SEARCH

SEARCH BY CITATION

Keywords:

  • chemotaxis;
  • Dictyostelium;
  • GSK3;
  • PI3K

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgment
  8. References
  9. Supporting Information

Glycogen Synthase Kinase 3 (GSK3) is a multifunctional kinase involved in diverse cellular activities such as metabolism, differentiation, and morphogenesis. Recent studies showed that GSK3 in Dictyostelium affects chemotaxis via TorC2 pathway and Daydreamer. Now we report that GSK3 affects PI3K membrane localization, of which the mechanism has remained to be fully understood in Dictyostelium. The membrane localization domain (LD) of Phosphatidylinositol-3-kinase 1 (PI3K1) is phosphorylated on serine residues in a GSK3 dependent mechanism and PI3K1-LD exhibited biased membrane localization in gsk3 cells compared to the wild type cells. Furthermore, multiple GSK3-phosphorylation consensus sites exist in PI3K1-LD, of which phosphomimetic substitutions restored cAMP induced transient membrane localization of PI3K1-LD in gsk3 cells. Serine to alanine substitution mutants of PI3K1-LD, in contrast, displayed constitutive membrane localization in wild type cells. Biochemical analysis revealed that GSK3 dependent serine phosphorylation of PI3K1-LD is constitutive during the course of cAMP stimulation. Together, these data suggest that GSK3 dependent serine phosphorylation is a prerequisite for chemoattractant cAMP induced PI3K membrane localization.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgment
  8. References
  9. Supporting Information

Understanding how eukaryotic cells manage their locomotive behaviors has been one of the major goals of current cell biology. Years of investigation uncovered that chemotaxis is synergistically controlled through multiple pathways that include PI3K, TORC2, soluble Guanylyl Cyclase (sGC), and PLA2 in Dictyostelium (Swaney et al. 2010; Kortholt et al. 2011). Recent studies using Dictyostelium cells demonstrated that GSK3 affects phosphatidylinositol-3,4,5-triphosphate (PIP3) metabolism, TORC2 signaling, and F-Actin remodeling via Daydreamer (Teo et al. 2010; Kolsch et al. 2013). It remains to be determined, however, how GSK3 affects these pathways at the molecular level. Furthermore, there exist contrasting phenotypes manifested by cells lacking GSK3: Teo et al. (2010)reported lack of increase in PIP3 level in response to cAMP, no TorC2 activation, and decreased Adenylyl Cyclase expression in gsk3 cells, whereas Kolsch et al. (2012) showed different results. The results reported here were obtained from gsk3 cells with JH10 background, which are largely consistent with those of Teo et al. (2010).

Dictyostelium GSK3 affected prestimulus control of PIP3 level through regulating PI3K membrane localization. Previous studies showed Dictyostelium PI3K is regulated at the following two levels: one is its localization control between the cytosol and the plasma membrane, and the other is regulating lipid kinase activity (Funamoto et al. 2002). Activation of PI3K is mediated through Ras, but the mechanism of PI3K membrane recruitment is not well understood. We noticed that the membrane localization domains of PI3K1 and PI3K2, the two main PI3Ks responsible for the majority of PIP3 generation in Dictyostelium cells (Huang et al. 2003), contain the consensus sequence for GSK3 phosphorylation (SxxxSxxxS, where ‘x’ indicates any amino acid) and that the PI3K1 membrane localization domain (LD) is phosphorylated on serine residues in wild type cells but significantly underphosphorylated in gsk3 cells. This serine phosphorylation of PI3K1-LD seems to be a requirement for optimal transient membrane localization of PI3K in response to cAMP stimulation. Biochemical as well as imaging analyses of the effects of GSK3 on the PI3K are described below.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgment
  8. References
  9. Supporting Information

Dictyostelium culture, chemotaxis and motility assays, and Fluorescence microscopy

Dictyostelium wild-type strain (JH10) and gsk3 cells were grown as described previously (Kim et al. 1999). Exponentially growing cells were differentiated with 50 nmol/L pulses of cAMP for 4 h and assayed for either random motility or challenged with a cAMP-filled capillary needle (Eppendorf Femtotip) at a density of 6 × 104 cells/cm2. Images were recorded using a CoolSNAP digital camera with OpenLab software. Chemotactic indices and speed of movements were computed as described before (Veeranki et al. 2008). All fluorescent images were obtained using a 100× oil lens on a Leica DM IRB inverted epifluorescence microscope equipped with a CoolSNAP digital camera and relative fluorescence profiles were obtained using Openlab image software.

