SEARCH

SEARCH BY CITATION

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Using a genetic screen in yeast we found that Mycobacterium tuberculosisPE-PGRS62 was capable of disrupting yeast vacuolar protein sorting, suggesting effects on endosomal trafficking. To study the impact of PE-PGRS62 on macrophage function, we infected murine macrophages with Mycobacterium smegmatis expressing PE-PGRS62. Infected cells displayed phagosome maturation arrest. Phagosomes acquired Rab5, but displayed a significant defect in Rab7 and LAMP-1 acquisition. Macrophages infected with M. smegmatis expressing PE-PGRS62 also expressed two- to threefold less iNOS protein when compared with cells infected with wild-type bacteria. Consistent with this, cells infected with a Mycobacterium marinum transposon mutant for the PE-PGRS62 orthologue showed greater iNOS protein expression when compared to cells infected with wild-type organisms. Complementation restored the ability of the mutant to inhibit iNOS expression. No differences in iNOS transcript levels were observed, suggesting that PE-PGRS62 effects on iNOS expression occurred post-transcriptionally. Marked differences in colony morphology were also seen in M. smegmatis expressing PE-PGRS62 and in the M. marinum transposon mutant,suggesting that PE-PGRS62 may affect cell wall composition. These findings suggest that PE-PGRS62 supports virulence via inhibition of phagosome maturation and iNOS expression, and these phenotypes may be linked to effects on bacterial cell wall composition.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

One-third of the world's population is estimated to be latently infected with Mycobacterium tuberculosis, with eight million cases of diagnosed disease and 1.4 million deaths occurring each year (World Health Organization Tuberculosis Data and Statistics, 2011). M. tuberculosis infects macrophages and has evolved multiple mechanisms to avoid macrophage microbicidal activity. Within the macrophage M. tuberculosis resides in an early-stage phagosomal vacuole, which is known to be arrested between the early endocytic and late phagosome stages (Xu et al., 1994; de Chastellier et al., 1995; Clemens and Horwitz, 1995; Deretic and Fratti, 1999). Phagosomes containing virulent mycobacteria display early endosomal markers such as transferrin receptors, EEA-1 and the glycosphingolipid GM1 ganglioside (Russell et al., 1996), but not late endosomal or lysosomal markers such as mannose-6-phosphate receptors, Cathepsin D and the vacuolar proton ATPase (Sturgill-Koszycki et al., 1994; Xu et al., 1994; Clemens and Horwitz, 1995). Although Rab5 is present on mycobacterial phagosomes, Rab7 recruitment is impaired, suggesting that Rab exchange, in which Rab5 is replaced with Rab7 (Rink et al., 2005; Poteryaev et al., 2010), is defective.

The mycobacterial PE/PPE protein family is thought to be involved in virulence, although definitive functions have not been assigned (Brennan et al., 2001; Banu et al., 2002; Delogu et al., 2004). PE/PPE proteins have close associations with the Type VII secretion system in mycobacteria, as genetic expansion of the PE/PPE protein family has been linked to that of the ESX gene clusters which encode the Type VII secretion system (Gey van Pittius et al., 2006). The ESX-5 transport system was found to be necessary for the secretion of PPE41, a Mycobacterium marinum protein, into macrophages upon infection (Abdallah et al., 2006). PE proteins are characterized by highly conserved N-terminal domains containing a proline and glutamate residue at positions 8 and 9 (PPE proteins contain an additional proline residue at position 9 followed by a glutamate at position 10).

Of the PE proteins that have been associated with virulence, PE-PGRS62 (Rv3812) appears to be a promising candidate M. tuberculosis effector. PE-PGRS62 is classified as belonging to the PE-PGRS subfamily, which contains an additional C-terminal domain (the polymorphic GC-rich repetitive sequence) that encodes multiple glycine–alanine or glycine–asparagine repeats. However, sequence analysis indicates that the C-terminal domain of PE-PGRS62 does not appear to contain the glycine–alanine or glycine–asparagine repeats that make up a classical PGRS domain, suggesting that this protein may have unique functions among PE-PGRS proteins (Delogu et al., 2008). PE-PGRS proteins have only been found in members of the M. tuberculosis complex, Mycobacterium ulcerans and M. marinum thus far, and expression of the M. marinum orthologue of PE-PGRS62 was found to be upregulated in M. marinum-infected J774 macrophages and in granulomas from M. marinum-infected frogs (Ramakrishnan et al., 2000). Furthermore, infection of frogs with an M. marinum PE-PGRS62 orthologue mutant was attenuated, indicating a role for PE-PGRS62 in virulence (Ramakrishnan et al., 2000); however, its exact function in pathogenesis is unknown.

We screened an M. tuberculosis H37Rv genomic library in yeast to identify mycobacterial proteins which could disrupt yeast vacuolar protein sorting (VPS). Trafficking of protein cargo from the Golgi to the yeast vacuole is a well-characterized system with many similarities to mammalian endosomal trafficking (Lemmon and Traub, 2000; Bowers and Stevens, 2005). The latter is not surprising since, as of the more than 70 proteins shown to be involved in VPS in yeast, nearly all have mammalian orthologues. The yeast vacuole is analogous to the mammalian lysosome, which fuses with phagosomes as they reach full maturity. Yeast is an ideal model organism in which to study the effects of pathogen effector proteins as many bacterial effectors involved in mammalian infection have been shown to retain their function in yeast (Lesser and Miller, 2001). In fact, two studies used a genetic screen in the budding yeast Saccharomyces cerevisiae and identified candidate secretory proteins of Legionella pneumophila that disrupted the VPS pathway (Campodonico et al., 2005; Shohdy et al., 2005). We reasoned that M. tuberculosis proteins that disrupt yeast VPS may also disrupt phagosome maturation in macrophages. Our screen identified several candidate effectors that disrupted yeast VPS, one of which was PE-PGRS62. We assessed whether PE-PGRS62 affected macrophage function, and discovered that similar to its effect on disrupting VPS in yeast, Mycobacterium smegmatis expressing PE-PGRS62 showed a gain-of-function phenotype for inhibition of phagosome maturation post acquisition of Rab5. In addition, macrophages infected with M. smegmatis expressing PE-PGRS62 displayed two- to threefold lower iNOS protein levels when compared with cells infected with control PE-PGRS62-null bacteria. Consistent with this finding, for the pathogenic bacterium M. marinum, infection with an M. marinum transposon mutant for the PE-PGRS62 orthologue showed loss-of-function for inhibition of iNOS protein expression when compared to either complemented bacteria or wild-type M. marinum. Taken together, these results identify novel functions for PE-PGRS62, which may contribute to mycobacterial virulence via inhibition of both phagosome maturation and iNOS expression.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Pathogen effector protein screening in yeast shows that PE-PGRS62 disrupts VPS

