1B was studied in the serial sections of acute necrotic lesions of cerebral infarction by immunohistochemistry. Reactive astrocytes and foamy macrophages moderately expressed all three components and interleukin -1B with the location in the cytoplasm.

Discussion

By immunohistochemistry, we showed that reactive astrocytes and infiltrating foamy macrophages express the complete set of NLRP3 inflammasome components, such as NLRP3, ASC and CASP1, along with IL-1B in active demyelinating lesions of MS, active necrotic lesions of NMO and acute necrotic lesions of cerebral infarction. In contrast, the levels of expression of NLRP3, ASC, CASP, and IL-1B were substantially reduced in chronic inactive lesions of MS and chronic gliotic lesions of cerebral infarction, when compared with the expression levels in active demyelinating and necrotic lesions. We also found that the great majority of ramified and amoeboid microglia did not express NLRP3 in active and inactive MS lesions, and active NMO and infarct lesions. These results apparently contradict the observations of NLRP3 expression in HMO6 human microglial cells by RT–PCR, and the microglial expression of NLRP3 in a mouse model of AD.[15] However, a recent study elucidated NLRP3 inflammasome-independent mechanisms of IL-1B and IL-18 maturation in microglia.[27] Our observations suggest that NLRP3 inflammasome could be activated chiefly in astrocytes and macrophages under the condition of active destruction of brain tissues that potentially provides a danger signal, regardless of the etiology, such as MS, NMO and cerebral infarction. However, in the present study, the main limitation exists in non-quantitative analysis as a result of a small sample size analyzed by immunohistochemistry. To overcome this drawback, further examinations on large cohorts, including frozen brain tissues by western blot analysis, would be required.

Accumulating evidence shows that a diverse range of danger signals containing DAMP and PAMP effectively activate NLRP3 inflammasome.[1, 2, 7-10] Among the host-derived signals with DAMP, ATP is released extracellularly from damaged or dying cells after injury, infection and inflammation.[7, 12] The activation of NLRP3 inflammasome in response to extracellular ATP is mediated by the purinergic receptor, P2X7, which recruits the pannexin-1 membrane channel.[7] Importantly, EAE is ameliorated by P2X7 receptor blockade.[28] Furthermore, the levels of P2X7 receptor expression are elevated in activated macrophages/microglia in the spinal cord of MS, suggesting the possible contribution of extracellular ATP to activation of NLRP3 in MS lesions.[29] Astrocytes also express a P2X7 receptor and respond well to extracellular ATP.[30] It is worthy to note that acidic extracellular pH as a result of active destruction of brain tissues promotes NLRP3 inflammasome activation.[31]

A recent study showed that nanoparticles, such as 20 nm latex beads, could activate NLRP3 inflammasome in bone marrow-derived macrophages.[32] We could raise a possible scenario that brain tissue debris containing myelin degradation products of nanoparticle size, when taken up by phagocytosis, might serve as a danger signal for activation of NLRP3 inflammasome in infiltrating macrophages in active MS, NMO and infarct lesions. Furthermore, reactive astrocytes, as well as professional phagocytes, such as macrophages, microglia and dendritic cells, have a capacity to phagocytose damaged cells.[33] Mitochondrial injury generates excessive amounts of ROS in active MS lesions,[34] which potentially accelerates the assembly of NLRP3 inflammasome complex. NLRP3, translocated to mitochondria after activation of the inflammasome, regulates mitochondrial homeostasis.[35] Importantly, IFNβ inhibits activation of Rac1 through the SOCS1 signaling pathway, and reduces the generation of ROS.[36] Treatment with IFNβ is highly effective in a subtype of EAE whose development depends primarily on NLRP3 inflammasome, whereas it is ineffective in a distinct subtype of EAE independent of NLRP3 inflammasome activation induced by aggressive immunization.[36] In EAE, NLRP3 inflammasome promotes chemotactic migration of CD4+ T cells and antigen-presenting cells into the CNS, supporting a pro-inflammatory role of NLRP3 inflammasome.[37]

As clearance of damaged cellular constituents by locally accumulated phagocytes is a fundamental process to limit tissue damage, the present observations suggest the hypothesis that NLRP3 inflammasome expressed in reactive astrocytes and infiltrating macrophages plays a key role in not only amplification of inflammation, but also facilitation of tissue repair and regeneration by rapid and efficient production of IL-1B, serving as a potent growth factor for neural precursor cells, in MS, NMO and infarct lesions after acute tissue destruction.[38]

Acknowledgements

All autopsied brain samples were provided by Research Resource Network (RRN), Japan. This work was supported by grants from the JSPS KAKENHI (C22500322 and C25430054), the Ministry of Education, Culture, Sports, Science and Technology (MEXT), Japan. The authors declare no conflict of interest.

Ancillary