SEARCH

SEARCH BY CITATION

Keywords:

  • albino frog;
  • targeted gene knockout;
  • tyrosinase;
  • Xenopus tropicalis ;
  • zinc-finger nuclease

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

To generate albino lines of Xenopus tropicalis, we injected fertilized eggs with mRNAs encoding zinc-finger nucleases (ZFNs) targeting the tyrosinase coding region. Surprisingly, vitiligo was observed on the skin of F0 frogs that had been injected with ZFN mRNAs, indicating that both tyrosinase genes in the genome were disrupted in all melanocytes within the vitiligo patches. Mutation analysis using genomic DNA from the skin revealed that two mosaic F0 frogs underwent spatially complex tyrosinase gene mutations. The data implies that the ZFN-induced tyrosinase gene ablations occurred randomly over space and time throughout the entire body, possibly until the young tadpole stage, and that melanocyte precursors lacking functional tyrosinase proliferated and formed vitiligo patches. Several albino X. tropicalis, which are compound heterozygotes for biallelic tyrosinase mutations, were obtained by mating the mosaic F0 frogs. To our knowledge, this is the first report of the albino vertebrates generated by the targeted gene knockout.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

Gene knockout by homologous recombination in embryonic stem (ES) cells involves the characterization of altered phenotypes as a means of clarifying the functions of the ablated genes. Because of the difficulty in establishing ES cell lines from other species, this technology has only been used in the mouse genome (Chisaka & Capecchi 1991) and more recently, in the rat genome (Tong et al. 2011). The facile gene knockout technique, which is used to analyze gene function, is desired for use in other animals. The knockdown technique, which uses antisense morpholinos (Nasevicius & Ekker 2000), is effective for only the first few days of early development and is not useful for analyzing juvenile or adult phenotypes. TILLING is time-consuming because it requires the detection of a heterozygous point mutation at a locus of interest using a chemically mutagenized sperm DNA library, DNA sequencing to confirm the presence of nonsense mutations and artificial insemination with the corresponding sperm (Wienholds et al. 2002, 2003).

Zinc-finger nucleases (ZFNs) are fusion proteins comprised of a zinc-finger DNA-binding sequence and the nuclease domain from the restriction enzyme Fok I (Kim & Chandrasegaran 1994). ZFNs bind to target nucleotide sequences and introduce double-strand breaks, which are repaired by homologous recombination (Bibikova et al. 2001) and non-homologous end-joining (NHEJ). The target site may continue to be cut by the ZFN until NHEJ produces small deletions or insertions and alters the nucleotide sequence of the ZFN recognition site. When NHEJ results in a frame shift, a nonsense mutation, a deletion or a missense mutation that affects essential amino acids, the target gene product loses its function. ZFN-induced mutagenesis has been widely used for targeted mutagenesis in the fruit fly (Beumer et al. 2008), nematode (Morton et al. 2006), zebrafish (Doyon et al. 2008; Meng et al. 2008), frog (Young et al. 2011), sea urchin (Ochiai et al. 2010), silk worm (Takasu et al. 2010), Ciona intestinalis (Kawai et al. 2012) and medaka (Ansai et al. 2012).

Albinism is a condition found throughout the animal kingdom, including vertebrates. Tyrosinase is essential for melanin biosynthesis and converts tyrosine to dopaquinone in the initial step of the melanin-producing pathway. Tyrosinase-negative oculocutaneus albinism is an autosomal-recessive disease and characterized by a clinically undetectable level of melanin in skin, hair and eyes (Kinnear et al. 1985). This form of human albinism is comparable to the c-albino locus form in mouse that is caused by the loss of function of the tyrosinase gene (Beermann et al. 1990; Schedl et al. 1993). Therefore, it is reasonable that ZFN-induced knockout of the tyrosinase gene produces the albino phenotype.

Our goal is to promote further studies of Xenopus tropicalis (X. tropicalis) by establishing and distributing albino lines of X. tropicalis that may facilitate research techniques, such as in situ hybridization expression analysis and transplantation experiments (Kashiwagi et al. 2010). In the present study, we obtained albino X. tropicalis by injecting mRNAs encoding ZFNs that target the tyrosinase-coding region into fertilized eggs.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

Animals

The Ivory Coast line of X. tropicalis was provided by the National Bio-Resource Project (NBRP) of the MEXT, Japan. The fertilized eggs were obtained from pairs of male and female X. tropicalis after an injection of human chorionic gonadotropin. The tadpoles were reared in dechlorinated tap water (28°C) and fed Sera Micron (Sera). The frogs were maintained at 24°C. All animals were maintained and used in accordance with the guidelines established by Hiroshima University for the use and care of experimental animals.

