Insulin induces proliferation and cardiac differentiation of P19CL6 cells in a dose-dependent manner

Authors


Author to whom all correspondence should be addressed.

Email: mzang@zzu.edu.cn

Abstract

Insulin is a peptide hormone produced by beta cells of the pancreas. The roles of insulin in energy metabolism have been well studied, with most of the attention focused on glucose utilization, but the roles of insulin in cell proliferation and differentiation remain unclear. In this study, we observed for the first time that 10 nmol/L insulin treatment induces cell proliferation and cardiac differentiation of P19CL6 cells, whereas 50 and 100 nmol/L insulin treatment induces P19CL6 cell apoptosis and blocks cardiac differentiation of P19CL6 cells. By using real-time polymerase chain reaction (PCR) and Western blotting analysis, we found that the mRNA levels of cyclin D1 and α myosin heavy chain (α-MHC) are induced upon 10 nmol/L insulin stimulation and inhibited upon 50/100 nmol/L insulin treatment, whereas the mRNA levels of BCL-2-antagonist of cell death (BAD) exists a reverse trend. The similar results were observed in P19CL6 cells expressing GATA-6 or peroxisome proliferator-activated receptor α (PPARα). Our results identified the downstream targets of insulin, cyclin D1, BAD, α-MHC, and GATA-4, elucidate a novel molecular mechanism of insulin in promoting cell proliferation and differentiation.

Introduction

Heart disease affects nearly 33% of people in the world and accounts for half of all deaths. The reason for high mortality of heart disease is that loss of myocardium can not be replenished due to the limited regenerative capacity of postnatal cardiomyocytes as terminally differentiated cells (Aries et al. 2004; Chiha et al. 2012). Therefore, cardiac regeneration studies will help us to establish the molecular basis of heart disease for clinical medications and treatment.

P19 embryonic carcinoma cells can differentiation into cardiomyocytes, which contributed to the elucidation of the cardiac regeneration mechanisms. P19CL6 cells, a derivative of P19 cells, can differentiation into spontaneously beating cardiomyocytes more efficiently than the parent P19 cells in the presence of 1% dimethylsulfoxide (DMSO), which provide a very useful model to explore the mechanisms of cardiac regeneration in vitro. The regulation of cardiac differentiation of P19CL6 cells have been well studied, with most of the attention having focused on several transcription factors and signaling pathway, such as the high mobility group (HMG) of nuclear proteins, Nkx2.5, Sox6 and Wnt- and β-catenin pathway (Monzen et al. 1999, 2008; Cohen-Barak et al. 2003; Nakamura et al. 2003), but relatively little is known about the mechanisms whereby cardiac differentiation of P19CL6 is regulated by peptide hormone.

Insulin is a secreted peptide hormone and functions as an important regulator of glucose transporter Glut-4 translocation, glucose uptake, glycogen synthesis, and fatty acid synthesis (Desvergne et al. 2006). Recently, Cirri et al. (2005) demonstrated that insulin inhibits platelet-derived growth factor-induced NIH3T3 and C2C12 cell proliferation; Conejo et al. (2001) found that insulin induces C2C12 cell differentiation. The roles of insulin in cell differentiation urge us to further determine whether insulin regulates cardiac differentiation of P19CL6 cells.

GATA-6 is a zinc finger transcription factor and is essential for cardiogenesis (Wada et al. 2002; Nemer & Nemer 2003; Yin & Herring 2005; Lepore et al. 2006; Zhao et al. 2008; Kodo et al. 2009). Moreover, our previous studies demonstrate that GATA-6 promotes insulin-stimulated glucose consumption (Yao et al. 2012), implying that GATA-6 may be involved in the roles of insulin. Like GATA-6, peroxisome proliferator-activated receptor α (PPARα) functions as a critical regulator of lipid metabolism (Burri et al. 2010). Similar to GATA-6, our previous studies also demonstrated that PPARα promoted insulin-stimulated glucose consumption (Yao et al. 2012), implying that PPARα may also be involved in the roles of insulin.

Apoptosis is the process of programmed cell death and a naturally occurring process. BCL-2-antagonist of cell death (BAD) protein induces apoptosis upon proapoptotic signals stimulation (Sermeus et al. 2012). In contrast to BAD protein, cyclin D1 is a D-type cyclin and functions as a stimulator of the cell cycle (Tamamori-Adachi et al. 2008a). Recent studies suggest that cyclin D1 proteins are involved in cardiac proliferation (Tamamori-Adachi et al. 2008a,b; Nakajima et al. 2011). However, whether the expression of cyclin D1 and BAD in P19CL6 cells is regulated by insulin remains unknown.

