SEARCH

SEARCH BY CITATION

Keywords:

  • aneuploidy;
  • gene regulation;
  • knockout;
  • Nrf1;
  • oxidative stress response

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Primer sequences
  8. Acknowledgements
  9. References

Nuclear factor erythroid-derived 2-related factor 1 (Nrf1) regulates cellular stress response genes, and has also been suggested to play a role in other cellular processes. We previously demonstrated that hepatocyte-specific deletion of Nrf1 in mice resulted in spontaneous apoptosis, inflammation, and development of liver tumors. Here, we showed that both fibroblasts derived from Nrf1 null mouse embryos and fibroblasts expressing a conditional Nrf1 allele showed increased micronuclei and formation of abnormal nuclei. Lentiviral shRNA-mediated knockdown of Nrf1 in SAOS–2 cells also resulted in increased micronuclei, abnormal mitosis and multi-nucleated cells. Metaphase analyses showed increased aneuploidy in Nrf1−/− embryonic fibroblasts. Nuclear defects in Nrf1-deficient cells were associated with decreased expression of various genes encoding kinetochore and mitotic checkpoint proteins. Our findings suggest that Nrf1 may play a role in maintaining genomic integrity, and that Nrf1 dysregulation may induce tumorigenesis.


Abbreviations
4OHT

tamoxifen

ARE

antioxidant response element

BUB

Budding Uninhibited by Benzimidazoles

CENP

Centromere Associated Protein

DAPI

4′-6-diamidino-2-phenylindole

MAD2

Mitotic Arrest Deficient

MEF

mouse embryonic fibroblast

NDC80/HEC1

Highly Activated in Cancer 1

Nrf1

nuclear factor erythroid-derived 2-related factor 1

NUF2

NDC80 Kinetochore Complex Component Homolog

SAC

spindle assembly checkpoint

SGOL1

Shugoshin-like 1

Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Primer sequences
  8. Acknowledgements
  9. References

Accurate chromosome segregation during mitosis is essential to maintain euploidy in eukaryotic cells. Errors in this process result in losses and gains of chromosomal material known as aneuploidy, which is associated with developmental abnormalities and syndromic conditions, and is also a hallmark of cancer [1, 2]. Aneuploidy has been suggested to play a role in tumorigenesis by causing multiple genetic changes necessary for the onset and progression of cancer [3]. Faithful transmission of chromosomes relies upon correct assembly and function of the kinetochore, which mediates attachment between chromosomes and spindle microtubules for proper chromosome segregation during mitosis [4]. The kinetochore comprises many different proteins including centromere associated proteins (CENPs), NDC80/HEC1, NUF2, SGOL1, among others [5, 6]. To guard against aneuploidy, accurate chromosomal segregation during mitosis in eukaryotes is maintained by the spindle assembly checkpoint (SAC). The SAC prevents chromosome instability by delaying the onset of anaphase from metaphase until all of the chromosomes are properly aligned and attached to the mitotic spindle. The kinetochore recruits SAC proteins such as BUB1, BUB3, MAD2, and Aurora-A and -B that monitor kinetochore microtubule attachment prior to anaphase. Altered expression or mutations of various components of the kinetochore and the SAC has been linked to tumorigenesis [7-9].

Transcription of many detoxification genes and antioxidants is regulated through cis-acting sequences known as antioxidant response elements (AREs) [10]. These elements have been identified in regulatory regions of genes involved in the oxidative stress response and xenobiotic metabolism. For example, AREs regulate expression of the catalytic and regulatory subunits of glutamylcysteine ligase involved in glutathione biosynthesis. AREs also regulate heme oxygenase, glutathione reductases, thioredoxin reductases and ferritins, and phase 2 enzyme genes including quinone reductases and glutathione S–transferases. Phase 2 proteins catalyze the conversion of mutagenic metabolites or their precursors to less reactive and more readily excretable compounds.

Several members of the cap n collar basic-leucine zipper (CNC-bZIP) family have been shown to regulate ARE function [11]. The CNC family consists of four closely related members that include p45NFE2 (nuclear factor erythroid-derived 2) and the nuclear factor erythroid-derived 2-related factors Nrf1, Nrf2 and Nrf3, characterized by a highly conserved 43 amino acid sequence located on the N–terminal side of the basic DNA-binding domain. Numerous studies have indicated a pivotal role for Nrf2 in protection against xenobiotics and electrophiles [10]. In contrast to Nrf2, less is known regarding the function of Nrf1. In vitro and in vivo studies indicate that Nrf1 modulates gene expression through AREs, and preferentially activates a subset of oxidative stress response genes [12]. Recent studies suggest that Nrf1 is critical for both basal and inducible expression of genes encoding proteasomal subunits [13, 14]. In addition to the stress response, Nrf1 has been shown to regulate genes involved in development and other cellular processes. In cell development, Nrf1 has been found to activate expression of Osterix, a zinc finger transcription factor that regulates osteoblast differentiation during bone formation [15]. Nrf1 has also been reported to repress the expression of the dentin sialophosphoprotein gene in terminally differentiated odontoblasts [16].