Construction of zinc-finger nucleases

The design, assembly and MEL-1 assay of ZFNs were performed by Sigma-Aldrich as previously described (Urnov et al. 2005; Doyon et al. 2008). The obligate heterodimer form of the ZFN was used to reduce off-target effects (Miller et al. 2007).

Single-strand annealing assay

Inverse polymerase chain reaction (PCR) was performed to amplify the entire pRL-CMV vector (Promega), and LucF and LucR (Table 1) primers were used to obtain the pRL-CMV-single-strand annealing (SSA) vector containing the 5′ and 3′ inactive fragments of the Renilla luciferase gene with a 640-bp region of homologous overlap (Ochiai et al. 2010). The double-stranded ZFN target sequences (Table 1) were synthesized and inserted into the EcoR I and Xho I sites of the pRL-CMV-SSA vector.

Table 1. Oligonucleotide sequences used in the present study
OligonucleotideSequence (5′-3′)Description
Set-1FAATTGCCCTCAGTTTCCATTCTCTGGGGTTGACGATAGAZFN set-1 target sequence
Set-1RTCGATCTATCGTCAACCCCAGAGAATGGAAACTGAGGGC
Set-2FAATTGCCCTGGCACAGGTACTTCCTGCTGCACTGGGAACATGAGZFN set-2 target sequence
Set-2RTCGACTCATGTTCCCAGTGCAGCAGGAAGTACCTGTGCCAGGGC
Set-3FAATTCACAGGTACTTCCTGCTGCACTGGGAACATGAGATTCAGZFN set-3 target sequence
Set-3RTCGACTGAATCTCATGTTCCCAGTGCAGCAGGAAGTACCTGTG
LucFGACCTCGAGTGACATGGTAACGCGGCCTCConstruction of pRL-CMV-SSA
LucRGACGAATTCAGAATCCTGGGTCCGATTC
TyrFGTGAGGAGCAGCATGGAAMutation analysis
TyrRGCACCCCTACAACAGCCTTC

The cultured frog kidney cell line A6 was cotransfected with the ZFN-expressing plasmids, pRL-CMV-SSA reporter vector and pGL3-Control vector (Promega) (31.25 ng each) using 0.3 μL of FuGENE 6 Transfection Reagent (Roche) in each well of 24-well plates. After three days at 25°C, dual-luciferase assays were conducted using the Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer's instructions.

RNA microinjection

Zinc-finger nuclease mRNAs (20 pg each) were injected into X. tropicalis embryos at the one-cell stage along with 200 pg of mCherry mRNA (Clontech). The fluorescent product of the latter was used to identify successfully injected embryos and confirm that the injected RNA had been translated (Young et al. 2011). Embryos were raised in 0.1× MMR with 0.1% BSA and 50 μg/mL gentamycin at 22°C.

Mutation analysis

Genomic DNA was extracted from tadpole tail fins and frog skin using SimplePrep reagent for DNA (TaKaRa). A 1305-bp fragment of X. tropicalis tyrosinase DNA was amplified by PCR from genomic DNA using TyrF and TyrR primers (Table 1). The amplified fragment was inserted into the pGEM-T Easy vector (Promega), and the nucleotide sequence was subsequently determined. The position of a nucleotide in the tyrosinase gene is denoted as the number of nucleotides from the translation start site in the open reading frame, and the A nucleotide of the initiation codon is defined as position 1.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