Here, we demonstrate that insulin promotes proliferation and cardiac differentiation of P19CL6 cells in a dose- and stage-dependent manner. Upon administration of insulin on day 0 of cardiac differentiation for 24 h, 10 nmol/L insulin induces proliferation and cardiac differentiation of P19CL6 cells, whereas 50 and 100 nmol/L insulin inhibit proliferation and cardiac differentiation of P19CL6 cells. By using real-time polymerase chain reaction (PCR) or Western blotting analysis, we found that the expression of cyclin D1 and α-myosin heavy chain (α-MHC) was upregulated and downregulated upon 10 and 50/100 nmol/L insulin treatment, respectively, whereas the expression of BAD was downregulated and upregulated upon 10 and 50 nmol/L insulin treatment, respectively. Our results indicate that insulin regulates cell proliferation and differentiation through regulation of its downstream targets cyclin D1/BAD, alpha-MHC and GATA-4.

Materials and methods

Cell culture, transfection and differentiation

P19CL6 cells were grown in α-minimal essential medium (α-MEM, GIBCO) supplemented with 10% fetal bovine serum (FBS). Transfections were carried out using calcium phosphate 24 h after plating cells. Briefly, reporter constructs containing either the cyclin D1 or BAD promoter-luc were transiently transfected into P19CL6 cells, or cells overexpressing GATA-6 or PPARα. Twenty-four hours post-transfection, the cells were administered 10, 50, and 100 nmol/L insulin for 24 h. Next, cells were harvested for luciferase activity measurements with a Berthold LB960 luminometer. The amount of reporter was maintained at 1 μg per well of a 12-well plate, and the amount of DNA was kept constant using the empty expression vector.

To construct a stable cell line constitutively expressing GATA-6 or PPARα, the empty pcDNA3.1(+) vector (G418-resistant), pcDNA3-GATA-6 or pcDNA3-PPARα were transfected into P19CL6 cells using Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer's instructions. Twenty-four hours post-transfection, the cells were maintained in medium containing 400 μg/mL G418 (Amersham Pharmacia Biotech), and the medium should be changed every 2–3 days. G418-resistant colonies were selected after 2 weeks.

To induce cardiac differentiation, P19CL6 cells were plated at a density of 1.8 × 105 cells in a 6-well plate with α-MEM supplemented with 10% FBS in the presence of 1% DMSO and incubated for 18 days. The medium was changed every 2 days.

Quantitative real-time PCR

RNA was extracted from normal and differentiated P19CL6 cells, or cells stably transfected with the GATA-6 or PPARα expression vector and/or treated with 10, 50, and 100 nmol/L insulin for 24 h using the TRIzol method (Invitrogen). Real-time PCR reactions were performed as described previously (Yao et al. 2013). Briefly, the cycling conditions were 95°C for 15 min, then 40 cycles of 95°C for 30 s, and 58°C for 1 min, then 72°C, 30 s. A comparative quantification method was used, and the levels of mRNA were normalized to those of the ribosomal protein S16. The sequences of the primers are listed in Table 1.

Table 1. Primer sequences
 Forward primerReverse primer
Cyclin D1ATGAGAACAAGCAGACCATCCGCAGCTTGACTCCAGAAGGGCTTCAAT
BADGCTTAGCCCTTTTCGAGGACGATCCCACCAGGACTGGAT
Ribosomal protein S16TCTGGGCAAGGAGAGATTTGCCGCCAAACTTCTTGGATTC

Western blot analysis

Cell lysates were prepared from normal and differentiated P19CL6 cells, or cells stably transfected with the GATA-6 or PPARα expression vector and/or treated with 10, 50, and 100 nmol/L insulin for 24 h. Western blotting was performed using cell lysates according to standard protocols as previously described (Yao et al. 2012). Briefly, proteins were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) and transferred to PVDF membranes, followed by immunoblotting with antibodies specific for the sarcomeric MHC (MF-20; Developmental Studies Hybridoma Bank), cyclin D1 (Santa Cruz, SC-753), BAD (Santa Cruz, SC-8044), tubulin (Santa Cruz, SC-32293), goat anti-mouse IgG-HRP (Santa Cruz, SC-2055), or goat anti-rabbit IgG-HRP (Santa Cruz, SC-2004), and visualized using the standard enhanced chemiluminescence (ECL) protocol (Pierce).