GSK3 kinase assay

The GSK3 peptide kinase assay was performed as previously reported (Ryves et al. 1998; Kim et al. 2002). The primed peptide substrate sequences are as follows. GSM peptide –RRRPASVPPSPSLSRHSSPHQRR, P1 peptide – RRRMNSIESS7SNDS11NRR, P2 peptide – RRRNDSNCSS109GSSS113-PGRR, and P3 peptide – RRRGSSSGSS177SGGS181-PDRR. Control samples were assayed in the presence of 50 mmol/L LiCl, a GSK3 inhibitor, and specific activities were calculated by subtracting these values from the total counts. Specific activity is expressed as picomole of phosphate transferred/assay. Each experiment was repeated three times and error bars represent standard deviation.

Ras binding assay

Active Ras proteins were assayed as before (Veeranki et al. 2008). Whole cell lysates prepared after 4 h of cAMP pulsing were mixed with 5 μg of purified GST-Raf1-RBD or GST-Byr2-RBD on Glutathione-sepharose beads at 4°C for 2 h, and the pellets were washed three times with cell lysis buffer (20 mmol/L TrisCl [pH7.7], 150 mmol/L NaCl, 1% Triton X-100, 5% glycerol, 1 mmol/L EDTA, 0.1% beta-mercaptoethanol, and 1× Roche Protease Inhibitor mix). The active Ras proteins bound with GST-RBD were visualized by western blotting with the anti-Pan-Ras antibody.

Antibodies and λ-phosphatase

Anti-GFP antibodies were from Covance for western blot analysis. Anti-GST antibody was purchased from Santa Cruz Biotech and anti-Pan-Ras antibodies were from Calbiochem (Ab-3). Rabbit anti-phosphoserine antibody was purchased from Invitrogen (Catalog No. 61-8100). For each western, 1:250 dilution was made to achieve a final concentration of 1 mg/mL. λ-phosphatase was purchased from Biolabs, the reaction was conducted according to the provider's suggestions (30 min at 30°C in a total volume of 50 μL).

GST-PI3K1-LD expression vector construction

pEXP4(+)-PI3K1LD-GFP (Funamoto et al. 2002) was used as a template for generating GST-PI3K1-LD. The full length PI3K1LD cDNA (the intron within the PI3K1LD was removed by site-directed mutagenesis) is 1476 bp long and contains a ClaI site at +1457. pEXP4(+)-PI3K1LD was obtained by removing GFP with KpnI digestion. By using a primer set (5'-GAAGATCTATGTCCCCTATACTAGGTTATTGG-3’ and 5’-GAAGATCTGAATTCCGGGGATCCACG-3’), a cDNA encoding GST, a thrombin site, a BamHI, an EcoRI site was generated by polymerase chain reaction (PCR) from PGEX-4T-1 vector. The GST gene was inserted into the upstream of the region of PI3K1LD in pEXP4(+)-PI3K1LD. All constructs above were confirmed by sequencing.

Site-directed mutagenesis

Mutations were generated using the QuikChange Site Directed Mutagenesis Kit (Stratagene) and confirmed by sequencing, and expressed in pEXP4. The serine to alanine mutations were generated by PCR with mutants primers as indicated: PI3K1-LD (S7A, S11A) – primers SDM11F and SDM11R, PI3K1-LD (S109A, S113A) – primers SDM12F and SDM12R, PI3K1-LD (S177A, S181A) – primers SDM13F and SDM13R, PI3K1-LD (S370A, S374A) – primers SDM14F and SDM14R. The sextuple alanine to serine mutant (SAS-PI3K1-LD) was generated by PCR from PI3K1-LD (S7A, S11A, S177A, S181A) using mutant primers SDM12F and SDM12R. The Sextuple Phosphomimetic mutant (SPM-PI3K1-LD) was generated through the following steps: PI3K1-LD(S7E, S11E) was generated by using the mutant primers SDM21F and SDM21R, PI3K1-LD(S109E, S113E, S177E, S181E) was generated with SDM22F and SDM22R mutant primers using PI3K1-LD (S177E, S181E) as the template, and SPM-PI3K1-LD (S7E, S11E, S109E, S113E, S177E, S181E) was generated by substituting the SpeI-SpeI fragment of the PI3K1-LD (S109E, S113E, S177E, S181E), which contains the four mutations, into the PI3K1-LD (S7E, S11E). Primers used in the mutants generation are as follows:

