SEARCH

SEARCH BY CITATION

FilenameFormatSizeDescription
cmi12057-sup-0001-si.pdf592K

Fig. S1. A. Schematic representation of the Sti1 replacement constructs. Approximately 1000 bp of Sti1 5′-UTR were amplified by PCR with EcoRI, SwaI and KpnI sites added as indicated and ligated between EcoRI and KpnI sites of plasmid pUC19 to produce pUC19- Sti1-5′. Similarly, the 3′-UTR of Sti1 was amplified with BamHI, SwaI and HindIII sites and integrated between the BamHI and HindIII sites of pUC19-Sti1-5′ to create pUC19- Sti1-5′-3′. Next, the selection marker genes for puromycin (puro) and bleomycin (bleo) were fitted between the KpnI and BamHI sites to produce the two replacement constructs pUC19-Sti1-5′-puro-3′ and pUC19-Sti1-5′bleo-3′ respectively. Prior to electroporation, the gene replacement cassettes of either construct were excised using SwaI restriction digest.

B. Schematic representation of the gene add-back construct pIRmcs3+ Sti1. The open reading frame plus 1000 bp of the 3′-UTR from the Sti1 gene were amplified to create KpnI and BglII sites at either ends and ligated between the KpnI and BglII sites of pIRmcs3+. Digesting the plasmid with SwaI yielded a linearized fragment with small subunit rRNA sequences on either ends. After electroporation, the gene expression cassette is integrated into one of the SSU rRNA-coding sequences.

Fig. S2. PCR analysis of putative Sti1 replacement mutants.

A. Amplification of open reading frame sequences by PCR. Genomic DNA from four suspected Sti1−/− gene replacement mutants was used as template. Note that all four clones still possess Sti1-coding sequences.

B. Amplification of the Sti1 locus including the flanking DNA sequences. Genomic DNA from L. donovani 1SR wild-type (lane 1), L. donovani Sti1+/− (lane 2) and of six suspected Sti1−/−/+ gene replacement/gene add-back clones (lanes 3–8) was used as template. Note that the ∼ 3600 bp species representing the wild-type locus is lacking from lanes 3–8, indicating that replacement of the Sti1-coding sequences was successful in the presence of a Sti1 transgene. As expected, the mono-allelic gene replacement mutant Sti+/− (lane 2) shows a mixed band pattern representing one wild-type and one recombined Sti1 locus.

C. Schematic annealing of the PCR primers used.

Sti1_locus_fwd (GGTGACCGCGAGCGGCTTC)

Sti1_ORF-5′ (CCATGGTACCATGGACGCAACTGAGCTG)

Sti1_ORF_3′ (CCTCTAGATCTCTACTGACCAAAACGAATG)

Sti1_locus_rev (CTGCCAACGTGACACCTG).

Fig. S3. Schematic representation of Hsp90 transgenes. The plasmid vector pTLv6 (A) was combined from the cosmid pcosTL (Kelly et al., 1994) and pIRmcs3+ (Hoyer et al., 2004) and allows the stable episomal establishment of transgenes in Leishmania spp. Coding sequences for Hsp90 variants were excised from pUC19 with KpnI and BamHI and fused between the KpnI and BglII sites of pTLv6 (B). The Hsp90 variants are schematically drawn up with mutation sites highlighted (C–F).

Fig. S4. Schematic representation of 3xHA-tagged Hsp90 transgenes. The plasmid vector pCLneo:3HA (A) was opened with NdeI and BglII. The coding sequences for the Hsp90 variants were amplified by PCR to create NdeI and BamHI sites, subcloned into pUC19 and verified, and then fused between the NdeI and BglII sites of pCLneo:3HA. The Hsp90 variants are schematically drawn up with mutation sites highlighted (B–E).

Fig. S5. Upper panel: Schematic representation of pCLsat:Sti1::eGFP. The streptothricine (SAT) resistance marker expression is driven by T. cruzi glyceraldehyde 3′ phosphate dehydrogenase gene flanking sequences. Sti1::eGFP fusion gene expression is under control of the L. mexicana cystein proteinase B2 intergenic region and the L. donovani LPG1 3′ UTR. Lower panel: Fluorescence microscopy imaging of Sti1::eGFP and anti-Hsp90 immune staining.

Fig. S6. Schematic representation of primer directed mutagenesis. Hsp90-coding sequences were amplified and ligated into plasmid pUC19. A forward primer bearing the desired mutation six base pairs from its 5′ end anneals immediately downstream from a reverse primer with wild-type sequence (A). Both primers were 5′-phosphorylated prior to PCR using polynucleotide kinase. Amplification using the iProof kit with the buffer for G/C-rich DNA yielded a linear product (B) bearing the planned mutation. Ligation of the blunt ends then produced the pUC-Hsp90 plasmid with the mutation (C). Using KpnI and BamHI, the coding sequence was excised for insertion into the expression vector pTLv6 (SM3).

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.