SEARCH

SEARCH BY CITATION

Keywords:

  • bone morphogenetic protein;
  • chick embryo;
  • Ebf2;
  • Ebf3;
  • lateral sclerotomal marker

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References
  9. Supporting Information

The chick Early B-cell Factor-2 and 3 (cEbf2 and cEbf3) genes are members of EBF family of helix loop helix transcription factors. The expression, regulation and importance of these genes have been extensively studied in lymphatic, nervous and muscular tissues. Recently, a new role for some members of EBF in bone development has been investigated. However, the expression profile and regulation in the axial skeleton precursor, the somite, have yet to be elucidated. Therefore, this study was aimed to investigate the expression and regulation of cEbf2 and cEbf3 genes in the developing chick embryo somite from HH4 to HH28. The spatiotemporal expression study revealed predominant localization of cEbf2 and cEbf3 in the lateral sclerotomal domains and later around vertebral cartilage anlagen of the arch and the proximal rib. Subsequently, microsurgeries, ectopic gene expression experiments were performed to analyze which tissues and factors regulate cEbf2 and cEbf3 expression. Lateral barriers experiments indicated the necessity for lateral signal(s) in the regulation of cEbf2 and cEbf3 genes. Results from tissue manipulations and ectopic gene expression experiments indicate that lateral plate-derived Bmp4 signals are necessary for the initiation and maintenance of cEbf2 and cEbf3 genes in somites. In conclusion, cEbf2 and cEbf3 genes are considered as lateral sclerotome markers which their expression is regulated by Bmp4 signals from the lateral plate mesoderm.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References
  9. Supporting Information

Somites are paired blocks of mesodermal cells that have originated from the cranial end of the presomitic mesoderm (crPSM). New somites are continuously formed from the crPSM in an anterior-to-posterior direction. The furthest posterior somite is the most newly formed (immature) somite, somite I (SI), the next cranial somite is SII, and so on (nomenclature according to, Christ & Ordahl 1995). The first three newly formed immature somites (from SI to SIII) are spherical and composed of an outer columnar epithelial layer and a mesenchymal core in the centre, the somitocoele. The ventro-medial portion of somite IV, which is epithelial, undergoes epithelial-mesenchymal transition to form the sclerotome giving rise to the first mature somite. The sclerotome is the primordium for the entire vertebral column and also gives rise to the proximal ribs (Dietrich et al. 1997). Once formed, the sclerotome is subdivided along the anterior posterior axis into anterior and posterior half by von Ebner's (intra-somitic) fissure (Christ & Wilting 1992). The anterior half is invaded by neural crest cells and their derivatives, dorsal root ganglia (DRG) and nerve axons, and functionally interacts with these neuronal structures, guiding them to their targets (Bronner-Fraser & Stern 1991).

Bone morphogenetic proteins (BMPs) from the lateral mesoderm are crucial for normal formation and patterning of sclerotome. Previous studies have shown that the activation of lateral somitic programs depends on members of the Bmp signaling family, especially Bmp2/4, released by the lateral plate mesoderm (McMahon et al. 1998; Tonegawa & Takahashi 1998; Dockter 2000). Furthermore, Smad-mediated Bmp4 signals from the lateral plate mesoderm induce the expression of the lateral somitic marker Sim1 (Pourquie et al. 1996) and control axial chondrogenesis through maintenance of Bapx1/Nkx3.2 and Sox9 expression (Murtaugh et al. 2001; Zeng et al. 2002).

The chick early B-cell factors (Ebf) genes are members of the EBF family, which is a novel highly conserved family of atypical helix-loop-helix (HLH) transcription factors. To date, four Ebf genes (Ebf1-4) and three Ebf genes (Ebf1-3) have been isolated from mouse embryos (Garel et al. 1997; Wang et al. 2002), and chick embryo (Nieminen et al. 2000; Mella et al. 2004), respectively. Several previous studies have demonstrated the importance of these Ebf genes for tissue specification, differentiation and cell movements during development of many tissues including lymphatic, adipose, nervous and muscular tissues. Therefore, the expression profile of Ebf genes was extensively detailed in B-lymphocytes, adipocytes, neural cells and myoblast (reviewed by Dubois & Vincent 2001; Liberg et al. 2002). Although some previous studies have showed expression of some members of the EBF family in the somites, no detailed analysis of these genes expression in the somites was established. There is scarce available data to show that some members of Ebfs are expressed in different domains of somites. For example, mouse mEbf1-3 genes are expressed in the medial (mEbf1) and lateral (mEbf2 and mEbf3) parts of the sclerotome (Garel et al. 1997; Kieslinger et al. 2005). In Xenopus, xEbf2 is expressed in cells located at the lateral halves of somites (Dubois et al. 1998). mEbf2 homologue in Amphioxus, AmphiCoe, is expressed in a more lateral domain in somites (Mazet et al. 2004).

The diversity of expression and function of Ebf genes suggests the presence of a large variety of signaling molecules regulating these genes. Several studies have disclosed genetic interactions between Ebf genes and some of the most important regulators of development including; Hedgehog (Hh) (Vervoort et al. 1999; Mohler et al. 2000; Hersh & Carroll 2005) and Notch/Delta (Crozatier et al. 1996, 2002; Pozzoli et al. 2001). All of these studies have been performed in tissues (e.g. lymphatic, nervous and muscular tissues) other than somites. Analysis of the lateral somitic expression of Xenopus xEbf2 expression profiles (Dubois et al. 1998) and Amphioxus AmphiCoe (Mazet et al. 2004), suggests that lateral tissues (intermediate and lateral plate mesoderm) may regulate expression of these genes in somites. The most important molecules are members of the Bmp family most notably Bmp4, which is responsible for patterning of the somites along the mediolateral axis (Tonegawa et al. 1997; McMahon et al. 1998; Schmidt et al. 1998; Tonegawa & Takahashi 1998). This raises the possibility that Bmp4 may control Ebf genes expressed in the lateral somitic domains. In support of this idea, somitic expression of mEbf2 (Kieslinger et al. 2005) is maintained throughout the skeletogenesis process, which is mainly regulated by Bmp signals, which are essential for proper formation of skeleton. Pertinently, mEbf2 null mice have a clear bone phenotype characterized by osteopenia (Kieslinger et al. 2005).