  • SDM11F – gaatagtattgaaagtgcttctaatgatgccaatgagataaataaaaattcaaac,
  • SDM11R – gtttgaatttttatttatctcattggcatcattagaagcactttcaatactattc,
  • SDM12F – gatagtaattgtagtgctggtagtagtgctggaggacatgtaaataatgg,
  • SDM12R – ccattatttacatgtcctccagcactactaccagcactacaattactatc,
  • SDM13F – gtagcagtggtagtgccagtggtggtgctgatgaatctgcttcaaatc,
  • SDM13R – gatttgaagcagattcatcagcaccaccactggcactaccactgctac,
  • SDM14F – caccaaaatcaaataatactGctaaaaagacaGcatccgatacaacacc,
  • SDM14R – ggtgttgtatcggatgctgtctttttagcagtattatttgattttggtg,
  • SDM21F – gaatagtattgaaagtgaatctaatgatgaaaatgagataaataaaaattcaaac,
  • SDM21R – gtttgaatttttatttatctcattttcatcattagattcactttcaatactattc,
  • SDM22F – gatagtaattgtagtgaaggtagtagtgaaggaggacatgtaaataatgg,
  • SDM22R – ccattatttacatgtcctccttcactactaccttcactacaattactatc,
  • SDM23F – gtagcagtggtagtgaaagtggtggtgaagatgaatctgcttcaaatc, and
  • SDM23R – gatttgaagcagattcatcttcaccaccactttcactaccactgctac.

Subcellular fractionation of wild type and mutants GFP-PI3K1-LD proteins

Cell fractionation assay were performed as described previously with minor modifications (Han et al. 2006). Twenty five million aggregation competent cells were spun down and washed once with ice-cold PBS (137 mmol/L NaCl, 2.7 mmol/L KCl, 10 mmol/L Na2HPO4, 1.8 mmol/L KH2PO4) and the cell pellets were treated with 400 μL of 0.02% TritonX-100 and incubated 10 min at 4°C with agitation. All solutions contained protease inhibitors (Roche, Complete Mini). Mixtures were centrifuged at 12 000 g for 5 min at 4°C. The supernatants were then mixed with 4 × SDS protein loading dye and the pellet were mixed with 100 μL of 1 × SDS protein loading dye. Forty microliters of soluble (cytosolic) fractions and 1 μL of pellet (membranous) fractions were loaded onto sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) and analyzed by western blotting using anti-GFP antibody. Ras proteins were used as a marker enriched at the pellet fraction.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgment
  8. References
  9. Supporting Information

gsk3 cells display aberrant membrane localization of GFP-PHcrac and GFP-PI3K1-LD proteins

Vegetative wild type Dictyostelium cells expressing GFP-PH proteins as a PIP3 marker (generous gift from Dr. Devreotes Lab) display largely cytoplasmic localization of GFP-PHcrac (Parent et al. 1998; Kortholt et al. 2011). In contrast, vegetative gsk3 cells expressing GFP-PHcrac proteins displayed significantly elevated level of plasma membrane localization of GFP-PHcrac proteins compared to wild type cells (Fig. 1A). Similarly, wild type cells pulsed with cAMP for 4 h exhibited low basal level of GFP-PHcrac proteins at the plasma membrane. In contrast, cAMP pulsed gsk3 cells displayed relatively high basal level of GFP-PHcrac proteins at the plasma membrane (Fig. 1B, time 0). In response to cAMP stimulation, GFP-PHcrac proteins translocalized to the plasma membrane in a transient manner in wild type cells, but not in gsk3 cells (Fig. 1B, Movies S1 and S2). Our results using gsk3 cells with JH10 background are consistent with the results of Teo et al. (2010) using gsk3 cells of Ax2 background.

image

Figure 1. gsk3 cells display high basal membrane localization of GFP-PHcrac. (A) Vegetative gsk3 cells displayed undoubtedly visible GFP signals from the plasma membrane, whereas no such phenotype was observed from wild type cells. (B) The same cells were pulsed with cAMP for 4 h. gsk3 cells exhibited aberrantly high level of prestimulus membrane localization of GFP-PHcrac proteins that persisted during the course of cAMP, of which period wild type cells showed transient membrane recruitment of GFP-PHcrac proteins. Relative fluorescence profile showed transient increase in GFP-PHcrac signal in the membrane of wild type but not in gsk3 cells. Mean values from three independent experiments are shown with standard deviations. P-values are between wild type samples at time 0 and 5 or 10 s, Student's t-test.