Yeast can be used as a model in which to screen for pathogen effectors that may influence mammalian phagosome trafficking as they may also interfere with the yeast VPS pathway (Campodonico et al., 2005; Shohdy et al., 2005). To this end, we constructed an H37Rv library in the yeast expression vector pWS93 and transformed the heterogeneous pool of plasmids into the yeast strain NSY01 following the protocol described previously for L. pneumophila (Shohdy et al., 2005). The plasmid library was estimated to contain three genome equivalents. Transformed yeast clones were assessed for defects in VPS by overlaying plates with glucostat reagent (described in Experimental procedures). The yeast strain NSY01 expresses an invertase–carboxypeptidase Y (Inv-CPY) fusion protein which is normally trafficked to the yeast vacuole (Shohdy et al., 2005). Disruption of the trafficking of Inv-CPY results in the protein being secreted extracellularly, and this can be detected by overlaying colonies with glucostat reagent containing sucrose, the substrate for invertase. The resulting glucose that is formed is utilized by glucose oxidase present in glucostat reagent to form a lactone and H2O2. The latter is used by horseradish peroxidase to oxidize the compound O-dianisidine, resulting in the formation of a brown-red product (Shohdy et al., 2005). Thus, yeast which display a protein trafficking defect to the yeast vacuole exhibit brown-red colouration when given glucostat reagent. Through our partial screen of ∼6800 colonies, we identified four candidate effectors. Two of these effectors were hypothetical proteins, one was annotated as being a metal cation transporting P-type ATPase, and the fourth was PE-PGRS62. Yeast that had been transformed with a plasmid containing PE-PGRS62 showed a clear defect in VPS trafficking, as assessed by brown-red colouration when given glucostat reagent (Fig. 1). Out of the candidate effectors identified from the yeast screen, PE-PGRS62 was selected for additional studies to assess its effects on macrophage function, as this protein has previously been linked to virulence in M. marinum (Ramakrishnan et al., 2000).

figure

Figure 1. Yeast clones transformed with pWS93 plasmid containing Rv3812 (gene for PE-PGRS62) show brown pigmentation when overlaid with glucostat reagent, thus indicating VPS disruption. The Sc-Ura agar plate was streaked with two individual clones containing the same pWS93-Rv3812 plasmid encoding for PE-PGRS62. Yeast transformed with pWS93 empty vector was included as a negative control. Yeast transformed with pWS93 plasmid containing the L. pneumophila protein VipD was included as a positive control, as this effector protein was previously identified as being able to disrupt yeast VPS (Shohdy et al., 2005).

Download figure to PowerPoint

Construction of M. smegmatis expressing PE-PGRS62

The non-pathogenic M. smegmatis does not contain a PE-PGRS62 orthologue. We took advantage of this to study the effects of PE-PGRS62 on macrophage function and made an M. smegmatis construct that expressed PE-PGRS62 upon induction with acetamide. M. smegmatis clones expressed His-tagged PE-PGRS62 when grown in culture supplemented with acetamide (Fig. 2A). Moreover, subcellular fractionation of these clones identified the location of the fusion protein as being on the cell wall (Fig. 2B), in agreement with previous studies which had identified PE-PGRS proteins as being cell wall proteins (Brennan et al., 2001; Banu et al., 2002; Delogu et al., 2004; Cascioferro et al., 2007).

figure

Figure 2. A. M. smegmatis transformed with pJAK2.D-Rv3812 expresses histidine-tagged fusion protein when induced with acetamide. Two different concentrations of acetamide were tested. The same clones were grown in normal dextrose-containing medium, and did not show expression of PE-PGRS62 fusion protein.

B. Subcellular fractionation of M. smegmatis induced to express PE-PGRS62 showed localization to the cell wall fraction. No signal was seen for fractions isolated from uninduced bacteria. GroEL2 is included as a control for the subcellular fractionation.

Download figure to PowerPoint

M. smegmatis expressing PE-PGRS62 is able to block phagosome maturation

When J774A cells were infected with PE-PGRS62-expressing M. smegmatis, immunoblotting of phagosome lysates showed normal recruitment of the small GTPase Rab5 (Fig. 3A). However, probing with an antibody against the late endosomal GTPase Rab7 showed a 50% reduction in phagosomal recruitment of Rab7, and a trend towards lower Cathepsin D levels (Fig. 3A). An assessment of the total cellular levels of these markers showed similar levels of expression, suggesting that the differences observed in phagosomes result from differential recruitment, and were not due to changes in cellular expression (Fig. 3B). Additional confocal microscopic analysis of infected cells at 6 and 24 h post infection showed a significant decrease in LAMP-1 colocalization to phagosomes containing PE-PGRS62-expressing bacteria (Fig. 3C, white highlighting indicates colocalization of bacteria containing phagosomes with LAMP-1 as determined by the Colocalization Highlighter plugin in Image J software, described in Experimental procedures). Moreover, reduced phagosome maturation in PE-PGRS62-infected cells was found to be linked to increased survival within macrophages (Fig. 3D). These findings established that expression of PE-PGRS62 in macrophages was linked to a phenotype of phagosome maturation arrest and increased survival, and were consistent with the genetic screen in yeast showing disruption of VPS by PE-PGRS62.

figure

Figure 3. A. Phagosomes isolated from J774A cells infected with M. smegmatis induced to express PE-PGRS62 showed normal acquisition of Rab5, but significantly decreased Rab7 acquisition when compared to phagosomes isolated from cells infected with uninduced control bacteria. Phagosomes from cells infected with PE-PGRS62-expressing M. smegmatis also show a trend towards lower Cathepsin D levels, although this was not found to be statistically significant. Blots are representative of three independent experiments. Densitometry shows mean ± s.e.m. of three independent experiments. White bars = uninduced, black bars = induced to express PE-PGRS62. *P < 0.05.

B. Western blotting of whole cell lysates from infected cells showed no differences in the levels of Rab5, Rab7 and Cathepsin D, suggesting that the differences seen in phagosome lysates are due to differential recruitment, and not because of any effects on the cellular expression of these proteins. Blot is representative of two independent experiments.

C. LAMP-1 colocalization was significantly decreased for phagosomes containing M. smegmatis induced to express PE-PGRS62 when compared to those infected with uninduced control bacteria. Images were taken at 6 and 24 h post infection. White arrowhead denotes area depicted in the enlarged panel. Colocalization is highlighted in white using the Colocalization Highlighter plugin from Image J. DAPI images have been pseudo-coloured red to allow colocalization analysis. Scale bar: 10 μm. Images are representative of three independent experiments. Bar graph to the right shows mean ± s.e.m of colocalization of three independent experiments. *P < 0.05.

D. M. smegmatis expressing PE-PGRS62 shows better survival in infected cells when compared to non-expressing bacteria. Infected cells were lysed 24 h post infection, and lysates were plated out onto Middlebrook 7H10 plates supplemented with OADC and 25 μg ml−1 kanamycin. The number of colony forming units was then counted. Graph represents means ± s.e.m. from four independent experiments. White bars = control uninduced M. smegmatis, black bars = M. smegmatis induced to express PE-PGRS62. *P < 0.05.

Download figure to PowerPoint

Macrophages infected with either M. smegmatis expressing PE-PGRS62 or the M. marinumPE-PGRS62 orthologue transposon mutant do not display significant differences in cytokines levels when compared to infections with wild-type bacteria

The M. marinum ESX-5 mutant, which displays defective secretion of PE-PGRS proteins (Abdallah et al., 2009), elicits increased levels of the proinflammatory cytokines TNF-α, IL-12p40 and IL-6, and decreased levels of IL-1β in infected macrophages (Abdallah et al., 2008). Because these findings suggested that PE-PGRS proteins may influence cytokine responses, we examined whether our M. smegmatis construct capable of expressing PE-PGRS62 could modulate the macrophage cytokine response. Assessment of transcript levels for TNF-α, IL-1β, IL-12p40 and IL-10 in infected macrophages showed no significant differences in cells infected with either M. smegmatis expressing PE-PGRS62 or the M. marinum PE-PGRS62 orthologue transposon mutant when compared to control or complemented or wild-type strains (Fig. 4). Thus, while other members of the PE-PGRS family of proteins may modulate macrophage cytokine responses, our results do not support such a role for PE-PGRS62.

figure

Figure 4. Cytokine analysis of TNF-α, IL-12p40, IL-10 and IL-1β of J774A cells infected with either M. smegmatis expressing PE-PGRS62 or M. marinum deficient for the orthologue to PE-PGRS62 showed no significant differences when compared to cells infected with control uninduced bacteria or other control strains. Induced = expressing PE-PGRS62, Uninduced = no PE-PGRS62 expression, Tn = transposon mutant for PE-PGRS62 orthologue, Cm = complemented mutant, Wt = wild-type M. marinum.