To disrupt the X. tropicalis tyrosinase gene, ZFN target-sequence candidates were selected; the sequences considered were those that would not result in off-target sites in the genome with four or fewer mismatched nucleotides. This off-target search was performed with five to seven spacer nucleotides because ZFNs preferentially bind to such target sequences (Handel et al. 2009). Several ZFNs directed at these target sites were constructed in the expression vector. Three sets of ZFNs, set-1, set-2 and set-3, had higher activities in the yeast MEL-1 assay than other ZFNs (Doyon et al. 2008) (data not shown). Figure 1A shows the target sites of the three ZFNs as well as a comparison of the X. tropicalis tyrosinase amino acid sequence to those of Rana nigromaculata (the Japanese pond frog), Bufo bufo, Gallus gallus and Homo sapiens. The identity profile for the five tyrosinase genes revealed a few conserved regions (Fig. 1B), one of which (residues 367–408) may be a component of the catalytic center (Lerch 1983) and may be involved in copper binding (Huber et al. 1985). Three ZFNs were designed to cleave the well-conserved region of the tyrosinase gene upstream of a putative copper-binding region; this approach was intended to ensure that these ZFNs would cut the target site in most cases, even if a non-inbred line of X. tropicalis was used. The target sites of these ZFNs are located within the exons of the gene. To reconfirm the activity of the ZFNs, an SSA assay (Ochiai et al. 2010) was performed by introducing the ZFN-expressing vectors and an SSA reporter construct with a target site into Xenopus A6 cells (Rafferty 1969). Because set-2 had the highest activity in this assay (Fig. 2) and the MEL-1 assay, set-2 was used in subsequent experiments (Fig. 1C).

image

Figure 1. The locations of zinc-finger nuclease (ZFN) target sites in the Xenopus tropicalis tyrosinase gene. (A) A comparison of the tyrosinase amino acid sequences of X. tropicalis (NP_001096518), Rana nigromaculata (Q04604), Bufo bufo (CAR95491), Gallus gallus (NP_989491) and Homo sapiens (AAK00805). Conserved amino acids are indicated by yellow boxes. The vertical arrows denote the boundaries of exons and introns. (B) Identity profile for five tyrosinase genes. Average identity values are plotted against the sequence position in the peptide chain. Each average is plotted in the middle of the 31 residues from which it is derived. (A,B) The three sites targeted by ZFNs and a putative copper-binding region are indicated by purple and green lines, respectively. (C) The location of the ZFN set-2 target site is shown in the genomic structure of the X. tropicalis tyrosinase gene. Exons and introns are indicated by black boxes and lines, respectively. The colored box shows the sequence recognized by each zinc finger of ZFN set-2R and L.

Download figure to PowerPoint

image

Figure 2. The functional activity of zinc-finger nucleases (ZFNs) estimated using the single-strand annealing (SSA) assay. A6 cells were transfected, incubated for 3 days at 25°C and evaluated for luciferase activity. The fold activation resulting from the cleavage of the ZFN target site and single-strand annealing to repair luciferase gene is represented by the relative luciferase activity levels in cells transfected with the ZFN expression constructs, an SSA reporter gene with the target site and a reference gene for transfection. These activity levels are relative to cells transfected with the ZFN expression constructs, an SSA reporter gene without the target site and a reference gene. Data are expressed as the means ± standard error of the mean (SEM) (n = 3).

Download figure to PowerPoint

The set-2 mRNAs were injected along with mCherry mRNA into the animal hemisphere of fertilized one-cell-stage embryos. This microinjection procedure did not have a significant effect on embryo development. The co-injection of mCherry mRNA facilitated the identification of successfully injected embryos at hatching (Young et al. 2011). mCherry-expressing embryos (574 total) were raised, and 41 froglets had some vitiligo patches. All melanocytes in vitiligo patches should have biallelic mutations of the tyrosinase gene because heterozygous mutants on tyrosinase gene locus appeared normal and homozygous mutants showed albino phenotype (Fig. 4B–D). Nine mosaic frogs were sexually matured and used for mating (Fig. 3).

image

Figure 3. Mosaic F0 frogs. Photographs of male (m1–m4) and female (f1–f5) F0 frogs with vitiligo patches.