We hypothesized that the somitic expression of cEbf2 and cEbf3 in chick is controlled by Bmp signals from the lateral plate mesoderm. Therefore, this work aimed to determine the gene expression of chick cEbf2 and cEbf3 genes during somite development as well as to identify the role of Bmps signaling pathways in regulation of this expression.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References
  9. Supporting Information

Embryo preparation

Fertilized white leghorn chicken eggs, supplied by Henry Stewart & Company, were incubated at 38°C, 80% relative humidity until embryos reached the appropriate stages (HH4-HH28) as assessed using the chick embryo staging guide (Hamburger & Hamilton 1951).

Embryo manipulations

Manipulations were performed at a cranial presomitic mesoderm level to study the initiation processes or at the epithelial somite level for the maintenance program. Unless stated otherwise, most operations were performed at HH11-12 in ovo. Lateral barrier insertion, ectodermal removal and neural tube ablation were performed as has been previously described by (Otto et al. 2006).

Application of beads

Affigel beads (100–150 μm, Bio-rad) or heparin acrylic beads (50–100 μm, Sigma, H5263) were washed in phosphate-buffered saline (PBS) and then incubated in 2 μL of 50, 100 and 150 μg/mL recombinant human BMP4 (R&D Systems) or 100 μg/mL recombinant human BMP7 (R&D Systems), respectively, for 1 h at 37°C. A small slit was made in crPSM and then one to three beads were picked up with fine curved forceps and forced into the slit.

Grafting of RCAS-Noggin infected cells

The full-length Xenopus noggin construct (a kind gift from Richard Harland and Dale Frank) was cloned into the shuttle vector Slax (Morgan & Fekete 1996) and then cloned into a replication-competent retroviral vector (RCAS) using established techniques (Logan & Tabin 1998). Chicken embryo fibroblasts, DF-1 cells (CRL-12 203), transfected with the viral construct were grown as previously described (Lamb et al. 1993). Confluent cultures were harvested, and cells were washed in PBS, pelleted, and resuspended in a minimal volume of PBS. Control infections were performed using an empty RCAS construct. Embryonic ectoderm over the operation region was stained lightly with Nile blue staining tips. A fine tunnel was made beneath the ectoderm at the following sites: (i) between the neural tube and somitic mesoderm (medial injection); and (ii) parallel to the lateral edge of the paraxial mesoderm (lateral injection). The prepared cells were blown into the tunnel in one motion, giving an equally dispersed cylinder of cells along a length of 3–6 somites.

Cloning and preparation of cEbf2 and cEbf3 probes

Chick Ebf2 and cEbf3 DNA, were cloned by reverse transcription–polymerase chain reaction (RT–PCR) using primers based on highly conserved regions in DNA binding domain of mouse mEbf2 and cEbf3 as described by (Garcia-Dominguez et al. 2003; Mella et al. 2004). The forward primer for cEbf2 was 5′ TCAGGACTGAACAGGATCTG 3′ and the reverse was 5′ GGTTATTGTGGACGAACAG 3′. The forward primer for cEbf3 was 5′ CGCCTCATAGACT-CCATGAC 3′ and the reverse was 5′ TGTATCACTCACTCCAGAC 3′. Total RNA was isolated from 3-day-old whole chick embryos using Trizol (Invitrogen). Total RNA was then reverse transcribed using M-MLV reverse transcriptase as described by the manufacturer (Qiagen). PCR was performed with the following cycling parameters: 95°C for 5 min for initial denaturation, followed by 40 cycles with 94°C for 30 s, annealing temperature 60°C (cEbf2) and 58°C (cEbf3) for 1 min, 72°C for 2 min, and final extension at 72°C for 10 min. PCR products were analyzed by 1% gel electrophoresis, and products of the correct size (405 bp for cEbf2 and 504 bp for cEbf3) purified and ligated into pGEM-T Easy vector. Cloning procedure was as described by the manufacturer (Promega). Plasmid DNA was linearised using Sac II restriction enzymes.

RNA probes were transcribed from 1 μg linearized plasmid DNA in a total reaction volume of 20 μL containing the following constituent parts: 1 μg of purified linear DNA, 1 μL RNase inhibitor, 4 μL 5× transcription buffer, 2 μL 10× labelling mix, 2 μL of SP6 RNA polymerase enzyme and a calculated amount of RNase-free water to make the volume up to 20 μL. The reaction was incubated at 37°C for 2 h. The probe was precipitated by adding 2.5 μL 4M LiCl and 75 μL prechilled 100% ethanol to the RNA and incubated for at least 1 h at −70°C followed by centrifugation at 11 337 g for 10 min. Following a prechilled 70% ethanol rinse and 2 min spin, all liquid was removed by inverting the tube; the pellet was briefly air-dried and finally resuspended in 100 μL TE, giving an approximate concentration of 0.1 μg/μL. 5 μL of the probe was analyzed by gel electrophoresis to gauge the quality and quantity of probe. RNA probes were stored at −80°C.

Whole mount in situ hybridization

Harvested embryos were washed in phosphate-buffered saline (PBS) and fixed in 4% paraformaldehyde (PFA), overnight at 4°C. Antisense RNA probes were labeled with digoxygenin and in situ hybridization was performed as the protocol previously described by (Nieto et al. 1996).