Download figure to PowerPoint

PE-PGRS62 modulates iNOS protein expression in infected macrophages

The expression of iNOS and the formation of reactive nitrogen intermediates is a potent anti-mycobactericidal strategy utilized by macrophages to combat infection. To this end, we sought to determine if iNOS levels are differentially regulated in macrophages infected with M. smegmatis expressing PE-PGRS62. Immunoblotting of cell lysates at different times post infection indicated a significant decrease in the levels of iNOS protein in J774A cells infected with M. smegmatis expressing PE-PGRS62 (Fig. 5A). Moreover, this difference in iNOS expression appeared to be restricted to the protein level, as the levels of iNOS transcripts in M. smegmatis expressing PE-PGRS62-infected cells were not significantly different from those found in control-infected cells (Fig. 5B). Notably, J774A cells infected with the M. marinum transposon mutant for the PE-PGRS62 orthologue showed two- to threefold greater iNOS protein than did cells infected with either the wild-type or complemented strains (Fig. 5C). This difference in iNOS expression was again restricted to the protein level, as analysis of iNOS transcript levels showed no significant differences between the infected cell types (Fig. 5D). Taken together, these results show that PE-PGRS62 is able to downregulate iNOS expression in infected macrophages, and it does this at a post-transcriptional level.

figure

Figure 5. A. J774A cells infected with M. smegmatis expressing PE-PGRS62 showed significantly reduced iNOS protein expression when compared to cells infected with control uninduced bacteria. Blot is representative of five independent experiments. PE-PGRS62+ = bacteria induced to express PE-PGRS62, PE-PGRS62 = uninduced bacteria. The bar graph to the right shows densitometry of 24 h and 30 h time points from five independent experiments.**P < 0.01.

B. Analysis of iNOS transcript levels from cells infected with M. smegmatis expressing PE-PGRS62 showed no significant differences when compared to cells infected with control uninduced bacteria.

C. J774A cells infected with the M. marinum transposon mutant for the orthologue to PE-PGRS62 expressed two- to threefold more iNOS protein when compared to cells infected with wild-type or complemented strains. Blot is representative of three independent experiments. Tn = PE-PGRS62 orthologue transposon mutant, Cm = complemented strain, Wt = wild-type strain. The bar graph to the right shows densitometry from three independent experiments. *P < 0.05.

D. Analysis of iNOS transcript levels from cells infected with the M. marinum transposon PE-PGRS62 orthologue mutant shows no significant differences when compared to cells infected with wild-type or complemented strains.

Download figure to PowerPoint

M. smegmatis expressing PE-PGRS62 and the M. marinumPE-PGRS62 orthologue transposon mutant display altered colony morphology

A previous study found that overexpression of the PGRS domain of Rv1818c in M. smegmatis and M. tuberculosis modified bacterial cell structure (Delogu et al., 2004). To assess any changes in colony morphology related to PE-PGRS62 expression, we spotted equal amounts of M. smegmatis induced to express PE-PGRS62 and uninduced control bacteria onto 7H10 agar plates supplemented with Middlebrook OADC enrichment. The results showed significant (Fig. 6A) colony morphology differences in M. smegmatis induced to express PE-PGRS62, and these disappeared upon growth on solid media in which Tween-80 had been added. In addition, the M. marinum transposon mutant for the PE-PGRS62 orthologue showed a smaller colony diameter when grown on plates in which Tween-80 had been added (Fig. 6B) when compared to its growth on medium lacking Tween-80, and with the wild-type and complemented strains.

figure

Figure 6. A. M. smegmatis expressing PE-PGRS62 shows differences in colony morphology when compared to bacteria containing empty vector. Induced = plates containing acetamide, which induces PE-PGRS62 expression, Uninduced = plates containing dextrose, which does not induce PE-PGRS62 expression. Bacteria grown on plates containing Tween-80 do not display appreciable differences in colony morphology.

B. The M. marinum transposon mutant for the PE-PGRS62 orthologue (Tn PE-PGRS62) shows growth retardation on plates containing Tween-80 when compared to wild-type (wt) or complemented strains (Cm PE-PGRS62).

C. The M. marinum transposon mutant for the PE-PGRS62 orthologue shows sensitivity to detergent. Bacteria were grown in liquid media with 0.1% SDS, and aliquots were plated for CFU enumeration. Graph depicts CFU ml−1 from three independent experiments. *P < 0.05.

Download figure to PowerPoint

The M. marinum transposon mutant for the orthologue to PE-PGRS62 shows sensitivity to SDS

To evaluate whether the phenotype displayed by the M. marinum PE-PGRS62 orthologue transposon mutant could be attributed to detergent sensitivity leading to impaired colony growth, we conducted an SDS resistance assay. Wild-type, complemented and mutant M. marinum were grown in Middlebrook 7H9 liquid culture that had been supplemented or not with 0.1% SDS. After 24 h of incubation, aliquots were taken and plated onto Middlebrook 7H10 solid medium supplemented with OADC. Enumeration of the colony-forming units (CFU) on the plates indicated that the PE-PGRS62 orthologue transposon mutant displayed a 30–40% reduction in survival when compared to wild type and complemented mutant (Fig. 6C). This suggests that loss of PE-PGRS62 expression results in significant changes to cell wall composition, rendering the mutant more susceptible to detergent. However, thin layer chromatography of cell wall lipids from both M. smegmatis expressing PE-PGRS62 and the M. marinum transposon mutant showed no obvious differences when compared to M. smegmatis control, and M. marinum wild type and complemented mutant respectively (data not shown). Taken together, these results suggest that PE-PGRS62 expression modulates cell wall integrity, which may or may not involve subtle changes in cell wall lipid composition. This is the focus of ongoing studies.

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Interest in the potential functions of mycobacterial PE-PGRS proteins is currently the focus of active research. PE/PPE proteins are estimated to make up approximately 10% of the coding potential of the M. tuberculosis and M. marinum genomes and have been implicated in virulence (Ramakrishnan et al., 2000; Brennan et al., 2001; Banu et al., 2002; Delogu et al., 2004); however, detailed information regarding the specific functions of these proteins is scarce. The high sequence variability between members of the PE/PPE family has been suggested to act as a form of antigenic variation to aid in mycobacterial immune evasion (Cole et al., 1998; Banu et al., 2002; Talarico et al., 2005). Microarray data of PE/PPE gene expression have shown that individual proteins of this family are variably regulated by different growth conditions and do not appear to be regulated as a group (Voskuil et al., 2004). The authors of this study viewed this as support for PE/PPE protein function in antigenic variation. However, an alternative explanation is that variability in expression could also reflect the fact that specific PE/PPE proteins may have discrete functions and are regulated by different environmental cues. PE-PGRS62 does not appear to contain the glycine–alanine or glycine–asparagine repeats typical of PE-PGRS proteins in its C-terminal domain (Delogu et al., 2008), suggesting that this protein may possess functions unique to PE-PGRS proteins. Indeed, recent studies have indicated specific roles for PE-PGRS proteins such as PE-PGRS11 (implicated in mediating mycobacterial resistance to oxidative stress) (Chaturvedi et al., 2010), PE-PGRS63 (lipase activity) (Deb et al., 2006) and PE-PGRS30 (inhibition of phagosome maturation) (Iantomasi et al., 2012). Interestingly, like PE-PGRS62, PE-PGRS30 is atypical of PE-PGRS proteins as this protein also contains a unique C-terminal domain (Iantomasi et al., 2012). However, beyond these studies, there is very limited information available about the functional activities of PE-PGRS proteins and their roles in host–pathogen interactions. In the present study, we identified two novel roles for PE-PGRS62 specifically in mediating phagosome maturation arrest and in inhibition of macrophage iNOS expression.