Cell proliferation assay

P19CL6 cells, or cells stably transfected with GATA-6 or PPARα expression vector were seeded at 10 000 cells per well in a 96-well plate. After 24 h, the cells were administered 10, 50, and 100 nmol/L insulin for 24 h, and the growth rate of these cells was evaluated by an MTT assay using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma). Briefly, 20 μL of a 5 mg/mL MTT solution was added to each well and incubated for 4 h at 37°C until a purple precipitate was visible. The MTT medium was then removed, and 150 μL of DMSO was added to dissolve the formazan. The absorbance was read at 490 nm using a Bio-Rad 550 Microplate Reader. All experiments were plated in sextuplicate and were performed three times.

Flow cytometric analysis

Flow cytometry was performed as previously described (Kim et al. 2007). In brief, P19CL6 cells, and cells stably transfected with GATA-6 or PPARα expression vector were seeded at 5 × 105 cells per well in a 6-well plate. After 24 h, the cells were administered 10, 50, and 100 nmol/L insulin, and the cells were harvested at 24 h and fixed with 70% ice-cold ethanol overnight at −20°C. Next, the cells were stained with propidium iodide (PI; Sigma) solution for 30 min at room temperature in the dark. Flow cytometric analysis was performed using a BD FACScan flow cytometer (Becton Dickinson Immunocytometry System), and cell cycle were analyzed using Cell-Quest software (BD Biosciences). The experiments were performed three times in duplicate.

Flow cytometry analysis of MHC expression

Undifferentiated P19CL6 cells (day 0), and day 18 of cardiac differentiation P19CL6 cells and/or treated with 10, 50, 100 nmol/L insulin at day 0 of cardiac differentiation for 24 h were dispersed into individual cells with trypsin, dispersed cells were washed with PBS two times and fixed by using 4% formaldehyde for 10 min at 37°C. Fixed cells were incubated in PBS with 0.1% Triton X-100 for 15 min at room temperature, followed by a centrifugation (300 g for 5 min). Next, the cells were incubated overnight at 4°C in PBS containing 0.1% Triton X-100 and MF-20 (1:100), followed by secondary fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse IgG antibody (Sigma, 1:100) for 1 h at room temperature. Cells were then washed, resuspend in 0.5 mL PBS, and analyzed using a BD FACScan flow cytometer (Becton Dickinson Immunocytometry System).

DAPI staining and Annexin V-FITC/PI apoptosis assay

P19CL6 cells, and cells stably transfected with GATA-6 or PPARα expression vector were allowed to adhere to glass coverslips (22 × 22 mm) in 6-well plates. Twenty-four hours later, the cells were administered 10, 50, and 100 nmol/L insulin, and the cells on the glass coverslips were rinsed with PBS at 24 h and fixed with 95% ethanol for 30 min at room temperature. Next, the cells were DNA stained with 0.5 μg/mL DAPI (4´6´-diamidino-2-phenylindole dihydrochloride) (Sigma) solution for 15 min at room temperature in the dark. The coverslips were mounted and imaged with a Nikon Eclipse E800 fluorescent microscope. Apoptosis was quantified with Annexin V-FITC/PI apoptosis detection kit (KeyGen BioTECH) as previously described (Yao et al. 2013).

Statistics

The data are reported as the mean ± SEM. Analysis of variance (anova) was used to compare differences between the three different cell types and different concentrations of insulin. In all cases, differences were considered to be statistically significant when P < 0.05.

Results

Insulin induces P19CL6 cells proliferation and apoptosis in a dose-dependent manner

To elucidate the specific role of insulin in cell growth, cell viability was measured by the MTT assay in P19CL6 cells treated with 10, 50, and 100 nmol/L insulin for 24 h (Fig. 1A, left). Interestingly, 10 nmol/L insulin treatment resulted in a 42% increase in cell viability, whereas 50 and 100 nmol/L insulin treatment resulted in a 9% and 60% reduction in cell viability, respectively (Fig. 1A, left). These data suggested that insulin has both proliferative and anti-proliferative effect on P19CL6 cells in a dose-dependent manner.

Figure 1.