Cryo-sectioning and photography

Embryos were frozen in tissue embedding medium (Jung) and cryo-sectioned at of 20 μm for HH 4-12 and 30 μm for older stages. Sections were mounted on tespa coated slides and the slides were then mounted using hydro-mount, cover slipped and left to dry overnight before photographing. Following whole mount in situ hybridization embryos were photographed using a Nikon E990 digital camera mounted on a Nikon dissecting microscope with both side and underneath illumination. Sections were photographed using a Leica DMRA2 microscope and DC300 camera system. Minor adjustments to contrast and brightness were made using Adobe Photoshop CS5.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References
  9. Supporting Information

Expression of cEbf2 and cEbf3 in somites

Prior to somitogenesis, cEbf2 transcripts were expressed around the Hensen's node (HN) (arrowhead, Fig. 1A) and in two small localized regions of ectodermal cells at the edges of the anterior part of the primitive streak (PS) (arrow, Fig. 1A,C). cEbf3 expression partially overlapped cEbf2 in the lateral region around the HN (green arrowhead, Fig. 1B) and also anteriorly, encompassing the neural plate (red arrowhead, Fig. 1B). Transverse sections at the level of HN revealed that cEbf3 is expressed in lateral mesodermal cells far away from the axial and paraxial regions (arrowhead, Fig. 1D). At HH8, cEbf2 was expressed very weakly in the crPSM and symmetrically throughout the medial and lateral domains of all somites (Fig. 1E). Sections showed that cEbf2 is expressed symmetrically in SI (Fig. 1G), but is excluded from the dorsal epithelia (dermomyotomal precursor) (black outlined area, Fig. 1G). cEbf3 was only noticed in the lateral somitic domains of the most cranial two somites with a stronger expression in SIV and a weaker expression in SIII (Fig. 1F). Sections showed expression of cEbf3 in the dorsolateral epithelia and the adjacent lateral somitocoele (Fig. 1H). The dermomyotomal precursor area is also negative for cEbf3 (black outlined area, Fig. 1H).

image

Figure 1. Whole mount in situ hybridisation analysis of cEbf2 and cEbf3 expression during HH5-8. (A) HH5 – Initial expression of cEbf2 lateral to Hensen's node (green arrowhead) and close to the anterior primitive streak (black arrow). (B) HH5+cEbf3 expression lateral to the HN (green arrowhead) and the neural plate (red arrowhead). (C) Transverse section – cEbf2 is expressed in some ectodermal cells flanking the cranial PS (arrow). (D) Transverse section – cEbf3 is expressed in the lateral mesoderm (arrowhead). (E) At HH8+, cEbf2 is uniformly expressed in all somites and in the neural fold/tube and head mesenchyme until the forebrain. (F) cEbf3 is only expressed in lateral domain of most cranial two somites (SIII and SIV) and in the head mesenchyme up to the midbrain. (G) Transverse section revealed a symmetrical cEbf2 expression throughout the sclerotomal precursor and somitocoele of SI. No cEbf2 expression in the dermomyotomal precursor was seen (black outlined areas). (H) Transverse section – cEbf3 is expressed in the lateral somitic epithelia, but not in the dermomyotomal precursor area (black outlined area). Ect, ectoderm; HN, Hensen's node; Mes, mesoderm; N, notochord; NG, neural groove; NP, neural plate; PS, primitive streak; crPSM, cranial presomitic mesoderm; S I, somite 1; SIV, somite 4. Scale bars: A, B, E, F = 1 mm, C, D, G, H = 150 μm.

Download figure to PowerPoint

During stages HH11-13, the two chick cEbf genes were expressed in lateral halves of somites (Fig. 2A,B). Transverse sections revealed this expression in the ventrolateral somitic epithelia of the immature somites (Fig. 2C) and laterally in the sclerotome (Fig. 2D). No expression was detected in either the dorsal somitic epithelia (Fig. 2C) or their derivative, the dermomyotome (yellow outlined area, Fig. 2D). At HH14-16, cEbf2 was detected throughout the crPSM and showed a broader expression domain in the immature somites; however, in all remaining somites it became restricted to the lateral sclerotomal domain with a slight medial expansion (HH16, Fig. 2E,G). cEbf3 was expressed in the most lateral domains of the sclerotome (HH14, Fig. 2F,H). Moreover, the two cEbf genes remained absent in the dermomyotome precursor area (Fig. 2G,H). By stage HH18, the two cEbf genes were co-expressed in the crPSM and in a more lateral portion of the sclerotome close to, but not in, the ventrolateral dermomyotomal lip (Fig. 2I–L). Coincident with the appearance of the neural structures in the anterior half of sclerotome at HH 24, the new expression pattern of cEbf2 and cEbf3 was seen in the dorsal root ganglia (DRG) (black arrowheads, Fig. 2M,N), whereas, the earlier lateral sclerotomal expression became confined to the ventrolateral portion of the somite (blue arrowheads, Fig. 2M–P). Moreover, the two genes were expressed either weakly (cEbf2) or strongly (cEbf3) at the middle portion of the anterior somitic half (yellow arrowheads, Fig. 2M,N). Transverse sections indicated this expression is in an elongated band of mesenchymal cells medial (yellow arrowheads, Fig. 2O,P) and lateral (red arrowheads, Fig. 2O,P) to the dermomyotome.

image

Figure 2. Whole mount in situ hybridisation showing cEbf2 and cEbf3 expression profile during HH11-22. (A) HH13 – cEbf2 expression becomes confined to the lateral somitic domains. (B) HH11 – cEbf3 completely overlapped cEbf2 in the lateral somitic domains. (C) Transverse section through immature somites at the level marked in (B) revealed cEbf3 expression in the dorsolateral somitic epithelia and the adjacent portion of the somitocoele. (D) Transverse section through mature somites at the level marked in (B) –The lateral cEbf3 expression continued in the lateral sclerotome; however, the dermomyotome remained negative (two yellow outlined areas). (E) HH16 – inset, cEbf2 expression is broader in immature than mature somites. (F) HH14 – cEbf3 completely overlapped cEbf2 expression in the lateral somitic domain. (G) Transverse section at the level marked in (E) – cEbf2 expression in the lateral and central sclerotomal portions. (H) Transverse section at the level marked in (F) – cEbf3 completely overlapped cEbf2 in the lateral sclerotomal portion. (I) HH18 – cEbf2 is expressed in the crPSM, throughout immature somites, the lateral domain of the mature somites. (J) HH18 – cEbf3 is activated in the lateral portion of the PSM and overlapped cEbf2 expression in somites. (K) Transverse section at the level marked in (I) – cEbf2 is mainly expressed in the lateral sclerotomal domain. (L) Transverse section at the level marked in (J) – cEbf3 overlapped cEbf2 in the lateral sclerotomal domain. (M) HH22 – cEbf2 is expressed strongly in the ventrolateral (blue arrowhead) and cranial border (yellow arrowhead) of somites and weakly in DRG (black arrowhead). (N) HH22 – cEbf3 is expressed in the middle portion of somitic anterior half (yellow arrowhead), the ventrolateral somitic portion (blue arrowhead) and in the DRG (black arrowhead). (O) Transverse section at the level marked in (M) – cEbf2 is expressed lateral (red arrowhead) and medial (yellow arrowhead) to the hypaxial dermomyotomal domain, in DRG and around the ventral portion of spinal nerve (blue arrowhead). (P) Transverse section at the level marked in (N) – cEbf3 expressed in the DRG, around the spinal nerve (blue arrowhead) and around the dermomyotomal domain (yellow and red arrowheads). DM, dermomyotome; DRG, dorsal root ganglia; LPM, lateral plate mesoderm; N, notochord; NT, neural tube; SN, spinal nerve. Scale bars: A, B, E, F, I, J, M, N = 1 mm, C, D, G, H, K, L, O, P = 150 μm.