Our results show that M. smegmatis expressing PE-PGRS62 was able to inhibit phagosome maturation post Rab5 acquisition by blocking the acquisition of Rab7 (Fig. 3A). This was accompanied by a corresponding deficit in LAMP-1 recruitment to phagosomes containing PE-PGRS62 positive M. smegmatis (Fig. 3B). The phenotype of the arrested M. tuberculosis phagosome has previously been shown to involve a block at the junction between Rab5 loss and Rab7 acquisition onto the phagosome membrane (Xu et al., 1994; de Chastellier et al., 1995; Clemens and Horwitz, 1995; Deretic and Fratti, 1999). Thus, it is striking that the sole expression of PE-PGRS62 in M. smegmatis was sufficient to recapitulate the phenotype of maturation arrest brought about by infection with M. tuberculosis per se. Regarding potential underlying mechanisms, subcellular fractionation analysis showed localization of PE-PGRS62 in the mycobacterial cell wall (Fig. 2B), which renders it accessible to macrophage host proteins. Thus, it is possible that PE-PGRS62 may interact with host phagocytic receptors or phagosomal proteins, thereby disrupting critical interactions between endosomal vesicles. Although a previous study had suggested that PE-PGRS62 from Mycobacterium bovis inhibits phagosome maturation, the authors based this conclusion solely on PE-PGRS62 effects on CD63 total cellular expression, and did not examine recruitment of markers to phagosomes directly (Huang et al., 2012). Hence, no conclusions could be drawn regarding phagosome maturation. On the other hand, our results, examining Rab5, Rab7, Cathepsin D and LAMP-1 recruitment to phagosomes (Fig. 3), provide the first direct evidence that PE-PGRS62 modulates phagosome maturation.

In addition to its role in blocking phagosome maturation, macrophages infected with PE-PGRS62 expressing M. smegmatis showed a deficiency in induction of iNOS when compared to cells infected with control bacteria (Fig. 5A). This implicates PE-PGRS62 in modulating the macrophage nitric oxide response. In support of this, macrophages infected with the M. marinum transposon mutant for the PE-PGRS62 orthologue expressed two- to threefold more iNOS protein when compared to cells infected with wild-type bacteria (Fig. 5C). Reinstatement of PE-PGRS62 orthologue expression to the transposon mutant resulted in restoration of decreased iNOS levels, as macrophages infected with the complemented strain show similar levels of iNOS protein expression when compared to cells infected with wild-type bacteria (Fig. 5C). Remarkably, these differences in iNOS protein levels did not appear to be due to differential induction of iNOS gene transcription. Assessment of transcript levels in macrophages infected with the M. marinum PE-PGRS62 orthologue transposon mutant, wild-type or complemented strains showed no significant differences in levels of iNOS transcripts. Nor could we detect any differences in cytokine expression profiles (Fig. 4) which could be expected to affect iNOS gene expression. Macrophages infected with M. smegmatis expressing PE-PGRS62 also displayed similar levels of iNOS and cytokine transcripts when compared to cells infected with control bacteria (Figs 5B and 4 respectively). Our finding that PE-PGRS62 expression did not affect levels of iNOS transcripts in infected cells is consistent with a previous study examining murine macrophages infected with M. smegmatis expressing PE-PGRS62 from M. bovis (Huang et al., 2010). The authors of this study found that iNOS mRNA levels did not change upon PE-PGRS62 expression; however, they did not examine iNOS protein expression (Huang et al., 2010). We have found that despite the fact that iNOS mRNA levels did not change significantly upon PE-PGRS62 expression, iNOS protein levels were clearly reduced. These results suggest that PE-PGRS62 modulates iNOS expression at a post-transcriptional stage, possibly through iNOS protein proteasomal degradation or translational regulation. The mechanism of PE-PGRS62-mediated inhibition of iNOS protein expression is currently being investigated.

Subcellular localization analysis identified PE-PGRS62 as being present on the cell wall of M. smegmatis when it was ectopically expressed (Fig. 2B). Although ESX-5-mediated secretion has been identified as being necessary for PE-PGRS protein secretion in M. marinum, M. smegmatis lacks the ESX-5 locus (Abdallah et al., 2006; 2009). This suggests that PE-PGRS62 may be one of several PE-PGRS proteins which do not require ESX-5 for secretion to the cell wall. Other precedents for this include: PE-PGRS11, PE-PGRS33 (Rv1818c) and Rv1917c (Sampson et al., 2001; Delogu et al., 2004; Chaturvedi et al., 2010). In silico analysis of the amino acid sequence for PE-PGRS62 using SignalP [version 4.0 (Petersen et al., 2011)] did not indicate the presence of an N-terminal peptide signal sequence for Sec-dependent translocation (data not shown), suggesting that PE-PGRS62 may be delivered to the mycobacterial cell surface through some other translocation system.

In the context of any discussion regarding PE-PGRS62-mediated effects on phagosome maturation arrest and inhibition of iNOS expression, it is important to note that both M. smegmatis expressing PE-PGRS62 and the M. marinum transposon mutant displayed significant differences in colony morphology when compared to control, wild-type and complemented strains. The M. marinum transposon mutant for the orthologue to PE-PGRS62 showed significant growth impairment on solid media containing Tween-80, and had reduced survival when grown in medium containing SDS (Fig. 6B and C). This sensitivity to the addition of detergent is similar to that seen for the mmaA4 M. tuberculosis mutant lacking the ability to impart distal oxygen-containing modifications to its mycolic acids (Dao et al., 2008). Thus, sensitivity to Tween-80 may suggest significant changes to the cell wall structure. Expression of PE-PGRS62 in M. smegmatis also resulted in notable differences in colony morphology when compared to control (Fig. 6A), which again suggests that cell wall structure may be modified. However, we cannot exclude the possibility that some of this differential colony morphology may have been due to overexpression of the protein. The absence of endogenous PE-PGRS62 in M. smegmatis makes this scenario somewhat less likely. It has also been observed previously that expression of other PE-PGRS proteins in M. smegmatis (PE-PGRS11, PE-PGRS33) also resulted in changes to colony morphology (Delogu et al., 2004; Chaturvedi et al., 2010), although the qualitative morphological changes observed in each case were distinct. It is tempting to speculate that PE-PGRS62 (and PE-PGRS11 and 33) modulate some aspects of mycobacterial cell wall structure or composition which may contribute to virulence. Our initial results with thin layer chromatography analysis of cell wall lipids suggested that there were no observable differences in lipid composition brought about by either the gain or loss of PE-PGRS62 expression (data not shown). However, the relative proportions of the lipid groups were chemically detected (Besra, 1998), and although this technique can reveal major changes in lipids, it is not as sensitive as results obtained after radiochemical labelling of cultures. Thus, there is a possibility that small changes in lipids may have occurred upon PE-PGRS62 loss or gain of expression that we could not detect. However, our results do show that PE-PGRS62 loss or gain of expression brings about significant changes to colony morphology and cell wall integrity (Fig. 6), and these changes appear to be independent of significant changes to lipid composition. The expression of PE-PGRS62 was sufficient to confer upon M. smegmatis the ability to block phagosome maturation and impair iNOS expression. Whether the mechanism behind these two phenotypes is the result of differential cell wall structure or composition is the subject of ongoing investigation.