Download figure to PowerPoint

Ten albino offspring were obtained from the mating of mosaic F0 frogs (Fig. 4B,C and Table 2), and the tyrosinase gene mutations were analyzed in six albino tadpoles (Fig. 4E). Two albino offspring from a cross using male m1 and female f2 frogs (m1 × f2) harbored the same mutations: a one-base deletion at position 653 on one chromosome along with a two-base deletion at position 653–654 and a one-base substitution on the other chromosome. Three albino offspring from the m2 × f1 cross also had the same mutations: a one-base deletion at position 653 and a 367-base deletion from position 645 to 1011. One albino offspring from m2 × f2 possessed the same tyrosinase mutations as three albino offspring from m2 × f1, although the origin of the one-base deletion is different between offspring from the m2 × f2 and m2 × f1 crosses (see discussion). All mutations resulted in frame shifts and premature translational termination, which led to products without a putative copper-binding region.

image

Figure 4. Mutation analysis in albino F1. (A–D) Photographs of F1 froglets. (A) A wild-type froglet. (B) An albino froglet from a cross using m1 and f2 frogs. (C) An albino froglet from the m2 × f1 cross. (D) A wild-type-colored froglet that is a heterozygous offspring from the m1 × f2 cross. (E) The tyrosinase gene mutations in F1. The wild-type tyrosinase amino acid sequence is shown at the top. The nucleotide sequences of tyrosinase genes in offspring from the m1 × f2, m2 × f1 and m2 × f2 crosses are compared with the wild-type sequence. Numbers of characterized offspring are shown in parentheses. The phenotypes of F1 (Ph.) are indicated as wild-type (WT) and albino (Al). Deletions and a substitution are indicated by red dashes and a red letter, respectively. The recognition sequences of ZFN set-2 are underlined with purple lines. There are two allotypes, A and B, for the tyrosinase gene locus in the Ivory Coast line of Xenopus tropicalis. Allotype B has a nine-base deletion in the intron from position 1102 to 1110 that is not present in allotype A. The tyrosinase allotype is indicated on the right-hand side.

Download figure to PowerPoint

Table 2. The occurrence of albino F1 tadpoles from the mating of mosaic F0 frogs. The ratio of albino tadpoles to total hatched tadpoles for each mating is indicated
  F0 female
f1f2f3f4f5
F0 malem10/224/88   
m23/9621/322   
m3 2/2180/147  
m4   0/10470/362

Cel-1 assay (Miller et al. 2007) using PCR fragments of tyrosinase gene revealed that three tadpoles were heterozygous in six wild-type-colored offspring obtained from the m1 × f2 cross (data not shown). The mutant tyrosinase gene was isolated from one heterozygous tadpole and demonstrated by sequencing to contain a two-base deletion at positions 653–654 and a one-base substitution on one locus as observed in albino siblings (Fig. 4E). One tadpole was shown by Cel-1 assay to be heterozygous in five wild-type-colored offspring from the m2 × f1 cross, and had a 367-base deletion, which was found in albino siblings. To estimate the mutation rate in the F0 germ cells, m1 was outcrossed to a wild-type female. Offspring from this cross were raised to the neurula stage, and analyzed by Cel-1 assay for mutations on the tyrosinase gene locus. Genotyping offspring from a cross using m1 and a wild-type female clarified that 11 of 19 embryos had inherited a two-base deletion at positions 653–654 and a one-base substitution on one locus, which were observed in albino and heterozygous offspring from the m1 × f2 cross (Fig. 4E).

The presence of F0 frogs with several vitiligo patches demonstrates that the tyrosinase gene was mutated in a biallelic manner in melanocytes and that the ZFNs ablated the tyrosinase gene target in a spatially distinct pattern in each F0 frog. To analyze these changes, total cellular DNA was extracted. For the m1 frog, skin samples were collected from the following areas with vitiligo: a right finger, right forearm and left toe. Samples were also collected from wild-type-colored areas on the left forearm and on a right toe (Fig. 5A). For the m2 frog, skin samples were collected from the following areas with vitiligo: a left toe, left thigh and posterior-most back area. Samples from wild-type-colored areas were collected from a left finger and right toe (Fig. 5B). All observed mutations are listed in Figure 5 and varied among albino offspring from the m1 × f2, m2 × f1 and m2 × f2 crosses. These differences indicate that the m1 and m2 frogs had at least four different mutations in the tyrosinase gene that occurred at spatially distinct areas and that the mosaic F0 frogs are genetic chimeras.