The effect of Insulin on cell proliferation. (A) P19CL6 cells, and cells stably transfected with GATA-6 or peroxisome proliferator-activated receptor α (PPARα) expression vector were seeded in 96-well plates, and treated with 10, 50 and 100 nmol/L insulin for 24 h with α-minimal essential medium (α-MEM) supplemented with 10% fetal bovine serum (FBS) (left), or 1, 3, 5, 10, 50 and 100 nmol/L insulin for 24 h with a serum free α-MEM medium (right). Cell viability was determined by MTT assay. The data shown are the mean ± SEM of three independent experiments. *indicates P < 0.05 versus control, and **indicates P < 0.01 versus control. (B) The effect of insulin on cell cycle progression. Fluorescence-activated cell sorting (FACS) analyses were performed in P19CL6 cells, or P19CL6 cells stably transfected with GATA-6 or PPARα expression vector after treatment with 10, 50, and 100 nmol/L insulin for 24 h. (C) The effect of insulin on apoptosis. DAPI (4´6´-diamidino-2-phenylindole dihydrochloride) staining (left) and Annexin V-fluorescein isothiocyanate (FITC)-propidium iodide (PI) double staining (right) were performed in P19CL6 cells, or P19CL6 cells stably transfected with GATA-6 or PPARα expression vector after treatment with 10, 50, and 100 nmol/L insulin for 24 h, and chromatin fragmentation was monitored as an indicator of apoptosis (left) and the percentage of apoptotic cells were quantified (right), respectively. Images were taken using a 20× objective. Scale bar is 50 μm and applies to all images in Figure 1C. ins, insulin.

Given unknown concentration of insulin in the serum, we did the MTT assay in serum-free medium, as shown in Figure 1A (right). Unexpectedly, exposure to 10 nmol/L insulin resulted in a 15% reduction in cell viability. Moreover, exposure to 50 and 100 nmol/L insulin resulted in a 50% and 65% reduction in cell viability, respectively, whereas exposure to 1, 3, and 5 nmol/L resulted in a 46%, 42%, and 38% increase in cell viability, respectively (Fig. 1A, right). These results further determined that insulin exerts both proliferative and anti-proliferative effects on P19CL6 cells in a dose-dependent manner.

To determine whether the anti-proliferative effects of 50 and 100 nmol/L insulin is due to the cell cycle arrest, fluorescence-activated cell sorting (FACS) analysis was performed in P19CL6 cells treated with 10, 50, and 100 nmol/L insulin for 24 h following propidium iodide (PI) staining. In comparison to control cells, 10 nmol/L insulin treatment showed a 21% decrease in the G0/G1 population and a 53% increase in the G2/M population (Fig. 1B), suggesting that 10 nmol/L insulin induces cell cycle. In contrast to the administration of 10 nmol/L insulin, the administration of 50 and 100 nmol/L insulin caused a 20% and 31% increase in S population, and a 7% and 27% decrease in G2/M population, respectively, suggesting that 50 and 100 nmol/L insulin induce S-phase arrest.

To determine whether the anti-proliferative effects of 50 and 100 nmol/L insulin results from apoptosis, the effects of insulin on apoptosis were examined in P19CL6 cells treated with 10, 50, and 100 nmol/L insulin for 24 h by evaluating chromatin condensation. Higher levels of condensed chromatin were observed in cells treated with 50 and 100 nmol/L insulin, whereas 10 nmol/L insulin treatment showed no apoptosis (Fig. 1C, left), suggesting that insulin induces P19CL6 cells apoptosis in a dose-dependent manner. Furthermore, FACS analysis using annexin V-FITC-propidiumiodide (PI) double staining were performed to quantify the percentage of apoptotic cells, as shown in Figure 1C (right), 50 and 100 nmol/L insulin treatment resulted in 5.2- and 9.3-fold increase in the percentage of apoptotic P19CL6 cells, respectively, suggesting that insulin induces apoptosis in a dose-dependent manner.

Taken together, these results indicate that 50 and 100 nmol/L insulin treatment inhibits P19CL6 cell growth by induction of cell cycle arrest and apoptosis, whereas in medium containing serum, 10 nmol/L insulin induces P19CL6 cell growth by promoting cell cycle progression.