In conclusion, our results assign novel roles for PE-PGRS62 in mediating mycobacterial virulence. PE-PGRS62 is able to inhibit phagosome maturation in infected macrophages and in parallel, impair iNOS expression, thereby defusing two important microbicidal strategies in the macrophage arsenal. This dynamic combination of phagosome maturation block and nitric oxide evasion is all the more remarkable in that it appears to require only the expression of this one PE-PGRS protein to bring about these phenotypes. PE-PGRS62 thus represents an important mycobacterial virulence factor in the ongoing battle between host and pathogen.

Experimental procedures

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Cell culture and bacterial strains

The murine macrophage cell line J774A was obtained from the American Type Culture Collection (ATCC TIB-67) and was cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 4500 mg l−1 glucose and L-glutamine (Sigma). M. smegmatis mc2155 was a kind gift from Dr Horacio Bach (University of British Columbia). The M. marinum wild-type M strain, L1D transposon mutant and the complemented L1DT strain were kind gifts from Dr Lalita Ramakrishnan (University of Washington).

PEPSY plasmid genomic library construction

The genomic library used for PEPSY screening was constructed in a similar manner as described previously for L. pneumophila (Shohdy et al., 2005). Briefly, genomic DNA from M. tuberculosis strain H37Rv was isolated and subjected to incomplete digestion with the restriction enzyme Sau3AI for 15 min at 37°C. Digested DNA was then run out on an agarose gel and fragments between 0.8 and 5 kb were gel extracted and purified. These fragments were then ligated into the pWS93 yeast expression vector (a kind gift from Dr Marion Carlson, Columbia University) that had been previously linearized by BamHI/BglII digestion. This vector allows the constitutive expression of inserts under the alcohol dehydrogenase (ADH1) promoter. The resulting ligation reactions were then transformed into the Escherichia coli strain DH5α, and the resulting colonies were pooled together and a plasmid maxiprep performed to isolate plasmids. This resulted in a collection of heterogenous plasmids, which were then used to transform the yeast strain NSY01.

Yeast transformation

The yeast strain NSY01 was obtained as a kind gift from Dr Howard Shuman (Columbia University). This yeast strain expresses a carboxypeptidase Y/invertase (CPY/Inv) fusion protein. Carboxypeptidase Y (and CPY/Inv) is normally trafficked from the late Golgi apparatus to the yeast vacuole. Disruption of this VPS pathway in the yeast by ectopic expression of a pathogen virulence factor results in altered protein sorting and release of CPY/Inv into the extracellular medium, where its presence can be detected by overlaying yeast colonies with agar containing glucostat reagent [125 mM sucrose, 100 mM sodium acetate (pH 5.5), 0.5 mM N-ethylmaleimide, 10 μg ml−1 horseradish peroxidase, 8 units ml−1 glucose oxidase and 2 mM O-dianisidine]. NSY01 was streaked onto a yeast–peptone–fructose (YPF) agar plate from glycerol stock and incubated at 30°C for 3 days until colonies appeared. One of these colonies was selected and grown in 5 ml of YPF media supplemented with 50 μg ml−1 adenine hemisulfate (YPAF) at 30°C with shaking at 200 r.p.m. overnight. An optical density reading at 600 nm (OD600) of the overnight culture was then taken and 1.25 × 108 cells were then taken to inoculate 25 ml of YPAF fresh culture to give a cell titre of 5 × 106 cells ml−1. This culture was incubated at 30°C with shaking at 200 r.p.m. for 2 h, or until cells had doubled. Cells were then harvested by centrifugation at 4500 g for 6 min. The cell pellet was washed with 12.5 ml of sterile ddH2O, and centrifuged again. The resulting pellet was then resuspended in 0.5 ml of sterile ddH2O and transferred to a sterile 1.5 ml microcentrifuge tube. This cell suspension was then centrifuged at maximum speed in a microcentrifuge for 30 s, after which the supernatant was discarded and the cell pellet resuspended in 0.5 ml of sterile ddH2O by vigorous vortexing. One hundred microlitres of this cell suspension was then aliquoted into microcentrifuge tubes (one per transformation reaction), which were then centrifuged at maximum speed in a microcentrifuge for 30 s and the supernatant discarded. Cell pellets were resuspended in a transformation mix made up of 240 μl of PEG 3350 (50% w/v), 0.1 M lithium acetate, 278 μg ml−1 boiled salmon testes denatured DNA, 300 ng of plasmid, and sterile ddH2O to make up a total transformation volume of 360 μl. Empty vector and control transformations without vector were included. Cells were resuspended in transformation mixes by vigorous vortexing, and tubes were incubated at 42°C for 40 min, after which tubes were centrifuged at maximum speed in a microcentrifuge for 30 s and the supernatant removed. Cell pellets were resuspended in 1 ml of sterile ddH2O, and 150 μl was plated onto synthetic complete medium lacking uracil (SC-Ura) with fructose added as a carbon source and incubated at 30°C for ∼3 days until colonies appeared.

Yeast library screening

Positive colonies were selected based on brown colouration when plates were overlaid with glucostat reagent. Brown colonies were picked, then grown in 5 ml of SC-Ura liquid media with fructose added as the carbon source at 30°C with shaking at 200 r.p.m. overnight. A yeast plasmid miniprep was then performed on these liquid cultures (Omega Biotek). The isolated plasmids were then used to transform DH5α E. coli in order to obtain adequate plasmid quantities for a second yeast transformation. Plasmids were isolated from transformed DH5α and used to transform NSY01 yeast, which were then screened again with glucostat reagent to confirm that the trafficking defect phenotype seen in these yeast clones was attributable to the plasmids they were carrying, and not to spontaneous mutations in VPS trafficking.

Construction of M. smegmatis expressing PE-PGRS62

The full-length gene for PE-PGRS62 (Rv3812) was initially amplified from M. tuberculosis genomic DNA using the forward primer 5′-GTGTCGTTCGTGGTCACAGTGC-3′ and reverse primer 5′-AGCCGCCGGTTTGATTGC-3′. After obtaining the 1539 bp PCR product corresponding to the full-length gene, subsequent PCRs were performed to place flanking sequences which allowed the PE-PGRS62 gene to be cloned into the gateway vector pJAK2.D, a kind gift from Dr Zakaria Hmama (Sun et al., 2009). The primers used for cloning are summarized in Table 1. The pJAK2.D-PE-PGRS62 plasmid was then transformed into M. smegmatis mc2155 by established methods (Snapper et al., 1990).

Table 1. Primer sequences used for PE-PGRS62 (Rv3812) cloning into pJAK2.D (highlighted sequence for gateway cloning)
Primer nameSequence (5′-3′)
3812 forwardGTGTCGTTCGTGGTCACAGTGC
3812 reverseCTAAGCCGCCGGTTTGATTGCCAGG
Forward gatewayGGGGACAAGTTTGTACAAAAAAGCAGGCTTCGTGTCGTTCGTGGTCACAGTGC
Reverse gatewayGGGGACCACTTTGTACAAGAAAGCTGGGTCCTAAGCCGCCGGTTTGATTGCCAGG

Expression testing

A 6× histidine tag was placed at the N-terminus of full-length PE-PGRS62 in order to facilitate protein detection. To confirm expression of fusion protein, M. smegmatis clones were grown in 7H9/ADC/0.02% Tween-80 media with 25 μg ml−1 kanamycin overnight at 37°C with shaking at 150 r.p.m. Bacteria were then pelleted by centrifugation at 13 000 g for 1 min, and washed three times with 7H9 media with 0.02% Tween-80. The resulting pellets were then resuspended in 7H9/Tween-80 and divided evenly into two cultures which contained 7H9/Tween-80 supplemented with either 0.2% dextrose or 0.2% acetamide to induce fusion protein expression. These cultures were grown overnight at 37°C with shaking at 150 r.p.m., after which bacteria were pelleted, washed twice with PBS and resuspended in denaturing lysis buffer containing 100 mM NaH2PO4, 10 mM Tris-Cl and 8 M urea. Resuspended bacteria were then sonicated on ice for 10 s followed by 10 s rests for a total of 10 times. Following sonication, cell debris was then pelleted by centrifugation at 13 000 g for 1 min, and SDS loading buffer added to the isolated supernatant. This was then boiled prior to loading onto a 10% SDS-PAGE. After separation, proteins were transferred to nitrocellulose (Bio-Rad) and an immunoblot was performed with an antibody specific for the histidine epitope tag (Applied Biological Materials).