Download figure to PowerPoint

Whole mount embryos at stage HH26 was quite similar to the HH24 embryo, with clear overlapping expression of cEbf2 and cEbf3 in the DRG and laterally in the somitic anterior half (Fig. 3A,B). During vertebrate chondrogenesis at HH28, cEbf2 and cEbf3 expression became localized around the cartilage blastemas of the dorsal neural arches except at its most dorsal portion and spinous process precursors (yellow arrowheads, Fig. 3C,D). In addition, they were also expressed in the prospective area of the proximal ribs (blue arrowheads, Fig. 3C,D) and in the mesenchyme lateral to either the hypaxial (cEbf2- red arrowhead, Fig. 3C) or epaxial plus hypaxial (cEbf3- red arrowhead, Fig. 3D) muscle precursor domains.

image

Figure 3. Whole mount in situ hybridization showing cEbf2 and cEbf3 expression profile during HH26-28. (A) HH26 – cEbf2 expression remained laterally in the anterior half of somites and in the proximal of the DRG. (B) HH26 – cEbf3 expression overlaps cEbf2 laterally in the anterior somitic half and dorsally in the DRG. (C) HH28 – Transverse section through thoracic somites – cEbf2 is expressed at the periphery of the bone anlagen of both the neural arches lamina (excluding the most dorsal portion) (yellow arrowhead) and the proximal ribs (blue arrowhead), as well as in the mesenchyme lateral to the hypaxial muscular domain (red arrowhead). (D) HH28 – Transverse section through thoracic somites – cEbf3 overlaps cEbf2 in the bone anlagens (yellow and blue arrowheads) and in the mesenchyme lateral to the prospective trunk muscular domain (red arrowhead). N, notochord; NT, neural tube. Scale bars: A, B = 1 mm, C, D = 50 μm.

Download figure to PowerPoint

Lateral structures regulate cEbf2 and cEbf3 genes expression in the somites

The lateral somitic expression of cEbf2 and cEbf3 suggests a role for the lateral tissues (intermediate [IM] and lateral plate mesoderm [LPM]) in induction and/or maintenance of these two genes. To test whether the lateral tissues can induce cEbf2,3 expression in somites, the crPSM of HH12 embryo was separated from the IM/LPM by insertion of an impermeable barrier (with a length of 5–9 prospective somites) and then the operated embryo was reincubated for approximately 14 h until HH17. Somites that developed adjacent to the barrier completely lacked cEbf2 (green arrowhead, Fig. 4A, n = 6/6) and cEbf3 (green arrowhead, Fig. 4C, n = 6/6) as compared to the control somites (yellow arrowheads, Fig. 4A,C). Transverse sections at the operation sites revealed complete absence of the two cEbf genes expression in the sclerotome (green arrowheads, Fig. 4B,D) in comparison to the expression in the control sides (yellow arrowheads, Fig. 4B,D). These findings indicate that the lateral tissues or factors emanating from them are essential for induction of cEbf2 and cEbf3 genes in the somites.

image

Figure 4. Effect of lateral barrier insertion on cEbf2 and cEbf3 genes expression. (A–D) Whole mount in situ hybridization of HH17 chick embryos following lateral barriers insertion between IM/LPM and the crPSM. The red lines indicate the position of the barriers. The operation sides showed complete downregulation of cEbf2 (A) and cEbf3 (C) expression in the somites medial to the lateral barrier (green arrowheads) compared to the control side (yellow arrowheads). Transverse sections of embryos shown in (A and C), sclerotomal expression was completely extinguished in the somites medial to the barrier (green arrowheads) compared to the control somites (yellow arrowheads). (E, F) Whole mount in situ hybridization of chick embryos after implantation of the lateral barrier between IM/LPM and epithelial somites, the operation side showed complete downregulation of cEbf2 (E) and cEbf3 (F) expression in the somites (green arrowheads). In all photos, the red lines indicate the position of the barriers. IM, intermediate mesoderm; LPM, lateral plate mesoderm; NT, neural tube. Scale bars: A, C, E, F = 300 μm, B, D = 150 μm.

Download figure to PowerPoint

Insertion of barriers between the newly formed 5–8 somites and the IM/LPM of HH12 embryos followed by reincubation for 14–18 h resulted in complete downregulation of both cEbf2 (arrowhead, Fig. 4E, n = 5/5) and cEbf3 (arrowhead, Fig. 4F, n = 5/5) in the somites at the operation sides. These results suggested that the lateral tissues are also required for maintenance of cEbf2 and cEbf3 expression.

Inhibition of Bmp2/4 blocks cEbf2 and cEbf3 gene expression

Lateral barriers experiments indicate the necessity for lateral signal(s) in the regulation of cEbf2 and cEbf3 genes. Bmp4 is the most abundant gene expressed in the lateral plate mesoderm that is also crucial for mediolateral patterning of somites (Tonegawa et al. 1997; McMahon et al. 1998; Tonegawa & Takahashi 1998). Therefore, it may have a role in regulation of these genes.

