SEARCH

SEARCH BY CITATION

Keywords:

  • cross-species amplification;
  • EST-SSRs;
  • next-generation sequencing;
  • Nilaparvata lugens;
  • Sogatella furcifera

Abstract

  1. Top of page
  2. Abstract
  3. Acknowledgments
  4. References

With the advent of next-generation Roche 454 pyrosequencing technologies, transcriptome level sequence collections are arising as prominent resources for the discovery of gene-based molecular markers. In a previous study more than 1450 simple sequence repeats (SSRs) in expressed sequence tag (EST) sequences resulting from 454 pyrosequencing of Laodelphax striatellus cDNA were identified. From these we developed PCR primers for 40 di- or tri-candidate SSRs (minimum repeats > 8) from the combined EST library. After extensive optimization, 13 pairs were end labeled with a fluorescent dye. Here, we also tested these 13 SSRs for cross-species amplification in two other planthoppers, Nilaparvata lugens and Sogatella furcifera. The marker transferability was considerably high in N. lugens (92.31%) and in S. furcifera (61.54%). All of the 13 fluorescent SSRs were polymorphic, with allele numbers ranging from two to seven for 24 male and 24 female L. striatellus individuals. Observed heterozygosities ranged from 0.016 to 0.621. Development of SSR markers from ESTs will be a valuable tool to improve our understanding of population structure in this important rice pest.

The small brown planthopper Laodelphax striatellus (Fallén) is widely distributed in the Palearctic and Oriental regions (Kisimoto 1989). In China, L. striatellus occurs heavily on rice, wheat and maize plants in Northern China and Yangtze River valley, where it is a vector of a number of plant viruses, including rice striped virus, black-streaked dwarf virus and maize rough dwarf virus (Zhang et al. 2001). These diseases cause more severe yield reduction than the feeding damage by the insect itself (Xiong et al. 2008). Laodelphax striatellus can locally overwinter as a diapause nymph on wheat or weeds in winter (Murakami & Suzuki 1971; Cheng 1996). Despite L. striatellus's pest status, few reports are available on the molecular phylogeography and population structure in this species. Microsatellite DNA is expected to provide a valuable tool for this purpose because of the power and ability of microsatellite markers for investigating population genetic differentiation. Sun et al. (2012) developed nine polymorphic microsatellites for L. striatellus using the enriched method. However, for fully understanding the population genetics of the studied species, large numbers of microsatellite loci are needed. Thus, screening for enough polymorphic microsatellite loci is necessary for providing genetic information in L. striatellus.

Traditional microsatellite marker isolation protocols are costly and labor-intensive, and often inefficient (Zane et al. 2002). Expressed sequence tags (ESTs) are an ideal starting point to develop simple sequence repeat (SSR) markers quickly. Now, next generation sequencing (NGS) technologies allow the sequencing of large EST collections in a fraction of the time with low price (Hudson 2008; Mardis 2008). As a result, EST resources are rapidly growing and becoming publicly available, and offer a rich source of information for the development of SSRs and other genetic markers (Lesser et al. 2012). EST-SSR markers are considered to have many advantages over genomic SSR markers; for example, they have a higher proportion of high-quality markers or a higher transferability among related species (Varshney et al. 2005; Molina-Luzón et al. 2012). On the other hand, EST-SSR offers other advantages compared with genomic SSRs, because they can be more rapidly developed using recently developed software (Meglécz et al. 2010). In this study, we developed 13 polymorphic microsatellite markers for L. striatellus from the assembled EST library (Zhang et al. 2010), which were provided (W Qian and X Chen, pers. com., 2012), Cross-amplifications were also tested in two other important rice pests, Nilaparvata lugens and Sogatella furcifera, which were collected in Xingan, Guangxi Zhuang autonomous zone, China.

Adults of live-caught L. striatellus were collected in rice field of Jining, Shandong province, China and N. lugens and S. furcifera were collected in a rice paddy from Xingan, Guangxi Zhuang autonomous zone, China. Samples were placed in absolute ethanol and stored at room temperature. Forty-eight L. striatellus samples (24 males and 24 females), 24 N. lugens samples and 24 S. furcifera samples were selected for DNA extraction. Total genomic DNA was extracted from each larva using a modified Chelex-100 Method (Ashok Kumar et al. 2009). As the planthopper is small and the DNA quantity is low, we first completed polymerase chain reaction (PCR) amplification for each individual using the universal Folmer primers LCO1490 and HCO2198 (Folmer et al. 1994) to amplify a 658-bp fragment of the COI gene. Then we visualized DNA by electrophoresis through a 1.5% agarose gel and checked the results of DNA extraction.