Subcellular fractionation of M. smegmatis

Subcellular fractionation of M. smegmatis was performed as has been described previously (Dahl et al., 2001). To examine the subcellular localization of PE-PGRS62 fusion protein, a 150 ml culture of 7H9/ADC/Tween-80 was inoculated with M. smegmatis expressing PE-PGRS62 and was grown overnight at 37°C with shaking at 150 r.p.m. Bacteria were then pelleted, washed three times with 7H9/Tween-80, resuspended in 10 ml of 7H9/Tween-80 and divided evenly between two 75 ml cultures of 7H9/Tween-80 supplemented with either 0.2% dextrose or 0.2% acetamide. These cultures were then grown overnight at 37°C with shaking at 150 r.p.m., after which bacteria were harvested by centrifugation at 5000 g for 10 min. Subsequent steps were performed on ice or at 4°C. Bacterial pellets were resuspended in 2 ml of breaking buffer (PBS, 1 mM PMSF, 0.6 μg ml−1 each of DNase and RNase) and sonicated with 10 × 10 s pulses, with 10 s rests in between pulses. Lysates were then pelleted at 3000 g for 20 min to generate clarified whole cell lysates. The supernatants were then removed and centrifuged at 27 000 g for 30 min to obtain the cell wall pellet. The supernatant from this was then centrifuged again at 100 000 g for 2 h to separate the membrane fraction from the cytosolic fraction. Pellets from the cell wall and cell membrane centrifugation steps were washed once with PBS. Samples from each of the fractions were then resuspended in SDS loading buffer, boiled and loaded onto 10% SDS-PAGE. After separation, proteins were transferred to nitrocellulose membrane and an immunoblot was performed with an antibody specific for the histidine tag epitope (Applied Biological Materials).

Cytokine profiling of J774A macrophages infected with M. smegmatis expressing PE-PGRS62

J774A cells were infected with M. smegmatis induced to express PE-PGRS62 or not in order to compare the expression of IL-1β, IL-10 and IL-12p40 upon infection. A total of 0.5 × 106 J774A cells were placed in each well of a six-well culture plate and incubated overnight at 37°C/5% CO2 to allow plate attachment. Five millilitres of cultures of M. smegmatis in 7H9/Tween-80 supplemented with either 0.2% dextrose (for uninduced, control bacteria) or 0.2% acetamide (to induce PE-PGRS62 expression) were made and incubated overnight at 37°C with shaking at 150 r.p.m. The next day, OD600 readings of the bacterial cultures were taken, and the number of bacteria required to infect J774A cells at a multiplicity of infection ratio of 20:1 was calculated. The required amount of bacteria was then washed three times with plain DMEM media (no fetal bovine serum added) and then resuspended in an adequate volume of complete DMEM media to allow 1 ml of this resuspension to be given to each well of the six-well plates. Cells were allowed to phagocytose bacteria for 2 h, then were washed in warm PBS and given complete media with 50 μg ml−1 gentamycin. Cells were incubated for the required times, after which they were washed three times with cold PBS, scraped off and centrifuged at 3000 g for 2 min. The supernatant was pipetted off, and the cell pellets were resuspended in lysis buffer supplied with the E.Z.N.A. total RNA isolation kit (Omega Biotek). RNA was subsequently isolated as per manufacturer's protocol. Equal amounts of RNA were then used in first strand cDNA synthesis reactions using the cDNA synthesis kit from Invitrogen. The cDNA produced was then used as template for PCR reactions using primers specific for IL-1β (forward primer 5′-AAGGAGAACCAAGCAACGACAAAA-3′, reverse primer 5′-TGGAGCAACAAGTGGTGTTCTCCA-3′), IL-10 (forward primer 5′-AGAAGCATGGCCCAGAAATCA-3′, reverse primer 5′-GGCCTTGTAGACACCTTGGT-3′), IL-12p40 (forward primer 5′-TGGTTTGCCATCGTTTTGCTG-3′, reverse primer 5′-AGAAACAGTGAACCTCACCTGT-3′) and TNF-α (forward primer 5′-CTGAACTTCGGGGTGATCGG-3′, reverse primer 5′-GGCTTGTCACTCGAATTTTGAGA-3′). Signals were normalized to that obtained for mouse glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (forward primer 5′-TGACCACAGTCCATGCCATC-3′, reverse primer 5′-GACGGACACATTGGGGGTAG-3′).

Phagosome isolation and immunoblotting

Phagosomes were purified by ultracentrifugation on a 27% percoll density gradient as has been described previously (Ramachandra et al., 2001). Briefly, cells were infected as described above. After 6 h of infection, cells were harvested by washing three times with cold PBS. J774A cells were then isolated by scraping into cold PBS and centrifugation at 600 g for 10 min. Supernatants were decanted and cell pellets were resuspended in ice-cold homogenization buffer (10 mM Hepes, 25 mM sucrose) supplemented with protease inhibitor mix cocktail (Roche). Cells were homogenized by passage through a 271/2 gauge needle 80 times and intact cells and nuclei were pelleted by centrifugation at 2000 g for 5 min at 4°C. Supernatants containing phagosomes were transferred to new tubes and the centrifugation step repeated a total of three times. Cleared supernatants were then layered on top of a 27% percoll density gradient made up in homogenization buffer and ultracentrifuged in a swinging bucket rotor 36 000 g for 1 h at 4°C. The bottommost 3 ml were then taken and centrifuged for 2 min at 13 000 g to pellet phagosomes, which were then resuspended in 1× SDS loading buffer (63 mM Tris-Cl, pH 6.8, 715 mM 2-mercaptoethanol, 2% SDS, 20% glycerol) and boiled prior to running in 12.5% SDS-PAGE. Following transfer onto nitrocellulose, blots were probed with antibodies against Rab5 or Cathepsin D (G-19 clone) (Santa Cruz Biotechnology) or Rab7 (Abcam).

Confocal analysis of LAMP-1 colocalization

J774A were seeded onto glass coverslips and infected with M. smegmatis induced for PE-PGRS62 expression as described above. After 2 h, cells were washed three times with warm PBS and were given complete media supplemented with 50 μg ml−1 gentamycin. Cells were incubated at 37°C/5% CO2 for 6 h and 24 h, followed by overnight fixation with 2% paraformaldehyde at 4°C. Cells fixed onto coverslips were then washed three times with PBS, permeabilized with 0.1% Triton X-100 for 10 min, washed three times with PBS, and blocked with 1% BSA in PBS with 0.05% Tween-20 for 30 min, followed by an overnight incubation with an antibody against murine LAMP-1 (obtained from the Developmental Studies Hybridoma Bank) at 4°C. After washing with PBS, an anti-rat secondary antibody conjugated to FITC (eBiosciences) was used to detect antibody binding, and coverslips were mounted on Prolong® Gold antifade reagent with added DAPI stain (Invitrogen) to allow detection of bacteria within cells. Z-stacks of cells were imaged using a Leica DMIRE2 inverted microscope equipped with a SP2 AOBS laser scanning head. Images were processed using the MacBiophotonics version of the Image J software (National Institutes of Health) and colocalization analysis was conducted using the Colocalization Highlighter plugin (P. Bourdoncle, Institute Jacques Monod, Service Imagerie, Paris, France). Quantification was performed by counting the number of complete colocalization events; at least 300 phagosomes were counted for each of three experiments (∼900–1000 phagosomes in total).