BMP2/4 function can be abrogated by local implantation of cells secreting Noggin. To evaluate whether endogenous Bmp signaling regulates expression of cEbf2 and cEbf3 genes in vivo, pellets of chick DF-1 fibroblast cells transfected with a Noggin-RCASBP(A) virus or alone (control) were implanted medial or lateral to crPSM or epithelial somites at HH12. After 14–16 h incubation, cEbf2 and cEbf3 expression was analyzed by whole mount in situ hybridization. In accordance with previous studies (McMahon et al. 1998; Tonegawa & Takahashi 1998; Sela-Donenfeld & Kalcheim 2002), medial injection of Noggin cells between crPSM and neural tube led to the absence of dermomyotome and upregulation of the medial sclerotomal marker cPax1 compared to the control embryo (Appendix S1). This confirmed that the Noggin cells used in our experiments worked efficiently and any further change in cEbf2 and cEbf3 genes expression should be due to the Noggin activity.

Control embryos were injected with non-transfected DF-1 cells either between the crPSM (Fig. 5A, n = 6/6) and the lateral mesoderm or between the epithelial somites and lateral mesoderm (Fig. 5C, n = 6/6). As expected, no changes have been observed in the expression of any of the two cEbf genes (Fig. 5A–D). Injection of Noggin secreting DF-1 cells lateral to the crPSM resulted in complete loss of cEbf2 and cEbf3 genes expression in the sclerotome (Fig. 5E–H, n = 16/18) compared to the somites situated adjacent to DF-1 cells implanted on the control embryo (Fig. 5E–H). The kink in the embryos is caused by the smaller somites on the operated side. Unlike medial injection, lateral injection of the Noggin secreting cells does not interfere with normal development of the dermomyotome. Similar operations performed at the level of epithelial somites also resulted in a complete absence of cEbf2 and cEbf3 genes expression in the somites adjacent to the Noggin secreting cells as compared to the non-treated somites in the opposite side (Fig. 5I–L, n = 17/18) and to control injected embryos (Fig. 5C,D). These findings indicate that blockade of Bmp signaling in the somite, by placement of Noggin producing cells lateral to PSM, can specifically inhibit expression of cEbf2 and cEbf3 genes, which are normally expressed in lateral regions of the sclerotome. Thus, Bmp signals are necessary for induction and maintenance of the two chick genes.

image

Figure 5. Effect of lateral ectopic Noggin administration on cEbf2 and cEbf3 genes expression. (A–D) Whole mount in situ hybridization of HH17 (cEbf2) and HH18 (cEbf3) chick embryos and cross-sections following implantation of DF-1 control cells either between crPSM and lateral mesoderm (A and B) or between epithelial somites and lateral mesoderm (C, D) showing normal unaffected cEbf2 and cEbf3 expression in the somites at the operation sites (regions between each two blue arrowheads). The green arrowheads indicate the prospective site of the injected cells. (E–H) Whole mount in situ hybridization and cross-sections of HH18 chick embryos following injection of Noggin expressing cells between crPSM and lateral mesoderm (regions between each two blue arrowheads) showing complete downregulation of cEbf2 (E and F) and cEbf3 (G and H) expression in the somites at the operation sites. The kinks in the embryos are caused by the smaller somites on the operation side. (I–L) Whole mount in situ hybridization and cross-sections of HH17 (cEbf2) and HH18 (cEbf3) chick embryos following introduction of Noggin secreting cells between epithelial somites and lateral mesoderm (regions between each two arrowheads) showing complete loss of cEbf2 (I and J) and cEbf3 (K and L) expression in the somites at the operation sites. In all photos, the operation sites are indicated by the region between the two blue arrowheads. The prospective site of the injected cells is indicated by the green arrowheads. DM, dermomyotome; N, notochord; NT, neural tube. Scale bars: A, C, E, G, I, K = 300 μm, B, D, F, H, I, L = 150 μm.

Download figure to PowerPoint

To check whether inhibition of Bmp signaling in the medial somitic domain can also downregulate cEbf2 and cEbf3 expression, Noggin secreting cells were injected medially either between the neural tube and the crPSM or the NT and formed somite. Control injected embryos showed normal sclerotomal expression of cEbf2 and cEbf3 genes at the injected region (Fig. 6A–D, n = 9/9). Unexpectedly, implantation of Noggin expressing cells medial to the crPSM caused a complete downregulation of cEbf2 (Fig. 6E, n = 4/5), while cEbf3 expression was slightly reduced (yellow arrowhead, Fig. 6G, n = 4/5). On transverse sections, although this operation resulted in expansion of sclerotomal domain on the expense of the dermomyotomal domain, no cEbf2 expression was seen in the entire sclerotome (Fig. 6F). cEbf3 localized at the most ventrolateral portion (yellow arrowhead, Fig. 6H). Implantation of DF-1 cells overexpressing Noggin medial to the epithelial somites resulted in slight medial downregulation of cEbf2 (yellow arrowheads, Fig. 6I,J, n = 5/5) and very slight medial reduction of cEbf3 (yellow arrowheads, Fig. 6K,L, n = 4/5).

image

Figure 6. Effect of medial ectopic Noggin administration on cEbf2 and cEbf3 genes expression. (A–D) Whole mount in situ hybridization (A, C) and transverse sections (B, D) of HH18 chick embryos following introduction of DF-1 control cells either between crPSM and neural tube (A,B) or between epithelial somites and neural tube (C, D) showing normal cEbf2 (A, B) and cEbf3 (C, D) expression throughout the sclerotome at the operation sites along with normal development of dermomyotome. (E–H) Whole mount in situ hybridization (E, G) and transverse sections (F, H) of H1H8 chick embryos following injection of Noggin-driven cells between crPSM and neural tube showing complete loss of cEbf2 (E, F) and only slight reduction of cEbf3 (yellow arrowheads, G, H) expression in the sclerotome at the operation sites. The kinks in the embryos are resulted from the smaller ill-developed somites on the operation side. The dermomyotome failed to develop at injection sites (F, H). (I–L) Whole mount in situ hybridization (I,K) and transverse sections (J, L) of HH18 chick embryos following implantation of Noggin expressing cells between epithelial somites and neural tube showing slight reduction of cEbf2 (yellow arrowheads, I, J) and cEbf3 (yellow arrowheads, K, L) expression in the sclerotome at the operation sites. In all photos, the operation sites are indicated by the region between the two blue arrowheads. The prospective site of the injected cells is indicated by the green arrowheads. DM, dermomyotome; N, notochord; NT, neural tube. Scale bars: A, C, E, G, I, K = 300 μm, B, D, F, H, J, L = 150 μm.