Insulin induces GATA-6- or PPARα-expressing P19CL6 cell proliferation and apoptosis in a dose-dependent manner

Our previous studies demonstrated that GATA-6 and PPARα are involved in insulin-mediated glucose consumption (Yao et al. 2012). To further explore the roles of GATA-6 and PPARα in insulin-mediated P19CL6 cell growth, the MTT assays were performed in untreated or insulin-treated P19CL6 cells stably expressing GATA-6 or PPARα. As shown in Figure 1A (left), compared with the control cells, both GATA-6 and PPARα induced cell growth, and this induction was further enhanced by 10 nmol/L insulin but was reversed by 50 and 100 nmol/L insulin. Moreover, both GATA-6 and PPARα can partly rescue from anti-proliferative effect mediated by 100 nmol/L insulin (Fig. 1A, left). However, in serum-free medium, 1, 3, and 5 nmol/L insulin treatment further enhanced the cell proliferation induced by GATA-6 and PPARα, whereas 10, 50, and 100 nmol/L insulin treatment reversed this induction (Fig. 1A, right), suggesting that insulin induces GATA-6- or PPARα-expressing P19CL6 cell proliferation in a dose-dependent manner. Moreover, both GATA-6 and PPARα promoted cell cycle progression, and this promotion was further enhanced in the presence of 10 nmol/L insulin but was reversed in the presence of 50 and 100 nmol/L insulin (Fig. 1B). Of interest, both GATA-6 and PPARα can partly rescue from cell cycle arrest induced by 100 nmol/L insulin (Fig. 1B). Furthermore, both GATA-6 and PPARα can only alleviate but not rescue from cell apoptosis induced by 100 nmol/L insulin (Fig. 1C), suggesting that P19CL6 cell apoptosis induced by 100 nmol/L insulin does not fully depend on the expression of GATA-6 and PPARα.

Insulin activates the transcription of cyclin D1 and BAD in a dose-dependent manner

To explore the molecular mechanism underlying the induction of P19CL6 cell proliferation by low insulin concentrations, luciferase reporter assays were performed using a cyclin D1 promoter luciferase construct in P19CL6 cells treated with 10, 50, and 100 nmol/L insulin for 24 h. Compared with the control cells, 10 nmol/L insulin treatment caused a 2.3-fold increase in luciferase activity of cyclin D1 promoter, whereas 50 and 100 nmol/L insulin treatment caused approximate 7% and 44% decrease, respectively (Fig. 2A, right). Furthermore, both GATA-6 and PPARα activated cyclin D1 promoter in a dose-dependent manner (Fig. 2A, left), and this activation was further enhanced by 10 nmol/L insulin but was reversed by 50 and 100 nmol/L insulin (Fig. 2A, right). These results demonstrate that insulin activates cyclin D1 transcription in a dose-dependent manner.

Figure 2.

The effect of insulin on the expression of cyclin D1 and BCL-2-antagonist of cell death (BAD). (A) Transient transfections were performed in P19CL6 cells using the 1000 bp human cyclin D1 promoter with 50, 100, 200, 500 and 1000 ng of GATA-6/peroxisome proliferator-activated receptor α (PPARα) expression vector (left), or with 200 ng of GATA-6/PPARα expression vector and/or 24 h of treatment with 10, 50, and 100 nmol/L insulin (right). The data shown are the mean ± SEM of three independent experiments carried out in duplicate (out of 3). *indicates P < 0.05 versus control, and **indicates P < 0.01 versus control. (B) P19CL6 cells, or P19CL6 cells stably expressed GATA-6 or PPARα were transfected with a mouse BAD promoter luciferase construct (−2568 bp), after 24 h of treatment with 10, 50, and 100 nmol/L insulin, luciferase activity was analyzed. The data shown are the mean ± SEM of three independent experiments carried out in duplicate (out of 3). Iindicates P < 0.05 versus control, and **indicates P < 0.01 versus control. (C) P19CL6 cells, and cells stably expressing GATA-6 or PPARα were administered 10, 50, and 100 nmol/L insulin for 24 h, and expression levels of cyclin D1 (left) and BAD (right) were evaluated. The results are the mean ± SEM of three independent experiments. *indicates P < 0.05, and **indicates P < 0.01 compared to control. (D) P19CL6 cells (upper left), and cells stably expressing GATA-6 (upper middle) or PPARα (upper left) were treated with 10, 50, and 100 nmol/L insulin for 24 h, and cyclin D1 and BAD protein levels were evaluated. Each band from immunoblots was quantified by the Fujifilm Multi Gauge V3.0 software and normalized to tubulin (lower). Cd1, cyclin D1; G6, GATA-6.