Examining iNOS levels in infected cells

Cells were infected with M. smegmatis expressing PE-PGRS62 as described in the preceding section. At the required times, cells were washed three times with cold PBS, and scraped into 240 μl of ice-cold lysis buffer (20 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 mM Na2EDTA, 1 mM EGTA, 1% Triton X-100, 2.5 mM sodium pyrophosphate, 1 mM β-glycerophosphate, 1 mM Na3VO4, 1 μg ml−1 leupeptin and 1 mM PMSF). Cell suspensions were incubated on ice for 5 min, then passaged through a 271/2 gauge needle 10 times. Eighty microlitres of 4× SDS loading buffer was then added to each suspension, which were vortexed and centrifuged at 13 000 g for 10 min at 4°C. Supernatants were removed and loaded onto 10% SDS-PAGE for separation. Proteins were then transferred to nitrocellulose membrane and an immunoblot was performed with an antibody against iNOS protein (Santa Cruz Biotechnology).

The M. marinum PE-PGRS62 orthologue transposon mutant, complemented and wild-type strains were obtained as a kind gift from Dr Lalita Ramakrishnan from the University of Washington. For infections with the M. marinum transposon mutant for PE-PGRS62, as well as complemented and wild-type strains, bacteria were grown in Sauton's media supplemented with 0.2% Tween-80 and 30 μg ml−1 kanamycin (for complemented and PE-PGRS62 transposon mutant strains) until an OD600 reading of ∼0.8–1.0 was reached. The required amount of bacteria needed to achieve a multiplicity of infection of 20:1 was then taken, washed three times with PBS and resuspended in complete DMEM medium. Cells were infected for 4 h, after which they were washed three times with warm PBS and given fresh media supplemented with 20 U ml−1 murine IFN-γ and 20 μg ml−1 amikacin. Cells were then incubated for the required times, harvested and processed as described above for M. smegmatis infections.

To examine levels of iNOS transcripts, cells were infected as described and were harvested as described previously. The resulting cDNA products were used in PCR reactions using primers specific for murine iNOS (forward primer 5′-ACATCGACCCGTCCACAGTAT-3′, reverse primer 5′-CAGAGGGGTAGGCTTGTCTC-3′). Again, signals were normalized to that of murine GAPDH.

Analysis of colony morphology

7H9/Tween-80 cultures of M. smegmatis containing empty vector as well as the plasmid for PE-PGRS62 expression were induced as described previously, and grown overnight at 37°C with shaking at 150 r.p.m. Cultures were diluted to OD600 of 0.01, and 5 and 10 μl of each culture was spotted onto 7H10 agar plates supplemented with 25 μg ml−1 kanamycin, and either 0.2% dextrose or 0.2% acetamide. To one set of plates, 0.05% Tween-80 was added. Plates were then incubated at 37°C until colonies appeared (∼2 days).

To examine the colony morphology of M. marinum strains, bacteria were grown in Sauton's media supplemented with 0.2% Tween-80. Cultures were then diluted to OD600 of 0.01, and 10 μl of each culture was spotted onto 7H10 agar plates supplemented with 10% (v/v) Middlebrook OADC (Becton Dickinson), with or without 0.05% Tween-80. Plates were incubated at 30°C until colonies appeared (∼7–10 days).

SDS resistance assay

Wild-type, complemented and mutant M. marinum were grown in Middlebrook 7H9 liquid culture supplemented with 10% (v/v) Middlebrook OADC and 30 μg ml−1 kanamycin (for transposon mutant and complemented strains) until OD600 ∼0.5–0.7. Cultures were diluted to OD600 = 0.1 and a final concentration of 0.1% SDS was then added to these cultures, which were grown at 30°C. Aliquots were taken out at 0 h (initial) and 24 h of incubation and plated onto Middlebrook 7H10 solid medium supplemented with OADC. The number of CFU at 0 h was subtracted from CFU at 24 h and the results expressed as CFU ml−1.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