Download figure to PowerPoint

Effect of ectopic expression of BMP4 on cEbf2 and cEbf3 gene expression in somites

To check the effect of gain of BMP4 function on cEbf2 and cEbf3 expression, Affigel-coated beads soaked in BMP4 protein were implanted into the crPSM of HH11-13 embryos followed by 14–18 h incubation. Beads soaked in recombinant BMP4 protein at concentrations below the apoptotic threshold, e.g. 50–200 μg/mL, have previously been shown to be functionally active in the chick embryo (Schmidt et al. 1998). In agreement with previous studies (Tonegawa et al. 1997; Schmidt et al. 1998), implantation of BMP4 (50 μg/mL) loaded beads (Fig. 7A,B, n = 4/4) in the crPSM resulted in downregulation of cPax1 expression in the sclerotome and defective dermomyotomal development (green arrowhead, Fig. 7B). This result confirmed the accuracy and efficiency of the prepared BMP4 beads.

image

Figure 7. Effect of ectopic expression of BMP4 and BMP7 on cEbf2 and cEbf3 and cPax1 gene expression in somites. (A–H) Whole mount in situ hybridization of HH16 (cEbf3 and cPax1) and HH19 (cEbf2) embryos following implantation BMP4 loaded Affigel beads (magenta arrowheads) in the crPSM. In all BMP4 beads implanted embryos, the dermomyotome is defectively developed. (A) Whole mount and (B) transverse section of implanted embryo show complete downregulation of cPax1 in the sclerotome adjacent to 50 μg/mL BMP4 soaked bead. (C) Whole mount and (D) transverse section show very slight medial upregulation of cEbf2 with medial expansion toward the neural tube in area adjacent to 50 μg/mL BMP4 loaded bead (green arrowheads). (E) Whole mount and (F) transverse section show strong ectopic expression of cEbf3 in the dorsomedial sclerotomal portion adjacent to 50 μg/mL BMP4 loaded bead (green arrowheads). (G) Whole mount and transverse section (H) of embryo implanted with bead at higher concentration (150 μg/mL) of BMP4 show a graduate upregulation of cEbf3 expression in the medial somitic domain in the vicinity of the beads (green arrowheads). (I, J) Whole mount in situ hybridization of HH19 embryos following implantation of 100 μg/mL BMP4-loaded Affigel beads (magenta arrowheads refer to beads) in crPSM and medial to the cranial portion of the lateral barrier. (I) The lost cEbf3 expression after separation of the lateral plate mesoderm from the axial structure by lateral barrier is completely restored in somites containing the BMP4-loaded Affigel beads (yellow arrowhead), whereas somites caudal to beads and medial to the barrier do not express cEbf3 (green arrowhead). (J) Transverse section of embryo at bead level shows normal (restored) cEbf3 expression in the sclerotome flanking the bead (yellow arrowhead). (K, L) Whole mount in situ hybridization of HH16 embryos following implantation of 100 μg/mL BMP7 loaded heparin acrylic beads in the crPSM showing expression of cEbf2 (K) and cEbf3 (L) The expression of the two genes was completely downregulated in somites adjacent to BMP7-loaded beads. DM, dermomyotome; N, notochord; NT, neural tube. Scale bars: A, C, E, G, I, K, L = 300 μm, B, D, F, H, J = 150 μm.

Download figure to PowerPoint

Implantation of BMP4 beads at a lower concentration (50 μg/mL) resulted in a moderate dorsomedial expansion of cEbf2 toward the neural tube (green arrowheads, Fig. 7C,D, n = 5/6). cEbf3 showed the most marked response to the exogenous BMP4, since it upregulated adjacent to the bead in the dorsomedial sclerotome (green arrowheads, Fig. 7E,F, n = 6/6). To explore whether cEbf3 gene expression responds to higher concentration of BMP4, beads soaked in 150 μg/mL BMP4 (still below the apoptotic threshold) were placed in the crPSM of HH 12 chick embryo followed by 14–18 h incubation. cEbf3 gene showed more intense and broader ectopic medial expression in the sclerotome (green arrowheads, Fig. 7G,H, n = 12/12). In summary, these findings indicate that the cEbf2 and cEbf3 genes positively respond to the exogenous BMP4 protein in a gradient manner.

BMP4 can rescue cEbf3 expression after lateral barrier insertion

As exogenous BMP4 protein upregulates cEbf2 and cEbf3 genes, we would predict that, in the absence of the lateral mesoderm, the BMP4-loaded beads would normalize the expression patterns of these genes. Beads loaded with 100 μg/mL BMP4 were inserted into the most anterior portion of the crPSM, spanning a prospective area of three somites, and then a lateral barrier was implanted (at a length of six somites). This separates the crPSM (and bead) from the lateral mesoderm. cEbf3 was induced in the somites that developed close to the beads (yellow arrowhead, Fig. 7I, n = 9/10). As expected, the somites that developed adjacent to the barrier but further away from the beads did not express cEbf3 (green arrowhead, Fig. 7I). Transverse sections through the bead and barrier region revealed normal sclerotomal expression of cEbf3 in the vicinity of the bead and medial to the barrier (yellow arrowhead, Fig. 7J). Therefore, the loss of cEbf3 expression, due to separation of crPSM from lateral mesoderm can be rescued by BMP4, that is, BMP4 compensated for the absence of the lateral plate mesoderm.

Unlike BMP4, ectopic expression of BMP7 downregulates cEbf2 and cEbf3 genes expression

cEbf2 and cEbf3 genes may be common downstream targets for all BMPs or specific targets for the lateral plate-derived BMP members (such as BMP4). To investigate this question, BMP7 (not endogenously expressed in LPM/IM) was applied to the crPSM on beads at a concentration of 100 μg/mL. Unlike BMP4, BMP7 beads caused complete downregulation of the two cEbf genes in the somites adjacent to the beads (magenta arrowheads, Fig. 7K,L, n = 14/15). This means that cEbf2 and cEbf3 genes are specifically regulated by lateral plate-derived Bmp signals especially Bmp4.