Download figure to PowerPoint

One of the causes that gsk3 cells were unable to further recruit GFP-PHcrac proteins to the plasma membrane in response to chemoattractant could be that PI3K proteins are not properly regulated in gsk3 cells. PI3K1 and PI3K2, two of the major proteins responsible for cAMP induced PIP3 generation, are regulated at the level of lipid kinase activation by small G protein Ras as well as at the plasma membrane recruitment step through their membrane localization domain (PI3K-LD) (Huang et al. 2003). A previous study showed that constitutive localization of PI3K to the plasma membrane by myristoylation tagging led to higher prestimulus level of PIP3 (Huang et al. 2003), underscoring the importance of proper prestimulus membrane localization of PI3K.

Given that both elevated production of PIP3 through PI3K misregulation and sustained maintenance of PIP3 via downregulation of PTEN, a PIP3 phosphatse, could result in high basal PIP3 level, cAMP mediated regulation of both PI3K and PTEN were analyzed. Wild type cells expressing either GFP-PI3K1-LD or GFP-PTEN exhibited transient subcellular relocalization of each protein in response to cAMP as expected (Movies S3 and S4). gsk3 cells, however, displayed aberrantly high prestimulus level of GFP-PI3K1-LD at the plasma membrane at both vegetative and pulsed stages (Fig. 2A,C). No clear difference of prestimulus localization of GFP-PTEN was observed from wild type and gsk3 cells (Fig. 2A,D). gsk3 cells were unable to further mobilize PI3K1-LD to the plasma membrane in response to cAMP (Fig. 2C and Movie S5), yet displayed a transient membrane dislocalization of GFP-PTEN proteins upon cAMP stimulation similarly to wild type cells (Fig. 2D and Movie S6). The levels of GFP-PI3K1-LD proteins were comparable in both wild type and gsk3 cells (Fig. 2B). These data showed that aberrant prestimulus PI3K membrane localization was observed in gsk3 cells, which is insensitive to cAMP stimulation.

image

Figure 2. gsk3 cells displayed high basal membrane localization of PI3K1-LD-GFP. Cells were pretreated with 4 h of cAMP pulsing before the experiments. (A) Fluorescent images of GFP-PI3K1-LD and PTEN-GFP proteins at the plasma membranes of vegetative wild type and gsk3 cells. gsk3 cells displayed high basal PI3K1-LD at the plasma membrane, but no such aberrancies were observed from PTEN-GFP. (B) Western blot analysis using anti-GFP antibody displayed that the total amount of GFP-PI3K1-LD in wild type and gsk3 cells were comparable. (C) and (D). The same cells were pulsed with cAMP for 4 h and challenged with 10 μmol/L cAMP. Fluorescent images of GFP-PI3K1-LD and PTEN-GFP proteins and the relative fluorescence intensities in response to cAMP stimulation indicate that gsk3 cells were compromised in exhibiting cAMP mediated transient membrane recruitment of PI3K1-LD, but not PTEN. Mean values from three independent experiments are shown with standard deviations. P-values are between samples at time 0 and 10 s, Student's t-test.

Download figure to PowerPoint

To determine the possibility that whether an upstream activator of PI3K, Ras, is misregulated in gsk3 cells or not, the basal and cAMP induced Ras activities were measured using two different active Ras binding domains (RBD) from Raf1 and Byr2 proteins. Raf1-RBD preferentially binds to active RasB, RasD, and RasG and Byr2-RBD strongly to RasC but weakly to RasG (Kae et al. 2004; Sasaki et al. 2004). gsk3 cells displayed normal prestimulus Ras activities, but Ras activity persisted longer in gsk3 cells than in wild type cells when assayed by Raf1-RBD (Fig. 3A). In addition, cAMP induced Byr2-RBD binding Ras activities were exaggerated in gsk3 cells, but clearly responsive to cAMP stimulation. These data suggest that the lack of detectible change of cAMP induced PIP3 level in gsk3 cells when assayed using GFP-PHcrac protein as a PIP3 marker is not likely due to the misregulation of Ras activation. We prefer the view that the defect of cAMP-induced PIP3 level change in gsk3 cells are likely due to the limited level of PI(4,5)P2 subpopulation accessible to PI3K, which was previously proposed by Teo et al. (2010).