To explore the molecular mechanism underlying the induction of P19CL6 cell apoptosis by high insulin concentrations, luciferase reporter assays were performed using a BAD promoter luciferase construct in P19CL6 cells treated with 10, 50, and 100 nmol/L insulin for 24 h. Compared with the control cells, 10 nmol/L insulin treatment caused a 16% decrease in luciferase activity of BAD promoter, whereas 50 and 100 nmol/L insulin treatment caused approximately 47% and a 3.3-fold increase, respectively (Fig. 2B). Similar results were observed in GATA-6- or PPARα-expressing cells (Fig. 2B). These results demonstrate that insulin activates BAD transcription in a dose-dependent manner.

Insulin induces the expression of cyclin D1 and BAD in a dose-dependent manner

To determine whether insulin induces the mRNA levels of cyclin D1 and BAD, P19CL6 cells were treated with 10, 50 and 100 nmol/L insulin for 24 h, and then the mRNA levels of cyclin D1 and BAD were determined by real-time PCR experiments. As shown in Figure 2C, compared with the control cells, 10 nmol/L insulin treatment caused a 73% increase in the cyclin D1 mRNA level, whereas 50 and 100 nmol/L insulin treatment caused approximate 68% and 86% decrease in the cyclin D1 mRNA level, respectively (Fig. 2C, left). Similar results were observed in GATA-6- or PPARα-expressing cells (Fig. 2C, left). Moreover, GATA-6 can partially reverse the reduction of cyclin D1 mRNA level mediated by 100 nmol/L insulin (Fig. 2C, left). These results demonstrate that insulin induces the mRNA level of cyclin D1 in a dose-dependent manner. In contrast to cyclin D1, the BAD mRNA level was increased 1.0-fold and 2.3-fold in 50 and 100 nmol/L insulin-treated P19CL6 cells, respectively (Fig. 2C, right). However, the mRNA level of BAD was slightly downregulated in 10 nmol/L insulin-treated P19CL6 cells (Fig. 2C, right). Similar results were observed in GATA-6- or PPARα-expressing cells (Fig. 2C, right). Moreover, both GATA-6 and PPARα neither rescue the suppression of BAD mRNA level mediated by 10 nmol/L insulin, nor fully reverse the increase in the BAD mRNA level induced by 100 nmol/L insulin (Fig. 2C, right). These results demonstrate that insulin induces the mRNA level of BAD in a dose-dependent manner.

Consistent with the observed effects of insulin on the mRNA levels, the protein level of cyclin D1 is increased in cells treated with 10 nmol/L insulin and decreased in cells treated with 50 and 100 nmol/L insulin, similar results were observed in GATA-6- or PPARα-expressing cells (Fig. 2D), whereas the protein level of BAD is decreased in cells treated with 10 nmol/L insulin and increased in cells treated with 50 and 100 nmol/L insulin, similar results were observed in GATA-6- or PPARα-expressing cells except P19CL6 cells expressing PPARα and treated with 100 nmol/L insulin (Fig. 2D). These data demonstrate that insulin induces the expression of cyclin D1 and BAD in a dose-dependent manner.

Insulin induces cardiac differentiation of P19CL6 cells in a dose-dependent manner

To further determine the possible role of insulin in cardiac myogenesis, we monitored cardiac differentiation of P19CL6 cells induced by DMSO with the addition of insulin at concentrations of 10, 50 or 100 nmol/L for 24 h. As shown in Figure 3, compared to the control cells, insulin treatment promoted cardiac differentiation at a concentration of 10 nmol/L (Fig. 3A,B,E). However, 50 and 100 nmol/L insulin treatment thoroughly blocked DMSO-induced cardiomyogenic differentiation (Fig. 3C–E). Consistent with these observations, flow cytometry analysis of MHC expression using MF-20 antibody showed that, compared with undifferentiated P19CL6 cells (day 0 of cardiac differentiation, 2.4% MF-20 positive cells, Fig. 3F, upper left), the percentage of MF-20 positive cells increased to 17.3% on day 18 of cardiac differentiation (Fig. 3F, upper right), administration of 10 nmol/L insulin on day 0 of cardiac differentiation for 24 h resulted in increased percentage of MF-20 positive cells (26%, Fig. 3F, lower left), whereas 50 and 100 nmol/L insulin treatment resulted in 6.5% and 2.7% of MF-20 positive cells, respectively (Fig. 3F, lower middle and right), suggesting that insulin induces cardiac differentiation of P19CL6 cells in a dose-dependent manner.

