Lipoarabinomannan mannose caps do not affect mycobacterial virulence or the induction of protective immunity in experimental animal models of infection and have minimal impact on in vitro inflammatory responses

Filename	Format	Size	Description
cmi12065-sup-0001-si.tif		84K	Fig. S1. Genetic evidence for the deletion and complementation of gene Rv1635c. The left panel shows the PCR with deletion primers GGCGAACGGAACACTGTGAT and CCGTCTGGCTGACCGTATTA in the deleted region of Rv1635c. Lane 1: M. tuberculosis H37Rv WT; Lane 2: M. tuberculosis H37Rv ΔRv1635c; Lane 3: Complemented M. tuberculosis ΔRv1635c; Lane 4: Negative control; Lane 5: Molecular Weight marker. The predicted product size is 347 bp. As expected parent strain and complementant show a product which is of the correct seize, while the knockout does not yield a product. The right panel shows the PCR with flanking primers GTGCCGGTGTGGTCGCTATT and ACCTGGCAACCTGCCGACTT in the regions upstream and downstream of gene Rv1635c. Lane 1: M. tuberculosis H37Rv WT; Lane 2: M. tuberculosis H37Rv ΔRv1635c; Lane 3: Complemented M. tuberculosis ΔRv1635c; Lane 4: Negative control; Lane 5: M. bovis BCG; Lane 6: Molecular Weight markers. The predicted size of the product in M. tuberculosis H37Rv and M. bovis BCG is 3256 bp; predicted size in H37Rv ΔRv1635c is 2492 bp. As expected the complemented strain still yields the knockout product size as the complementation plasmid carries a full-length copy of Rv1635c but no flanking regions. Together the two PCRs prove the identity of parent strain, knockout and complementant.
cmi12065-sup-0002-si.tif		149K	Fig. S2. Mannooligosaccharide cap analysis of LAM. Purified LAM was analysed for presence of the mannose caps by capillary electrophoresis monitored by laser-induced fluorescence after mild acid hydrolysis and 8-aminopyrene-1,3,6-trisulfonate tagging. Shown are the profiles of LAM from M. tuberculosis wild type (trace 1) and M. tuberculosis capless mutant (trace 2). A, Ara-APTS; M, Man-APTS; S, internal standard, mannoheptose-APTS; AM, Manp-(α1→5)-Ara-APTS (monomannoside cap); AMM, Manp-(α1→2)-Manp-(α1→5)-Ara-APTS (dimannoside cap); AMMM, Manp-(α1→2)-Manp-(α1→2)-Manp-(α1→5)-Ara-APTS (trimannoside cap).
cmi12065-sup-0003-si.tif		3700K	Fig. S3. Evidence for a LAM-specific defect in mannosylation. M. tuberculosis H37Rv, capless mutant and complementant were grown on plates, suspended to 50 mg ml^−1 wet-weight, disrupted by beat-beating and 10 μl samples subjected to SDS-PAGE (12% acrylamide), blotted to PVDF membranes and probed with various monoclonal antibodies or lectins at 1–2 mg ml^−1 and immunostained. Mab F30-5 recognizes the arabinan domain of LAM; conA and DC-SIGN are lectins specific for mannosyl residues; Mab 183-24 recognizes tri-mannosyl residues in both the mannose cap of LAM and PIMs; Mab 55.92.1A1 recognizes mannose residues in cap only. Arrows indicate the migration of the indicated molecules. Ponceau staining proves adequate transfer to PVDF. The five immunoblots together show that only the mannose cap of LAM is affected in the capless mutant with no other changes in mannosylation visible. Molecular weight markers (expressed in kDa) are indicated along the Ponceau staining.
cmi12065-sup-0004-si.tif		284K	Fig. S4. MALDI-TOF Mass Spectrometry analysis of PIMs from M. tuberculosis wild type (A) and capless mutant (B) strains. Lipids were obtained by chloforform/methanol extraction of bacteria and subjected to MALDI-TOF MS analysis in the negative ion mode as previously described (Gilleron et al., 2003).
cmi12065-sup-0005-si.doc		30K	Supporting Information

Please note: Wiley-Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.