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References
  9. Supporting Information

Expression of cEbf2 and cEbf3 genes in the lateral halves of somites indicates a possible role for lateral tissues in regulation of these genes. Separation of somitic mesoderm from lateral tissues by lateral barrier leads to abolishment of the lateral somitic marker, Sim1 (Dietrich et al. 1997). Similar to Sim-1, the same operation resulted in complete downregulation of cEbf2 and cEbf3 expression. Taken together, induction and maintenance of cEbf2 and cEbf3 are mainly dependant on lateral tissues.

Previous studies have shown that the activation of lateral somitic programs depends on members of the Bmp signaling family, especially Bmp4, released by the lateral plate mesoderm (Tonegawa et al. 1997; McMahon et al. 1998; Dockter 2000; Christ et al. 2004). In consistence, our results from ectopic gene expression experiments indicate that lateral plate-derived Bmp4 signals control induction and maintenance of cEbf2 and cEbf3 genes expression in somites. Our results also showed that expression of cEbf2 and cEbf3 genes proportional to the concentration of BMP4. BMP4 is not only able to upregulate cEbf2 and cEbf3 but also can rescue their expression after separation of lateral plate mesoderm from the somitic mesoderm. The roof plate of the neural tube and the overlying ectoderm are two further sources of Bmp4 signals, referred to here as dorsal Bmp4 (Monsoro-Burq & Le Douarin 2000; Monsoro-Burq 2005). This dorsal Bmp4 is unlikely to have a regulatory effect on cEbf2 and cEbf3 expression for the following reasons: (i) ectodermal and/or neural tube removal does not change cEbf2 and cEbf3 expression (Appendix S2); and (ii) dorsal Bmp4 signals only affect the most dorsal sclerotomal cells that are positioned between the ectoderm and the dorsal neural tube and may have no effect on the remaining sclerotomal cells (Sela-Donenfeld & Kalcheim 2002). Therefore, cEbf2 and cEbf3 genes, which are expressed laterally in sclerotome, are mainly regulated by Bmp4 from the lateral mesoderm. In support of this notion, other non lateral plate-derived Bmps, such as, Bmp7 which is expressed in dorsal neural tube and dorsal dermomyotomal lip, is unable to regulate cEbf2 and cEbf3 genes expression.

It is likely that another molecule from the notochord is required to antagonize BMP4 and so inhibits expression of cEbf3 medially. A good candidate gene with these criteria is Noggin, since it is a medial signal secreted from the notochord (McMahon et al. 1998) and acts either synergistically with Shh to activate medial somitic markers, such as Pax1 (Dockter 2000; Dockter & Ordahl 2000) or alone to inhibit the lateralization effect of lateral mesoderm signals, especially BMP4 (Tonegawa et al. 1997; Capdevila et al. 1998; Tonegawa & Takahashi 1998). In agreement, Noggin overexpression in the lateral pre-somitic mesoderm results in complete loss of cEbf2 and cEbf3. In general, although inhibition of BMPs by Noggin injection induces sclerotomal cell formation, these cells failed to express cEbf2 and cEbf3 genes. This suggests that Bmp signals are crucial for both induction of these genes expression and maintenance of the identity of cells expressing these genes.

cEbf2 and cEbf3 expression profile, detected by in situ hybridization, strongly suggests their functional involvement in sclerotomal differentiation and in some aspects of vertebral morphogenesis. During the early stage of the development prior to somites formation, cEbf2 and cEbf3 genes assume a lateral pattern around the primitive streak and Hensen's node. After somitogenesis, the two genes continue to lateral in the ventral somitic tissue (the sclerotomal precursor) and the adjacent somitocoele of the immature somites. After epithelial mesenchymal transition (EMT), the two chick cEbf genes are expressed in the lateral sclerotomal portion of the mature somites. This means that the lateral sclerotomal portions can be identified early, before EMT, by expression of cEbf2 and cEbf3. In agreement, lateral somitic expression has also been seen in mouse Ebf2,3 and xenopus xEbf2, 3 (Dubois et al. 1998; Kieslinger et al. 2005). Later on, coincident with the appearance of the neural structures in the anterior half of sclerotome, new cEbf2 and cEbf3 expression was detected in the DRG, around the axon of the spinal nerve, whereas, the earlier lateral sclerotomal expression becomes confined to sclerotomal area around the proximal rib and the lamina of the neural arch except at the spinous process. Therefore, the sclerotomal expression of cEbf2 and cEbf3 genes can be divided into skeletogenic (at the periphery of vertebrae and proximal rib) expression and neurogenic (in DRG and around spinal nerves). The skeletogenic expression started earlier in the skeletogenic sclerotomal precursor cells and was maintained in the perichondrium of the bone anlagen of the vertebral arch and the proximal rib. However, the neurogenic expression started later and after the formation of the DRG and the spinal nerves, that is, it was expressed in the specified neuronal cells, but not in their progenitors. Similarly, previous studies have denoted late expression of different members of Ebf genes in the DRG and around the spinal nerves (Garel et al. 1997; Bally-Cuif et al. 1998; Garcia-Dominguez et al. 2003).

Previous studies have indicated that medio-lateral (ML) rotation of epithelial somites leads to normal somite development (Christ & Wilting 1992; Ordahl & Le Douarin 1992). This suggests that the newly formed somites are not yet determined along the ML axis, and that determination of medial and lateral somitic compartments occurs after somite formation in response to extrinsic cues. Although the medial and lateral portions of the somite are morphologically continuous structures, substantial progress has been made in identifying the regulatory cascades that control ML patterning of this tissue. The role of axial structures in the medial patterning of the somite is mainly mediated by Noggin and Shh signals that regulate expression of medial somitic markers, such as Pax1 (Hirsinger et al. 1997; Tonegawa et al. 1997). On the other hand, Bmp4 from the lateral mesoderm promotes lateralization of the somites via induction of lateral markers, such as Sim1 (Pourquie et al. 1996). However, to date, there is no definitive work studying the ML molecular identity of the sclerotome that distinguishes between precursors of vertebral body, pedicle, neural arch and proximal rib. Pioneer studies suggested that the amniote sclerotome is horizontally subdivided into medial and lateral domains, owing to the regionalized expression of medial markers such as Pax1 (Johnson et al. 1994), Nkx3.1 (Kos et al. 1998) and the lateral marker Sim1 (Pourquie et al. 1996; Cheng et al. 2004). However, these studies disagree on the precise sites of Sim1 expression: one study shows Sim1 as strictly a lateral dermomyotomal (hypaxial) marker (Cheng et al. 2004) while another refers to Sim1 as a marker for the lateral somite (dermomyotome and sclerotome) (Pourquie et al. 1996). This conflicting interpretation may be due to changes in Sim1 expression over time. The lateral sclerotomal expression of Sim1 was only detected in the HH13-14 chick embryo but was absent in successive developmental stages. In contrast, Sim1 remains in the lateral dermomyotome until later stages. The current outstanding questions are: how the medial and lateral sclerotomal precursor cells are segregated and how distinct medial and lateral skeletal components of the vertebral column may form.