Sequences were screened for perfect and compound microsatellite repeats (di- to tetranucleotide motifs) using the perl scripts (MISA, P3_in, P3_out) that incorporate Primer 3 (http://fokker.wi.mit.edu/primer3/) software for PCR primer design. Parameters for sequence selection and primer design included the following restrictions: (i) the target microsatellite had at least eight repeats; (ii) the resulting PCR product was between 100 and 500 bp long; (iii) the annealing temperature of primers was between 50°C and 64°C and the difference in annealing temperature between the forward and the reverse primer was <4°C; and (iv) the self-complementarities of primers and the complementarities between primers matched the quality criteria used as default parameters in Primer 3. Finally, 40 primer pairs were selected to synthesize. Markers were initially tested for amplification success and specificity in eight L. striatellus individuals. PCR reactions were conducted in 10 μL total volume and contained 5–20 ng DNA, 200 μM dNTP, 2 pmol each of forward and reverse primer and 0.5 U Taq DNA polymerase (rTaq; TaKaRa, Dalian, China) and 1 μL PCR amplification buffer. All of the loci were amplified using the following “touchdown” after a 5 min denaturation at 95°C: 30 s at 95°C, 30 s at 58 to 53°C (dropping 0.5°C/cycle), 30 s at 72°C, 10 cycles; then 35 cycles of 30 s at 95°C, 30 s at 53°C, 30 s at 72°C, and one final cycle of 7 min at 72°C. Following visualization by electrophoresis through a 1.5% agarose gel, loci exhibiting reliable amplification of a single product of expected size were selected to synthesis directly labeled forward primers (HEX, FAM, TAMRA or ROX). Products were capillary electrophoresed using a genetic analyzer (3130xl; ABI, Foster City, CA, USA). Data were analyzed using GeneMapper v4.0 (Applied Biosystems, Foster City, CA, USA). All of the 13 primer pairs developed for L. striatellus (Table 1) were assessed for cross-amplification in two other planthoppers, N. lugens and S. furcifera. The mean number of alleles (MNA) per locus, and observed (HO) and expected heterozygosities (HE) were calculated using ARLEQUIN v3.5 (Excoffier et al. 2005). Tests for Hardy–Weinberg equilibrium (HWE) and linkage disequilibrium were done using GENEPOP v3.4 (Raymond & Rousset 1995). Significance values for multiple comparisons were adjusted using the sequential Bonferroni correction (Rice 1989).

Table 1. Characteristics of 13 microsatellite loci in 24 male and 24 female (italic) Laodelphax striatellus, including motif repeats, forward and reverse primer sequences, number of alleles (NA), observed heterozygosity (HO) and expected heterozygosity (HE)
LocusRepeat motifIDForward and reverse primer (5′-3′)Size range (bp)NAHOHE
SBP01(AT)8Contig484F: TTGCAGCAAACAATAACGCT210–22250.2920.509
  R: TTCTTTTGTGGTGGTTCTTTG214–24040.2250.488
SBP05(GTT)8Contig3703F: TGTTGCTGCTGTCATGTTCA182–18420.3360.387
  R: TGATGTCCAGTCTGCTTTGG182–18620.3140.358
SBP06(AAC)10Contig4555F:TGATGTCCAGTCTGCTTTGG229–23830.1810.494
  R: AGATGGCTGAGCAGCAGAGT226–23530.2030.467
SBP08(AC)9Contig5478F: TGTGAGTGAATTCGGGTGAA145–15550.4460.628
  R: GCACAGTGAAATTGCGTCAT147–15740.3800.511
SBP10(GA)11Contig5828F: CCCACAATAATGAGTGCAAGA116–12860.3940.557
  R: CGCCCTTGAGAAAGACTACG114–13670.4860.602
SBP12(AG)8Contig7044F: TGGTCAAAGGTTCGATTTCC256–26640.2790.745
  R: CGTTATATTGCCGCTCTCGT254–26440.3640.787
SBP14(CTG)8Contig7772F: AGCTCTTTCAGTTGTCGCGT117–13220.0160.124
  R: GACGGATTGTCACCGCTATT120–12920.0790.187
SBP15(GCT)8Contig7838F: GCGATAGCTAATGGCAAAGC121–12720.1410.206
  R: TAAGTCGATGACGAAATGCG127–13320.1370.222
SBP17(AGC)10Contig8187F: ACAGGCTGACCAGGTCTCAT224–23330.2930.387
  R: GGGGATTGGACGAATACTGA224–23940.3020.515
SBP25(GT)8Contig10940F: TTTTGTAAGGCGATTCTGGG104–12660.4900.714
  R: TGTCAGGAGCAGTCGAAATG102–13070.5460.892
SBP30(CT)8Contig12444F: GGTTGCATGGAAAGTGTGTG189–20760.4840.792
  R: CCCTATGACAACAAGTGTGAGC191–20560.4960.771
SBP34(GAG)8Contig13527F: ACCGAAGGAGCAGTAGCTGA135–14730.1120.303
  R: GAGTACCTGTTTCCGGGCTA138–15020.1080.297
SBP39(CA)9Contig16536F: TAACCTAACCTTGCTCCCGA177–20160.6210.887
  R: CTTTGGACTGATCGACGGAT175–20770.5890.792