image

Figure 3. gsk3 cells displayed normal pre-stimulus Ras regulation, but aberrant post-stimulus regulation of a subset of Ras proteins. (A) Levels of active Ras proteins in wild type and gsk3 cells were analyzed by GST-RBD binding assay. Wild type cells displayed a transient activation of Ras bound with GST-Raf1-RBD protein. In contrast, gsk3 cells showed normal basal Ras activity but more prolonged activation of Ras proteins bound with GST-Raf1-RBD. (B) gsk3 cells displayed similar, but more exaggerated activation of Ras when tested with GST-Byr2-RBD, which preferentially binds with active RasC and RasG with lesser affinity. Mean values from three independent experiments are shown with standard deviations. P-values are between samples at time 0 and 5 s, Student's t-test.

Download figure to PowerPoint

GSK3 dependent serine phosphorylation of PI3K1-LD is critical for its cAMP induced membrane shuttling

Given that PI3K1-LD proteins are not properly regulated in cells lacking GSK3, GSK3 may phosphorylate PI3K1-LD and thus regulate its membrane localization. Furthermore, the membrane localization domains of PI3K1 and 2 contain multiple GSK3 phosphorylation consensus sequences (Fig. 4A). Systematic serine to aspartic acid as well as alanine sextuple substitution mutants of PI3K1-LD-GFP were generated and expressed in wild type and gsk3 cells and biochemically analyzed (Fig. 4B). Wild type PI3K1-LD-GFP proteins displayed contrasting subcellular localization in wild type and gsk3 cells; PI3K1-LD displayed approximately 50% enrichment in the pellet fraction of gsk3 cells compared to the wild type (Fig. 4B middle panel). Substitutions of potential GSK3 phosphorylation sites with aspartic acid (Sextuple Phosphomimetic Mutant [SPM]) restored cytosolic enrichment of PI3K in gsk3 cells, whereas serine to alanine mutant (Sextuple Alanine Substitution [SAS]) proteins were enriched in the pellet fraction of wild type cells. The total amount of PI3K1-LD proteins in Pellet and Supernatant fractions were comparable as shown in Figure 4B (lower panel) and the relative distributions of various PI3K1-LD proteins in each fraction were shown in Figure 4C.

image

Figure 4. PI3K1-LD contains potential GSK3 phosphorylation sites and of which mutations significantly affects its subcellular localization. (A) The top panel shows three potential GSK3 phosphorylation sites on PI3K1-LD: amino acids for the substitution mutations are marked bold with numbers. (B) GFP-PI3K1-LD or its mutants in soluble and pellet fractions were visualized by anti-GFP western blot analysis. Anti-Pan-Ras blot shows membrane enrichment of Ras proteins for each cell type. The sextuple phosphomimetic (SPM) PI3K1-LD mutant in both wild type cells and gsk3 cells mimicked wild type PI3K1-LD in wild type cells. (C) Mean values from three independent experiments are shown with standard deviations. P-values are between wild type PI3K1-LD and PI3K1-LD mutants, Student's t-test.

Download figure to PowerPoint

The same sets of PI3K1-LD-GFP proteins were then analyzed microscopically. The SPM-PI3K1-LD-GFP protein displayed transient membrane translocalization in response to cAMP stimulation in both wild type and gsk3 cells (Fig. 5 and Movies S7 and S8), suggesting that phosphorylation of these sites is a prerequisite for chemoattractant-induced regulation of PI3K1 subcellular localization. In other words, dephosphorylation of these sites would not be necessary for PI3K to relocalize back to the cytosol after the peak activation of PI3K. This point is further supported by biochemical analysis of PI3K1-LD phosphorylation described later (Fig. 6). In contrast to phosphomimetic mutant, the SAS-PI3K1-LD proteins in wild type cells displayed the high basal level of membrane localization, which was refractory to further activation by cAMP, resembling the situation of PI3K1 in gsk3 cells (Figs 5B and 2B, and Movie S9). Relative intensities of GFP signals from each experiment were shown in Figure 5C.

image

Figure 5. Effects of substitution mutations of PI3K1-LD assayed by fluorescent microscope. (A) GFP-SPM-PI3K1-LD displayed normal transient membrane translocation in response to cAMP stimulation in both wild type and gsk3 cells. (B) In contrast, GFP-SAS-PI3K1-LD constitutively localized to the plasma membrane of wild type cells. (C) Mean values of relative fluorescence from three independent experiments are shown with standard deviations.