We have found that the expression domains of cEbf2 and cEbf3 molecularly define the lateral portion of the sclerotome and later around the cartilaginous anlagen of the vertebral arch, hence they may form a true lateral compartment, foreshadowing the lateral subdivision of axial skeletal components. Unlike Sim1, cEbf3 may act as a specific marker for the lateral sclerotomal domain. In support of this notion, cEbf3 expression is initiated in the lateral domain of the crPSM and then continues in the ventrolateral portion of SI-III. After somite maturation, cEbf3 expression becomes confined to the lateral sclerotomal domain. Unlike Sim1, cEbf3 expression remains in the lateral sclerotome until later stages and is never shifted to the lateral dermomyotome. The lateral sclerotomal domain has been shown to be induced by signals from the lateral mesoderm (Bmp4 and Bmp2) and inhibited by signals from the notochord-floor plate complex (Noggin) (Pourquie et al. 1995, 1996; Sela-Donenfeld & Kalcheim 2002). Indeed, cEbf3 expression in this domain is also induced by Bmp4 signals and repressed by Noggin. cEbf3 expression continues in the lateral domain until chondrogenesis where it prefigures the outline of the lateral vertebral components, the neural arches and proximal ribs. Thus cEbf3 is a unique marker of the lateral sclerotome.

cEbf2 is also expressed in the lateral sclerotome, but is not as specific as cEbf3. cEbf2 expression completely overlaps cEbf3 in the lateral sclerotomal portion and extends slightly to the central sclerotomal portion. This can explain the different response of the two genes to the medial ectopic Noggin and may indicate the necessity of the non-lateral plate-derived BMP to initiate and maintain this expression. In line with this, BMP required to initiate cEbf2 expression is not only from lateral tissues because implantation of Noggin between the neural tube (NT) and the PSM completely downregulates cEbf2. Non-lateral plate derived BMP may also be required along with the lateral plate-derived BMP to maintain cEbf2 expression in the somite as ectopic noggin insertion between the NT and the epithelial somites slightly downregulates this expression. Moreover, it is unlikely that the ectoderm or the NT is the source for this non-lateral plate-derived BMP since removal of the ectoderm or the NT does not affect cEbf2 expression.

Striking similarities exist between mammalian and avian Ebf2, 3 expression in the somites, where both chick (this study) and mouse Ebf genes (Mella et al. 2004; Kieslinger et al. 2005) are expressed in lateral sclerotomal domains. This therefore suggests a common evolutionary conserved role for these genes in patterning of the lateral somatic domain. In anamniotes, xenopus xEbf2,3 and zebrafish zEbf2,3 have similar lateral somitic expression as their amniote counterparts (Dubois et al. 1998). Moreover, the cephalochordate EBF in Amphioxus, AmphiCoe, is notably expressed in the mesoderm at the extremely lateral portion of the mature somites and in the adjacent lateral mesoderm (Mazet et al. 2004). This suggests that the vertebrate ancestors of EBF expressing cells originally resided in the lateral somitic/lateral mesoderm interface. This could also explain why cEbf2 and cEbf3 genes are controlled by BMP4 from the lateral mesoderm.

It is possible that cEbf2 and cEbf3 are merely markers for lateral sclerotome under the control of BMP4, or they are functionally important in vertebral arch and proximal rib formation toward skeletogenesis triggered by BMP4 signaling. In support of the second possibility, the cEbf2 and cEbf3 expression domain in the perichondrium of the bone anlagen of the vertebral arch and the proximal rib, surrounds the domain of both the chodrogenic markers Sox9, Nkx3.2 and the osteogenic marker Runx2 (inside the pre-chondrogenic condensation and the cartilaginous structures of the whole vertebra and the proximal rib) (Murtaugh et al. 1999, 2001; Zeng et al. 2002). Interestingly, the expression of these markers along with cEbf2 and cEbf3 are regulated by BMP signals. Furthermore, cEbf2 homologue in mouse, mEbf2, is expressed in the perichondrium and its inhibition led to loss of Runx2 and bone masses (Kieslinger et al. 2005, 2010). This means that cEbf2 and cEbf3 expression may precede Sox9, Nkx3.2 and Runx2 in BMP signaling cascade regulating skeletogenesis.

In summary, the organization of cEbf2 and cEbf3 expressing cells in the lateral sclerotomal domains under the control of Bmp4 derived from the lateral mesoderm, indicates that these genes may exhibit a unique functional role during somite development and axial skeletogenesis.

Acknowledgments

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References
  9. Supporting Information

This work was supported by grants from Ministry of Higher Education, Egypt (full funded PhD scholarship). I am grateful for the superb technicians for their help: Elaine Sherville (Royal Veterinary College, London University) and Simon Feist (School of Biological Sciences, University of Reading).

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References
  9. Supporting Information

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References
  9. Supporting Information
FilenameFormatSizeDescription
dgd12077-sup-0001-AppendixS1.pdfapplication/PDF63KAppendix S1. Effect of medial ectopic Noggin administration on cPax1 gene expression.
dgd12077-sup-0002-AppendixS2.pdfapplication/PDF186KAppendix S2. Effect of ectoderm removal and neural tube ablation on cEbf2 and cEbf3 genes expression.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.