Figure 3.

Insulin induces P19CL6 cell differentiation in a dose-dependent manner. The effect of insulin on cardiac differentiation of P19CL6 cells was assessed using MF20 immunoblotting in control (A), 10 nmol/L (B), 50 nmol/L (C), and 100 nmol/L (D) insulin treated-P19CL6 cell lysates at the indicated time points. The cell lysates were also subjected to immunoblotting analysis on day 0 (before treatment with dimethylsulfoxide [DMSO]) and day 18 (E). (F) Flow cytometry analysis of MF-20 expression. Cells were isolated from day 0 (upper left), day 18 (upper right) of differentiated P19CL6 cells, and day 18 of differentiated P19CL6 cells treatment with 10 nmol/L (lower left), 50 nmol/L (lower middle), and 100 nmol/L (lower right) insulin at day 0 of differentiation for 24 h, and then cells were fixed, stained, and analyzed by flow cytometry.

To further investigate cardiac gene expression following insulin exposure during cardiomyogenic differentiation, real-time PCR analysis were performed to detect the expression of α-MHC and GATA-4. We found that treatment with insulin profoundly increased α-MHC expression at a dosage of 10 nmol/L, as shown in Figure 4A,B (right), the α-MHC mRNA level was first increased at 8 days after cardiac induction and the maximal level was reached after 16 days. Conversely, treatment with a high dose of insulin (50 or 100 nmol/L) resulted in decreased mRNA levels of α-MHC (Fig. 4C,D, right). Likewise, GATA-4 expression was increased upon administration of 10 nmol/L insulin compared with levels in the untreated control cells (Fig. 4A,B, left). In contrast, exposure to 50 and 100 nmol/L insulin failed to maintain the enhancement of GATA-4 expression induced by 10 nmol/L insulin (Fig. 4C,D, left), indicating that GATA-4 expression responds to insulin during cardiac differentiation of P19CL6 cells in a dose-dependent manner.

Figure 4.

The effect of insulin on cardiac marker gene expression. On the indicated days of differentiation, α-myosin heavy chain (α-MHC) and GATA-4 mRNA levels were evaluated by real-time polymerase chain reaction (PCR) analysis in P19CL6 cells (A) and/or treated with 10 nmol/L (B), 50 nmol/L (C), and 100 nmol/L (D) insulin. The results are the mean ± SEM of three independent experiments. *Indicates P < 0.05, and **indicates P < 0.01 compared to control.

The findings that insulin induces cardiac differentiation of P19CL6 cells in a dose-dependent manner prompted us to investigate the effect of insulin on different stage of cardiac differentiation. To this end, differentiated P19CL6 cells were administrated with 10, 50, and 100 nmol/L insulin on day 3, 7, and 11 for 24 h, cells were harvested at the indicated time points and cell lysates were prepared for western blotting analysis using MF20 antibody. As shown in Figure 5, compared with control P19CL6 cells (Fig. 3A), cardiac differentiation of P19CL6 cells was inhibited only in day 11 treatment with 50 and 100 nmol/L insulin (Fig. 5C), whereas 50 and 100 nmol/L insulin treatment on day 3 and 7 induced cardiac differentiation (Fig. 5A,B). However, 10 nmol/L insulin treatment on day 3, 7, and 11 induced cardiac differentiation (Fig. 5A–C). All these findings suggested that that insulin induces cardiac differentiation of P19CL6 cells in a concentration- and stage-dependent manner.

Figure 5.

The effect of insulin on cardiac differentiation of P19CL6 cells at different stage. Administration of 10, 50, and 100 nmol/L insulin on day 3 (A), day 7 (B), and day 11 (C) of cardiac differentiation of P19CL6 cells for 24 h, cells were harvested at the indicated time points, and the expression of MHC was assessed using MF20 immunoblotting in cell lysates. Ins, insulin.

Discussion

Insulin was found to be involved not only in glucose uptake and utilization via regulation of the crucial proteins in muscle and adipose tissue, such as FOX transcription factors, estrogen receptor, and HDAC2 (Desvergne et al. 2006; Deng et al. 2008; Sun & Zhou 2008; Gerin et al. 2009), but also in myogenesis, breast cancer, autophagy and mitochondriogenesis (Conejo et al. 2001; Pawlikowska et al. 2006; Chan et al. 2012; Yang & Yee 2012). Here, we showed that insulin induces proliferation and cardiac differentiation of P19CL6 cells in a dose-dependent manner. The observation that proliferation and cardiac differentiation of P19CL6 cells in response to insulin stimulation is potentially very important and has clinical implications during insulin treatment.