image

Figure 5. Mutation analysis in mosaic F0 frogs. The tyrosinase gene mutations in m1 (A) and m2 (B) frogs. (A, B) The observed mutations in m1 and m2 skin at the indicated locations, and the mutations in sperm that are predicted from mutations in the F1 offspring (Fig. 4). The spacer sequence is indicated by a bracket. The wild-type nucleotide sequence is shown at the top, and the predicted mutation in sperm is shown at the bottom. Deletions and substitutions are indicated by red dashes and red letters, respectively. An insertion is indicated by a green letter. Numbers in the photograph indicate the numbers of mutated and wild-type clones among those analyzed. For the analyzed clones, the frequencies of mutations I, II, III, IV, V and VI along with the wild-type sequence for the tyrosinase gene are denoted by red, yellow, green, orange, purple, magenta and blue, respectively, in each circle graph. Open and closed squares indicate that genomic DNA was isolated from the skin in areas with vitiligo patches and wild-type-colored areas, respectively.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

We succeeded in generating albino X. tropicalis by the ablation of the tyrosinase gene. Vitiligo patches were observed on the skin of F0 frogs that had been injected with ZFN mRNAs immediately after fertilization, indicating that the tyrosinase gene was destroyed in a biallelic manner in the melanocytes within the vitiligo patches. Each of the F0 frogs had a different pattern of vitiligo that should be related to the melanocyte precursor cells that were affected by the biallelic ablation of the tyrosinase gene. The different sizes of the vitiligo patches lead us to speculate that large vitiligo regions are indicative of an early melanocyte precursor losing both functional copies of the tyrosinase gene and subsequently undergoing many cell divisions. A small melanin-free area indicates damage to the tyrosinase gene in a late precursor cell. The mosaic frog m2 had an albino leg, a mosaic leg and several vitiligo patches on the trunk. Because skin melanocytes migrate from the neural crest and spread over the surface of the body, the albino leg indicates that the biallelic ablation of the tyrosinase gene occurred in a melanocyte precursor that was eventually distributed over the entire left leg. There are two possible explanations for the complex mosaic patterns observed on the F0 frogs. The first explanation is that the ablation of the second allele occurred in only one melanocyte precursor, which affected many different locations and proliferated to form the vitiligo patches. The other is that a second ablation occurred independently in several melanocyte precursor cells at different times. Because the ZFN mRNAs induced several mutations in individual frogs, as described in the results (Fig. 5), the latter explanation is more likely.

One medaka founder injected with ZFN mRNAs was reported to contain six mutations in the target gene (Ansai et al. 2012). Our mutation analysis using skin revealed that the m1 and m2 F0 frogs underwent multiple mutations of the tyrosinase gene that occurred in a spatially complex manner. m1 had the common mutation I in the left wild-type-colored forearm and in vitiligo patches on the right forearm and a right finger. It also had mutation II in the left wild-type-colored forearm and mutation III in an unpigmented left toe. The m2 frog harbored mutations IV and V in the vitiligo region on its back and mutation VI in a wild-type-colored right toe. It is worth emphasizing that only melanocytes produce melanin and that the skin includes many other types of cells, such as basal cells, fibroblasts, vessels and exocrine gland cells. For this reason, it is sometimes difficult to detect tyrosinase gene mutations in skin with vitiligo patches (e.g., left leg of m2) and sometimes possible to find mutations in wild-type-colored skin (e.g., left forearm of m1). These data demonstrate that ZFN-induced gene knockout involves multiple mutation events and spatiotemporally distinct patterns. These complex chimeric patterns may have occurred in the m1 and m2 frogs because the translation of ZFN mRNA and accumulation of ZFN protein in nuclei take time; thus, ZFNs are most active during late development rather than during early development. This hypothesis is supported by the finding that the fluorescence of the translational product encoded by the co-injected mCherry mRNA peaked a few days later and could be detected for at least 2 weeks under our experimental conditions (data not shown). However, differences in the stability of mCherry and ZFN mRNAs as well as the proteins should be considered. Embryos develop to the swimming stage within a few days and to NF-stage 49 within 2 weeks. It is possible that the ablation of the tyrosinase gene occurs in a spatially random fashion until the young tadpole stage. Therefore, vitiligo patches are observed when melanocyte precursors undergo biallelic ablation, proliferate and spread out. Even if the mutation of the target gene is detected in a part of the body, this does not necessarily mean that the F0 germ cells contain the knockout gene because the F0 is a spatially and genetically complex chimera.