Download figure to PowerPoint

image

Figure 6. PI3K1-LD is phosphorylated in a GSK3 dependent manner. (A) Top right panel: GST-PI3K1-LD proteins expressed in wild type cells displayed significantly higher level of serine phosphorylation than those from gsk3 cells when analyzed by western blot with anti-phospho-serine antibody. Anti-GST blot shows equal loading of the protein. Top left panel: GST-PI3K1-LD proteins purified from wild type and gsk3 cells showed little difference after λ-phosphatase treatment. Anti-GST blot shows equal loading of the protein. Mean values from three independent experiments are shown with standard deviations. P-values are between samples from wild type and gsk3 cells, Student's t-test. (B). Wild type cells expressing GST-PI3K1-LD were challenged with cAMP as indicated and analyzed by western blotting with anti-phospho-serine antibody after GST-pull down. Mean values from three independent experiments are shown with standard deviations. P-values are between samples from time 0 and after cAMP stimulation, Student's t-test. (C) GSK3 phosphorylates primed peptides encoding GSK3 consensus sequences from PI3K1-LD. The upper panel shows the sequences of the primed peptides used for the assay. The GSM peptide is a positive control and gsk3 cell lysate was a negative control for the assay. Mean values from three independent experiments are shown with standard deviations. P-values are between samples and the negative control, Student's t-test. All three peptides showed measurable amounts of phosphorylation above the background under the assay condition: among these, PI3K1LD-3 was most efficiently phosphorylated.

Download figure to PowerPoint

PI3K1-LD proteins are constitutively phosphorylated on serine residues in a GSK3 dependent manner

To further dissect the role of the phosphorylation of PI3K1-LD, we generated and expressed GST-PI3K1-LD in wild type and gsk3 cells. Western blot analysis using anti-phospho-serine specific antibody disclosed differential phosphorylation of PI3K1-LD proteins in wild type and gsk3 cells, which is sensitive to phosphatase treatment (Fig. 6A). We also noticed a slight, but consistent mobility difference between the GST-PI3K1-LD protein bands purified from wild type and gsk3 cells, which is sensitive to phosphatase treatment as well (Fig. 6A). As mentioned previously, the serine phosphorylation of PI3K1-LD protein is likely a prerequisite or permissive signal for chemoattractant-induced regulation of PI3K. Consistently, GST-PI3K1-LD proteins displayed no significant change in its serine phosphorylation level in response to cAMP stimulation (Fig. 6B). We also determined that synthetic and primed peptides encoding the three potential GSK3 phosphorylation sequences were phosphorylated by whole cell extract in a lithium sensitive manner (Fig. 6C). In contrast, only minimal level of lithium sensitive phosphorylation was observed from gsk3 cell lysates as expected. The simplest interpretation of these data is that GSK3 directly phosphorylates these sites upon priming by other kinases. Although, it is possible that GSK3 regulates PI3K phosphorylation indirectly through other kinase.

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgment
  8. References
  9. Supporting Information

Previous studies on the role of GSK3 in the context of cell motility regulation uncovered that GSK3 affects TorC2 (Teo et al. 2010) and Daydreamer (Kolsch et al. 2012) mediated signaling. This study details that GSK3 is essential for proper membrane targeting of PI3K. Misregulation of PI3K in gsk3 cells led to an aberrantly high level of prestimulus PIP3, which resembles the situation of cells lacking PTEN, and inefficient polarization in response to cAMP gradient. Furthermore, that gsk3 cells were refractory to cAMP mediated transient PIP3 production is likely due to a limited pool of PIP2 accessible for PI3K as suggested by Teo et al. (2010), given that a set of Ras can still be transiently activated in gsk3 cells by cAMP. Both GFP imaging experiments and biochemical fractionation supported the view that GSK3 affects serine phosphorylation of PI3K1 membrane localization domain, which is likely a permissive signal for chemoattractant-induced plasma membrane localization of PI3K. Considering that Sextuple Phosphomimetic PI3K1-LD mutant was able to display transient membrane localization in response to cAMP and the level of serine phosphorylation of GST-PI3K1-LD did not change during the course of cAMP stimulation, GSK3 dependent phosphorylation of PI3K1-LD is a prerequisite for proper chemotactic responses. It is thus likely that chemoattractant signals control PI3K localization by modulating PI3K binding targets either in the cytosol or on the plasma membrane as diagramed in Fig. 7.