Forty di- or trinucleotide candidate SSRs (minimum repeats > 8) from the combined L. striatellus EST library were designed. After extensive optimization, 13 loci exhibited reliable amplification of a single product of expected size in the tested L. striatellus individuals. Marker variations for the 13 microsatellites were assessed using 24 male and 24 female L. striatellus samples. All of these 13 pairs were found to be polymorphic (Table 1). The number of alleles per locus ranged from two to seven and expected heterozygosities ranged from 0.124 to 0.892 (Table 1). No significant linkage association was found among all these loci (P > 0.05). The size ranges and the number of alleles did not show differences between the male and female L. striatellus samples. Therefore, this set of EST-SSRs would be useful in studies of gene flow, genetic diversity and population structure in L. striatellus. All of these 13 microsatellite loci developed for L. striatellus were tested for cross-amplification in 24 N. lugens samples and 24 S. furcifera samples. The cross-amplification results showed that 12 and eight microsatellite loci worked in N. lugens and S. furcifera, respectively (Table 2). For N. lugens, eight of the 12 microsatellite loci were polymorphic, the number of alleles per locus ranged from two to three and the expected heterozygosities ranged from 0.186 to 0.361 (Table 2); for S. furcifera, four of eight microsatellite loci were polymorphic, the number of alleles per locus of the eight loci ranged from one to two and the expected heterozygosities ranged from 0 to 0.277 (Table 2). Although the polymorphic levels are not high for the tested samples, the marker transferability was considerably high in N. lugens (92.31%) and S. furcifera (61.54%). Two reasons may explain, to some extent, the high cross-species transferability of these 13 primer pairs. One explanation is that all of the 13 SSRs were developed in contigs; thus, the conserved nature of the priming sites may result in higher cross-species transferability levels. This is consistent with previous studies indicating high cross-species transferability of EST-based SSRs in N. lugens and other taxa (Jing et al. 2012). The second explanation is that because EST sequences are typically conserved relative to noncoding DNA, SSRs residing in EST sequences typically benefit from higher amplification rates and higher levels of cross-species transferability (Barbará et al. 2007; Ellis & Burke 2007).

Table 2. Cross-amplification of 13 microsatellite loci in Nilaparvata lugens and Sogatella furcifera
LocusNilaparvata lugensSogatella furcifera
Size range (bp)NAHOHESize range (bp)NAHOHE
  1. –, amplification failed (no, faint or multiple band).

SBP01210–21620.1040.186
SBP05171–17720.1550.211
SBP06216–21820.1370.209
SBP08125–12720.1510.237123–12920.1030.277
SBP1088–9830.2820.31590–9620.1150.219
SBP12262–27030.2770.306212100
SBP14123100117100
SBP15124100121100
SBP17227100
SBP25105–12330.2520.361
SBP30171–17720.1470.255
SBP34108100141–14720.1250.137
SBP39181–18930.2640.352179100

In conclusion, our results report microsatellite markers that will provide a valuable resource for population genetic studies in L. striatellus. These markers developed for L. striatellus are also potentially useful for population genetic studies of two other planthopper species, N. lugens and S. furcifera.

Acknowledgments

  1. Top of page
  2. Abstract
  3. Acknowledgments
  4. References

The authors thank Wei Qian and Xiaoying Chen for providing the assembled combined EST libraries of Laodelphax striatellus. This project was supported by the 973 Projects Grant (2010CB951503) from the Ministry of Science and Technology of China and National Genetically Modified Organisms Breeding Major Projects (2011ZX08012-004).

References

  1. Top of page
  2. Abstract
  3. Acknowledgments
  4. References