The tyrosinase mutations in the albino F1 tadpoles were analyzed in the present study. The mutation in the m1 germ cells is a two-base deletion at positions 653–654 and a one-base substitution on the allotype A locus because this mutation was shared in all heterozygous offspring produced from a cross using m1 and a wild-type female. This means that the mutation of f2 is a one-base deletion at position 653 on allotype B, as albino offspring from the m1 × f2 harbored both mutations. The deletion of 367 bases is derived from m2 because this large deletion is contained besides the f2 mutation (a one-base deletion) in an albino offspring from m2 × f2, and observed in offspring from m2 × f1 and m2 × f2 but not in albino offspring from m1 × f2. In the same manner, the one-base deletion at position 653 on allotype A is derived from the f1 frog. The one-base deletion at position 653 must have occurred independently two times because this deletion is located on allotype A in f1, while this mutation is on allotype B in f2.

We obtained a small number of albino offspring by mating the F0 frogs. One possible explanation is that only some of the germ cells are mutated in the male and female F0 frogs. In this scenario, the ability to obtain albino F1 offspring decreases synergistically. The ratio of albino siblings to total siblings from m1 × f2 is 4.5% and the mutation frequency in the germ cells of m1 is 58% from the outcross experiment, which suggests that the mutation rate in the f2 germ cells is approximately 10%. These mutagenesis efficiencies are comparable to the mutation rate (12–24%) reported by Young et al. (2011). However, the possibility that albino F1 offspring have reduced survival rates in early development cannot be excluded.