image

Figure 7. A model for GSK3 mediated PI3K1 membrane localization. The serine phosphorylation of PI3K1-LD seems to be constitutive and GSK3 dependent, which then permits chemoattractant signals to regulate PI3K localization by modulating PI3K binding partners either in the cytosol or on the plasma membrane. Both cytosolic and membrane PI3K1-LD binding targets would be susceptible to chemoattractant signaling mediated modification. It is also possible that the chemoattractant signal may further modify PI3K1-LD in addition to the GSK3 dependent serine phosphorylation.

Download figure to PowerPoint

In addition to the aberrant PI3K membrane recruitment, it is clear that gsk3 cells suffer from other defects. As reported by Teo et al. (2010) TorC2 activation and PKB and PKBR activations were severely compromised. Consistently, alleviating PIP3 level by treating gsk3 cells with PI3K inhibitor LY294002 did not improve motility properties of gsk3 cells (data not shown). Another possibility is that gsk3 cells either underexpress or overexpress signaling component critical for motility regulation. One such target is SodC, which is significantly underexpressed in gsk3 cells (Strmecki et al. 2007). sodC cells display aberrant Ras activation with a concomitant increase in the prestimulus PIP3 level (Veeranki et al. 2008). Overexpression of SodC in gsk3 cells, however, failed to rescue any of the compromised motility parameters (data not shown). Wild type cells expressing SodC displayed modest inhibition of the speed of movement, indicating that a fine-tuning of the superoxide level by this enzyme is necessary for optimal motility behavior of cells. Finally, it would be worthy to mention that the proper regulation of Raf1-RBD binding Ras species, likely RasD, may constitute a critical part of executing cell fate decisions mediated by GSK3.

Acknowledgment

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgment
  8. References
  9. Supporting Information

This work was supported by Grant-In-Aid from American Heart Association (0555264B) and NIH SC1 (CA143958) from the National Cancer Institute.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgment
  8. References
  9. Supporting Information
  • Parent, C. A., Blacklock, B. J., Froehlich, W. M., Murphy, D. B. & Devreotes, P. N. 1998. G protein signaling events are activated at the leading edge of chemotactic cells. Cell 95, 8191.
  • Funamoto, S., Meili, R., Lee, S., Parry, L. & Firtel, R. A. 2002. Spatial and temporal regulation of 3-phosphoinositides by PI 3-kinase and PTEN mediates chemotaxis. Cell 109, 611623.
  • Han, J. W., Leeper, L., Rivero, F. & Chung, C. Y. 2006. Role of RacC for the regulation of WASP and phosphatidylinositol 3-kinase during chemotaxis of Dictyostelium. J. biol. chem. 281, 3522435234.
  • Huang, Y. E., Iijima, M., Parent, C. A., Funamoto, S., Firtel, R. A. & Devreotes, P. 2003. Receptor-mediated regulation of PI3Ks confines PI(3,4,5)P3 to the leading edge of chemotaxing cells. Mol. Biol. Cell 14, 19131922.
  • Kae, H., Lim, C. J., Spiegelman, G. B. & Weeks, G. 2004. Chemoattractant-induced Ras activation during Dictyostelium aggregation. EMBO Rep. 5, 602606.
  • Kim, L., Harwood, A. & Kimmel, A. R. 2002. Receptor-dependent and tyrosine phosphatase-mediated inhibition of GSK3 regulates cell fate choice. Dev. Cell 3, 523532.
  • Kim, L., Liu, J. & Kimmel, A. R. 1999. The novel tyrosine kinase ZAK1 activates GSK3 to direct cell fate specification. Cell 99, 399408.
  • Kolsch, V., Shen, Z., Lee, S., Plak, K., Lotfi, P., Chang, J., Charest, P. G., Romero, J. L., Jeon, T. J., Kortholt, A., Briggs, S. P. & Firtel, R. A. 2013. Daydreamer, a Ras effector and GSK-3 substrate, is important for directional sensing and cell motility. Mol. Biol. Cell 24, 100114.
  • Kortholt, A., Kataria, R., Keizer-Gunnink, I., Van Egmond, W. N., Khanna, A. & Van Haastert, P. J. 2011. Dictyostelium chemotaxis: essential Ras activation and accessory signalling pathways for amplification. EMBO Rep. 12, 12731279.
  • Ryves, W. J., Fryer, L., Dale, T. & Harwood, A. J. 1998. An assay for glycogen synthase kinase 3 (GSK-3) for use in crude cell extracts. Anal. Biochem. 264, 124127.
  • Sasaki, A. T., Chun, C., Takeda, K. & Firtel, R. A. 2004. Localized Ras signaling at the leading edge regulates PI3K, cell polarity, and directional cell movement. J. Cell Biol. 167, 505518.
  • Strmecki, L., Bloomfield, G., Araki, T., Dalton, E., Skelton, J., Schilde, C., Harwood, A., Williams, J. G., Ivens, A. & Pears, C. 2007. Proteomic and microarray analyses of the Dictyostelium Zak1-GSK-3 signaling pathway reveal a role in early development. Eukaryot. Cell 6, 245252.
  • Swaney, K. F., Huang, C. H. & Devreotes, P. N. 2010. Eukaryotic chemotaxis: a network of signaling pathways controls motility, directional sensing, and polarity. Annu Rev Biophys. 39, 265289.
  • Teo, R., Lewis, K. J., Forde, J. E., Ryves, W. J., Reddy, J. V., Rogers, B. J. & Harwood, A. J. 2010. Glycogen synthase kinase-3 is required for efficient Dictyostelium chemotaxis. Mol. Biol. Cell 21, 27882796.
  • Veeranki, S., Kim, B. & Kim, L. 2008. The GPI-anchored superoxide dismutase SodC is essential for regulating basal Ras activity and for chemotaxis of Dictyostelium discoideum. J. Cell Sci. 121, 30993108.