By MTT experiments, FACS analysis, DAPI staining, and Annexin V-FITC/PI apoptosis assay, we demonstrated that low insulin concentration induces P19CL6 cell growth by increasing the speed of the cell cycle and upregulation of cell cycle activator cyclin D1 expression, whereas high insulin concentration inhibit cell growth by induction of S-phase arrest or apoptosis. Of interest, Cirri et al. (2005) showed that insulin inhibits platelet-derived growth factor-induced NIH3T3 and C2C12 cell proliferation. Gezginci-Oktayoglu et al. (2012) showed that decreasing insulin secretion causes beta cells apoptosis in hyperglycemic rats. Therefore, it would be tempting to examine whether these proliferation and apoptosis events plays any role in the glucose uptake and utilization.

As revealed by immunoblotting with antibodies specific for the sarcomeric MHC (MF-20), cardiac differentiation of P19CL6 cells was induced and blocked upon 10 and 50/100 nmol/L insulin stimulation, respectively. Also worth mentioning is the upregulation of GATA-4 mRNA levels induced by 10 nmol/L insulin and the gradual downregulation of GATA-4 mRNA levels mediated by 50/100 nmol/L insulin after day 12 of differentiation when compared to control cells. The precise molecular mechanisms of this observation are currently unknown, given that previous studies showed that insulin regulates cardiac differentiation of pluripotent cells partially through Wnt signaling (Naito et al. 2005; Freund et al. 2008; Lian et al. 2012, 2013), we speculate that 10 nmol/L insulin activated Wnt signaling, which subsequently activated the expression of GATA-4, one of the most important transcription factors, whereas 50/100 nmol/L insulin blocked the Wnt signaling pathway, which subsequently inhibited the expression of GATA-4, thereby causing induced and blocked cardiac differentiation of P19CL6 cells, respectively.

In addition to showing that insulin plays roles in cell growth and cardiac differentiation, we have also found that insulin regulates the expression of cyclin D1/BAD and α-MHC/GATA-4 to have an effect on cell growth and differentiation. One previous study demonstrated either the upregulation of cyclin D1 expression or induction of P19CL6 cell proliferation by insulin-like growth factor 1 (IGF-1; Yang et al. 2007). Together, these findings implicate a potential mechanism for the induction of proliferation and cardiac differentiation in response to insulin stimulation. Moreover, the expression of BAD also is regulated by insulin in a dose-dependent manner, which exists in a reversed trend when compared to cyclin D1. Based upon this observation, we speculate that insulin effects dual roles in P19CL6 cell growth and apoptosis. Although the underlying mechanisms are not fully understood, it is conceivable that different dose-insulin has, in association with different downstream signaling effectors, finally activated the expression of either cyclin D1 or BAD to stimulate cell growth and apoptosis. Also worth mentioning is that both GATA-6 and PPARα can partly rescue the reduced expression of cyclin D1 and partly reverse the enhanced mRNA levels of BAD in response to 100 nmol/L insulin. Based on these observations, we speculate that both GATA-6 and PPARα may be associated with the downstream effectors or upstream regulators of insulin signaling pathway.

In conclusion, the effects of insulin on P19CL6 cell growth and cardiac differentiation are mediated through the regulation of cyclin D1/BAD and α-MHC/GATA-4 expression. These findings represent a novel mechanism of insulin in cell growth and differentiation and have new clinical implications in the area of insulin therapies.

Acknowledgments

We thank Dr Issei Komuro, Dr Yunzeng Zou and Dr Chunyan Zhou for providing the P19CL6 mouse embryonic carcinoma cells. This study was supported by grants from the Ministry of Science and Technology of China (863 Program: 2007AA02Z122 and 2012AA022501 to M-X.Z.), the National Natural Science Foundation of China (no. 81141044 and 81371895 to M-X.Z, and no. 31071206 to L-X.X), the International Cooperation and Exchange Foundation of Henan Scientific Committee (082102310024, and 104300510016 to M-X.Z), the Scientific Research Foundation for the Returned Overseas Chinese Scholars, the State Education Ministry (SRF for ROCS, SEM) and the Ministry of Personnel, and the Henan University Key Teacher Foundation.

Ancillary