We demonstrated that F0 frogs injected with ZFN mRNAs exhibit spatially variable disruption of the target gene throughout the body. Our data suggest that the most efficient gene-knockout corresponds to high levels of ZFN activity as soon as possible in the embryos. We hope that the albino X. tropicalis generated in this study will contribute to further developmental studies.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. References
  • Ansai, S., Ochiai, H., Kanie, Y., Kamei, Y., Gou, Y., Kitano, T., Yamamoto, T. & Kinoshita, M. 2012. Targeted disruption of exogenous EGFP gene in medaka using zinc-finger nucleases. Dev. Growth Differ. 54, 546556.
  • Beermann, F., Ruppert, S., Hummler, E., Bosch, F. X., Muller, G., Ruther, U. & Schutz, G. 1990. Rescue of the albino phenotype by introduction of a functional tyrosinase gene into mice. EMBO J. 9, 28192826.
  • Beumer, K. J., Trautman, J. K., Bozas, A., Liu, J. L., Rutter, J., Gall, J. G. & Carroll, D. 2008. Efficient gene targeting in Drosophila by direct embryo injection with zinc-finger nucleases. Proc. Natl. Acad. Sci. USA 105, 1982119826.
  • Bibikova, M., Carroll, D., Segal, D. J., Trautman, J. K., Smith, J., Kim, Y. G. & Chandrasegaran, S. 2001. Stimulation of homologous recombination through targeted cleavage by chimeric nucleases. Mol. Cell Biol. 21, 289297.
  • Chisaka, O. & Capecchi, M. R. 1991. Regionally restricted developmental defects resulting from targeted disruption of the mouse homeobox gene hox-1.5. Nature 350, 473479.
  • Doyon, Y., Mccammon, J. M., Miller, J. C., Faraji, F., Ngo, C., Katibah, G. E., Amora, R., Hocking, T. D., Zhang, L., Rebar, E. J., Gregory, P. D., Urnov, F. D. & Amacher, S. L.2008. Heritable targeted gene disruption in zebrafish using designed zinc-finger nucleases. Nat. Biotechnol. 26, 702708.
  • Handel, E. M., Alwin, S. & Cathomen, T. 2009. Expanding or restricting the target site repertoire of zinc-finger nucleases: the inter-domain linker as a major determinant of target site selectivity. Mol. Ther. 17, 104111.
  • Huber, M., Hintermann, G. & Lerch, K. 1985. Primary structure of tyrosinase from Streptomyces glaucescens. Biochemistry 24, 60386044.
  • Kashiwagi, K., Kashiwagi, A., Kurabayashi, A., Hanada, H., Nakajima, K., Okada, M., Takase, M. & Yaoita, Y. 2010. Xenopus tropicalis: an ideal experimental animal in amphibia. Exp. Anim. 59, 395405.
  • Kawai, N., Ochiai, H., Sakuma, T., Yamada, L., Sawada, H., Yamamoto, T. & Sasakura, Y. 2012. Efficient targeted mutagenesis of the chordate Ciona intestinalis genome with zinc-finger nucleases. Dev. Growth Differ. 54, 535545.
  • Kim, Y. G. & Chandrasegaran, S. 1994. Chimeric restriction endonuclease. Proc. Natl. Acad. Sci. USA 91, 883887.
  • Kinnear, P. E., Jay, B. & Witkop Jr, C. J. 1985. Albinism. Surv. Ophthalmol. 30, 75101.
  • Lerch, K. 1983. Neurospora tyrosinase: structural, spectroscopic and catalytic properties. Mol. Cell Biochem. 52, 125138.
  • Meng, X., Noyes, M. B., Zhu, L. J., Lawson, N. D. & Wolfe, S. A. 2008. Targeted gene inactivation in zebrafish using engineered zinc-finger nucleases. Nat. Biotechnol. 26, 695701.
  • Miller, J. C., Holmes, M. C., Wang, J., Guschin, D. Y., Lee, Y. L., Rupniewski, I., Beausejour, C. M., Waite, A. J., Wang, N. S., Kim, K. A., Gregory, P. D., Pabo, C. O. & Rebar, E. J. 2007. An improved zinc-finger nuclease architecture for highly specific genome editing. Nat. Biotechnol. 25, 778785.
  • Morton, J., Davis, M. W., Jorgensen, E. M. & Carroll, D. 2006. Induction and repair of zinc-finger nuclease-targeted double-strand breaks in Caenorhabditis elegans somatic cells. Proc. Natl. Acad. Sci. USA 103, 1637016375.
  • Nasevicius, A. & Ekker, S. C. 2000. Effective targeted gene ‘knockdown’ in zebrafish. Nat. Genet. 26, 216220.
  • Ochiai, H., Fujita, K., Suzuki, K., Nishikawa, M., Shibata, T., Sakamoto, N. & Yamamoto, T. 2010. Targeted mutagenesis in the sea urchin embryo using zinc-finger nucleases. Genes Cells 15, 875885.
  • Rafferty Jr, K. A. 1969. Mass culture of amphibian cells: Methods and observations concerning stability of cell type. In: Biology of Amphibian Tumors. (ed. Mizell M) New York: Springer-Verlag, pp. 5281.
  • Schedl, A., Montoliu, L., Kelsey, G. & Schutz, G. 1993. A yeast artificial chromosome covering the tyrosinase gene confers copy number-dependent expression in transgenic mice. Nature 362, 258261.
  • Takasu, Y., Kobayashi, I., Beumer, K., Uchino, K., Sezutsu, H., Sajwan, S., Carroll, D., Tamura, T. & Zurovec, M. 2010. Targeted mutagenesis in the silkworm Bombyx mori using zinc finger nuclease mRNA injection. Insect Biochem. Mol. Biol. 40, 759765.
  • Tong, C., Huang, G., Ashton, C., Li, P. & Ying, Q. L. 2011. Generating gene knockout rats by homologous recombination in embryonic stem cells. Nat. Protoc. 6, 827844.
  • Urnov, F. D., Miller, J. C., Lee, Y. L., Beausejour, C. M., Rock, J. M., Augustus, S., Jamieson, A. C., Porteus, M. H., Gregory, P. D. & Holmes, M. C. 2005. Highly efficient endogenous human gene correction using designed zinc-finger nucleases. Nature 435, 646651.
  • Wienholds, E., Schulte-Merker, S., Walderich, B. & Plasterk, R. H. 2002. Target-selected inactivation of the zebrafish rag1 gene. Science 297, 99102.
  • Wienholds, E., Van Eeden, F., Kosters, M., Mudde, J., Plasterk, R. H. & Cuppen, E. 2003. Efficient target-selected mutagenesis in zebrafish. Genome Res. 13, 27002707.
  • Young, J. J., Cherone, J. M., Doyon, Y., Ankoudinova, I., Faraji, F. M., Lee, A. H., Ngo, C., Guschin, D. Y., Paschon, D. E., Miller, J. C., Zhang, L., Rebar, E. J., Gregory, P. D., Urnov, F. D., Harland, R. M. & Zeitler, B. 2011. Efficient targeted gene disruption in the soma and germ line of the frog Xenopus tropicalis using engineered zinc-finger nucleases. Proc. Natl. Acad. Sci. USA 108, 70527057.