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgment
  8. References
  9. Supporting Information
FilenameFormatSizeDescription
dgd12078-sup-0001-MovieS1.movvideo/mov699KMovie S1. cAMP induced transient membrane localization of GFP-PHcrac proteins in wild type cells. In response to cAMP stimulation, cAMP pulsed wild type cells exhibited GFP-PHcrac protein translocation to the plasma membrane in a transient manner. Images were collected every 5 seconds for a minute.
dgd12078-sup-0002-MovieS2.movvideo/mov162KMovie S2. cAMP pulsed gsk3 cells displayed high basal level of GFP-PHcrac proteins at the plasma membrane, in which no further translocation was detected in response to cAMP stimulation. Images were collected every 5 seconds for a minute.
dgd12078-sup-0003-MovieS3.movvideo/mov4242KMovie S3. cAMP pulsed wild type cells exhibited transient GFP-PI3K1-LD protein translocation to the plasma membrane in response to cAMP stimulation. Images were collected every 10 seconds for a minute.
dgd12078-sup-0004-MovieS4.movvideo/mov154KMovie S4. cAMP pulsed wild type cells exhibited transient GFP-PTEN protein translocation to the plasma membrane in response to cAMP stimulation. Images were collected every 10 seconds for a minute.
dgd12078-sup-0005-MovieS5.movvideo/mov4645KMovie S5. cAMP pulsed gsk3 cells displayed high basal level of GFP-PI3K1-LD proteins at the plasma membrane, in which no further translocation was detected in response to cAMP stimulation. Images were collected every 10 seconds for a minute.
dgd12078-sup-0006-MovieS6.movvideo/mov807KMovie S6. cAMP pulsed gsk3 cells exhibited transient GFP-PTEN protein translocation to the plasma membrane in response to cAMP stimulation. Images were collected every 10 seconds for a minute.
dgd12078-sup-0007-MovieS7.movvideo/mov3504KMovie S7. cAMP pulsed wild type cells exhibited transient SPM-PI3K1-LD-GFP protein translocation to the plasma membrane in response to cAMP stimulation. Images were collected every 10 seconds for a minute.
dgd12078-sup-0008-MovieS8.movvideo/mov5610KMovie S8. cAMP pulsed gsk3 cells exhibited transient SPM-PI3K1-LD-GFP protein translocation to the plasma membrane in response to cAMP stimulation. Images were collected every 10 seconds for a minute.
dgd12078-sup-0009-MovieS9.movvideo/mov4738KMovie S9. cAMP pulsed wild type cells exhibited constitutive plasma membrane localization of SAS-PI3K1-LD-GFP protein irrespective of cAMP stimulation. Images were collected every 10 seconds for a minute.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.