We thank Dr Gurdyal Besra and his laboratory for their assistance in conducting the lipid analysis. We would also like to thank David Lee, Farshaad Bilimoria, Jacky Yeung and Marisa Thi for their help in validating candidates from the yeast screen, and members of the Reiner laboratory for insightful discussions. We are also grateful to Drs Anaximandro Gomez-Velasco and Yossef Av-Gay for their helpful suggestions on assessing mycobacterial morphological defects. The authors declare no potential conflicts of interest.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  • Abdallah, A.M., Verboom, T., Hannes, F., Safi, M., Strong, M., Eisenberg, D., et al. (2006) A specific secretion system mediates PPE41 transport in pathogenic mycobacteria. Mol Microbiol 62: 667679.
  • Abdallah, A.M., Savage, N.D., van Zon, M., Wilson, L., Vandenbroucke-Grauls, C.M., van der Wel, N.N., et al. (2008) The ESX-5 secretion system of Mycobacterium marinum modulates the macrophage response. J Immunol 181: 71667175.
  • Abdallah, A.M., Verboom, T., Weerdenburg, E.M., Gey van Pittius, N.C., Mahasha, P.W., Jimenez, C., et al. (2009) PPE and PE_PGRS proteins of Mycobacterium marinum are transported via the type VII secretion system ESX-5. Mol Microbiol 73: 329340.
  • Banu, S., Honore, N., Saint-Joanis, B., Philpott, D., Prevost, M.C., and Cole, S.T. (2002) Are the PE-PGRS proteins of Mycobacterium tuberculosis variable surface antigens? Mol Microbiol 44: 919.
  • Besra, G.S. (1998) Preparation of cell-wall fractions from mycobacteria. In Methods in Molecular Biology, Mycobacteria Protocols. Parish, T. , and Stoker, N.G. (eds). Totowa, NJ: Humana Press, pp. 91107.
  • Bowers, K., and Stevens, T.H. (2005) Protein transport from the late Golgi to the vacuole in the yeast Saccharomyces cerevisiae. Biochim Biophys Acta 1744: 438454.
  • Brennan, M.J., Delogu, G., Chen, Y., Bardarov, S., Kriakov, J., Alavi, M., et al. (2001) Evidence that mycobacterial PE_PGRS proteins are cell surface constituents that influence interactions with other cells. Infect Immun 69: 73267333.
  • Campodonico, E.M., Chesnel, L., and Roy, C.R. (2005) A yeast genetic system for the identification and characterization of substrate proteins transferred into host cells by the Legionella pneumophila Dot/Icm system. Mol Microbiol 56: 918933.
  • Cascioferro, A., Delogu, G., Colone, M., Sali, M., Stringaro, A., Arancia, G., et al. (2007) PE is a functional domain responsible for protein translocation and localization on mycobacterial cell wall. Mol Microbiol 66: 15361547.
  • de Chastellier, C., Lang, T., and Thilo, L. (1995) Phagocytic processing of the macrophage endoparasite, Mycobacterium avium, in comparison to phagosomes which contain Bacillus subtilis or latex beads. Eur J Cell Biol 68: 167182.
  • Chaturvedi, R., Bansal, K., Narayana, Y., Kapoor, N., Sukumar, N., Togarsimalemath, S.K., et al. (2010) The multifunctional PE_PGRS11 protein from Mycobacterium tuberculosis plays a role in regulating resistance to oxidative stress. J Biol Chem 285: 3038930403.
  • Clemens, D.L., and Horwitz, M.A. (1995) Characterization of the Mycobacterium tuberculosis phagosome and evidence that phagosomal maturation is inhibited. J Exp Med 181: 257270.
  • Cole, S.T., Brosch, R., Parkhill, J., Garnier, T., Churcher, C., Harris, D., et al. (1998) Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 393: 537544.
  • Dahl, J.L., Wei, J., Moulder, J.W., Laal, S., and Friedman, R.L. (2001) Subcellular localization of the Iitracellular survival-enhancing Eis protein of Mycobacterium tuberculosis. Infect Immun 69: 42954302.
  • Dao, D.N., Sweeney, K., Hsu, T., Gurcha, S.S., Nascimento, I.P., Roshevsky, D., et al. (2008) Mycolic acid modification by the mmaA4 gene of M. tuberculosis modulates IL-12 production. PLoS Pathog 4: e1000081.
  • Deb, C., Daniel, J., Sirakova, T.D., Abomoelak, B., Dubey, V.S., and Kolattukudy, P.E. (2006) A novel lipase belonging to the hormone-sensitive lipase family induced under starvation to utilize stored triacylglycerol in Mycobacterium tuberculosis. J Biol Chem 281: 38663875.
  • Delogu, G., Pusceddu, C., Bua, A., Fadda, G., Brennan, M.J., and Zanetti, S. (2004) Rv1818c-encoded PE_PGRS protein of Mycobacterium tuberculosis is surface exposed and influences bacterial cell structure. Mol Microbiol 52: 725733.
  • Delogu, G., Cole, S.T., and Brosch, R. (2008) The PE and PPE protein families of Mycobacterium tuberculosis. In Handbook of Tuberculosis. Kaufmann, S.H. , and Rubin, E.J. (eds). Weinheim: Wiley-VCH, pp. 131150.
  • Deretic, V., and Fratti, R.A. (1999) Mycobacterium tuberculosis phagosome. Mol Microbiol 31: 16031609.
  • Gey van Pittius, N.C., Sampson, S.L., Lee, H., Kim, Y., van Helden, P.D., and Warren, R.M. (2006) Evolution and expansion of the Mycobacterium tuberculosis PE and PPE multigene families and their association with the duplication of the ESAT-6 (esx) gene cluster regions. BMC Evol Biol 6: 95.
  • Huang, Y., Wang, Y., Bai, Y., Wang, Z.G., Yang, L., and Zhao, D. (2010) Expression of PE_PGRS 62 protein in Mycobacterium smegmatis decrease mRNA expression of proinflammatory cytokines IL-1beta, IL-6 in macrophages. Mol Cell Biochem 340: 223229.
  • Huang, Y., Zhou, X., Bai, Y., Yang, L., Yin, X., Wang, Z., et al. (2012) Phagolysosome maturation of macrophages was reduced by PE_PGRS 62 protein expressing in Mycobacterium smegmatis and induced in IFN-gamma priming. Vet Microbiol 160: 117125.
  • Iantomasi, R., Sali, M., Cascioferro, A., Palucci, I., Zumbo, A., Soldini, S., et al. (2012) PE_PGRS30 is required for the full virulence of Mycobacterium tuberculosis. Cell Microbiol 14: 356367.
  • Lemmon, S.K., and Traub, L.M. (2000) Sorting in the endosomal system in yeast and animal cells. Curr Opin Cell Biol 12: 457466.
  • Lesser, C.F., and Miller, S.I. (2001) Expression of microbial virulence proteins in Saccharomyces cerevisiae models mammalian infection. EMBO J 20: 18401849.
  • Petersen, T.N., Brunak, S., von Heijne, G., and Nielsen, H. (2011) SignalP 4.0: discriminating signal peptides from transmembrane regions. Nat Methods 8: 785786.
  • Poteryaev, D., Datta, S., Ackema, K., Zerial, M., and Spang, A. (2010) Identification of the switch in early-to-late endosome transition. Cell 141: 497508.
  • Ramachandra, L., Noss, E., Boom, W.H., and Harding, C.V. (2001) Processing of Mycobacterium tuberculosis antigen 85B involves intraphagosomal formation of peptide-major histocompatibility complex II complexes and is inhibited by live bacilli that decrease phagosome maturation. J Exp Med 194: 14211432.
  • Ramakrishnan, L., Federspiel, N.A., and Falkow, S. (2000) Granuloma-specific expression of Mycobacterium virulence proteins from the glycine-rich PE-PGRS family. Science 288: 14361439.
  • Rink, J., Ghigo, E., Kalaidzidis, Y., and Zerial, M. (2005) Rab conversion as a mechanism of progression from early to late endosomes. Cell 122: 735749.
  • Russell, D.G., Dant, J., and Sturgill-Koszycki, S. (1996) Mycobacterium avium- and Mycobacterium tuberculosis-containing vacuoles are dynamic, fusion-competent vesicles that are accessible to glycosphingolipids from the host cell plasmalemma. J Immunol 156: 47644773.
  • Sampson, S.L., Lukey, P., Warren, R.M., van Helden, P.D., Richardson, M., and Everett, M.J. (2001) Expression, characterization and subcellular localization of the Mycobacterium tuberculosis PPE gene Rv1917c. Tuberculosis (Edinb) 81: 305317.
  • Shohdy, N., Efe, J.A., Emr, S.D., and Shuman, H.A. (2005) Pathogen effector protein screening in yeast identifies Legionella factors that interfere with membrane trafficking. Proc Natl Acad Sci USA 102: 48664871.
  • Snapper, S.B., Melton, R.E., Mustafa, S., Kieser, T., and Jacobs, W.R., Jr (1990) Isolation and characterization of efficient plasmid transformation mutants of Mycobacterium smegmatis. Mol Microbiol 4: 19111919.
  • Sturgill-Koszycki, S., Schlesinger, P.H., Chakraborty, P., Haddix, P.L., Collins, H.L., Fok, A.K., et al. (1994) Lack of acidification in Mycobacterium phagosomes produced by exclusion of the vesicular proton-ATPase. Science 263: 678681.
  • Sun, J., Lau, A., Wang, X., Liao, T.Y., Zoubeidi, A., and Hmama, Z. (2009) A broad-range of recombination cloning vectors in mycobacteria. Plasmid 62: 158165.
  • Talarico, S., Cave, M.D., Marrs, C.F., Foxman, B., Zhang, L., and Yang, Z. (2005) Variation of the Mycobacterium tuberculosis PE_PGRS 33 gene among clinical isolates. J Clin Microbiol 43: 49544960.
  • Voskuil, M.I., Schnappinger, D., Rutherford, R., Liu, Y., and Schoolnik, G.K. (2004) Regulation of the Mycobacterium tuberculosis PE/PPE genes. Tuberculosis (Edinb) 84: 256262.
  • World Health Organization Tuberculosis Data and Statistics (2011) Tuberculosis Data Sheet. http://www.who.int/tb/en/
  • Xu, S., Cooper, A., Sturgill-Koszycki, S., van Heyningen, T., Chatterjee, D., Orme, I., et al. (1994) Intracellular trafficking in Mycobacterium tuberculosis and Mycobacterium avium-infected macrophages. J Immunol 153: 25682578.