Previously, we have generated hepatocyte-specific Nrf1 knockout mice (Nrf1LKO), and shown that these animals developed steatohepatitis and showed 100% liver tumor incidence by 12 months [17]. Although it has been suggested that hepatic neoplasia is dependent on chronic liver inflammation in Nrf1LKO mice [17]. A direct role for Nrf1 in tumorigenesis has not been ruled out. It is possible that Nrf1 may accelerate disease progression by regulating yet to be identified pathways. In this study, we used wild-type and Nrf1-deficient cells to assess a possible role for Nrf1 in maintaining chromosomal stability. Loss of Nrf1 was found to induce micronuclei formation and aneuploidy. In addition, we found that expression of various genes encoding kinetochore proteins was reduced in Nrf1-deficient cells.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Primer sequences
  8. Acknowledgements
  9. References

Nrf1−/− cells exhibit increased numbers of abnormal nuclei

Hepatocyte-specific inactivation of Nrf1 leads to liver cancer with 100% penetrance and short tumor latency. Although inflammation has been suggested as a causative factor in neoplastic transformation of hepatocytes in Nrf1LKO mice, we speculate that loss of Nrf1 may contribute to tumorigenesis by promoting chromosome mis-segregation [17]. To investigate this possibility, we examined Nrf1−/− mouse embryonic fibroblast (MEF) cells for formation of micronuclei, which are representative of abnormal chromosome segregation during mitosis. As shown in Fig. 1A, multi-nuclei and micronuclei were readily observed in Nrf1−/− cells, but were markedly absent in wild-type cells. Micronuclei-containing cells were increased 10-fold in Nrf1−/− cells compared to wild-type cells. (Fig. 1B).

image

Figure 1. Nrf1-deficient cells exhibit abnormal nuclei. (A) Micrograph of 4′-6-diamidino-2-phenylindole (DAPI-stained wild-type and Nrf1−/− mouse embryonic fibroblasts. (C) Micrograph of DAPI)-stained DMSO- or 4OHT-treated Nrf1flox/flox;Cre-ERT2 fibroblasts. Note aberrant shaped nuclei and micronuclei (arrowheads) in Nrf1−/− cells and 4OHT-treated Nrf1flox/flox;Cre-ERT2 fibroblasts. (B,D) Histograms showing mean ± standard deviation for the percentage of micronuclei in control and Nrf1 knockout cells. Asterisks indicate statistically significant differences compared with wild-type (B) and DMSO-treated Nrf1flox/flox;CreERT2 cells. (D) (*< 0.05).

Download figure to PowerPoint

To examine the acute effects of Nrf1 ablation on genomic stability, we utilized MEF cells bearing an Nrf1 allele that may be disrupted by a tamoxifen (4OHT)-inducible Cre-LoxP recombination approach. MEF cells derived from Nrf1flox/flox;Cre-ERT2 mice have been described previously, and treatment of Nrf1flox/flox;Cre-ERT2 MEF cells with 4OHT leads to deletion of the Nrf1flox/flox conditional allele [13]. Quantitative RT–PCR analysis showed efficient inactivation of Nrf1 by 4OHT treatment of Nrf1flox/flox;Cre-ERT2 MEF cells. Nrf1 expression was reduced by 80% in 4OHT-treated cells compared to vehicle controls (Fig. 5B). In 4OHT treated Nrf1flox/flox;Cre-ERT2 MEF cells, increased numbers of abnormal nuclei and micronuclei were observed (Fig. 1C). The prevalence of micronuclei in 4OHT-treated Nrf1flox/flox;Cre-ERT2 MEF cells was threefold higher than in DMSO-treated Nrf1flox/flox;Cre-ERT2 MEF cells, but no difference was observed between DMSO- and 4OHT-treated control MEF cells (Fig. 1D).

Knockdown of Nrf1 leads to abnormal nuclear shape and micronuclei formation

To exclude potential non-specific effects associated with MEF cells, and to further support the hypothesis that reducing Nrf1 function affects chromosome segregation during mitosis, we performed shRNA-mediated knockdown of endogenous Nrf1 in SAOS–2 cells. Two shRNAs against Nrf1 were used for transduction. As shown in Fig. 2A, both constructs showed efficient knockdown of Nrf1 expression by western blot analysis. SAOS–2 cells with Nrf1 knockdown exhibited a threefold increase in the formation of micronuclei relative to the shScramble control (Fig. 2B,C). Knockdown of Nrf1 also resulted in an increased number of cells with abnormally large and deformed nuclei (Fig. 2B,C). To exclude the possibility of cell type specificity, Nrf1 shRNA-mediated knockdown was performed on HCT116 cells to confirm the inductive effects of Nrf1 depletion on the formation of micronuclei. The depletion of Nrf1 by shRNA-mediated knockdown was verified by western blot analysis (Fig. 2D). Similar to results obtained in SAOS–2 cells, formation of micronuclei was increased in both Nrf1 knockdown clones of HCT116 cells (Fig. 2E).

image

Figure 2. Knockdown of Nrf1 leads to abnormal nuclear shape and micronuclei formation. (A) Protein extracts of SAOS–2 cells transduced with scramble shRNA or Nrf1 shRNA were subjected to western blotting using the antibodies indicated. (B) Representative immunofluorescence analysis of SAOS–2 cells transduced with scramble control (shRNA-Scr) or Nrf1 shRNA (shRNA-Nrf1-1 and shRNA-Nrf1-2). Note multi-nuclei, donut-shaped and aberrantly shaped nuclei in Nrf1 knockdown cells. Arrowheads indicate micronuclei. (C) Histograms showing the mean ± standard deviation for the percentage of micronuclei in control and Nrf1 knockdown SAOS–2 cells. (D) Protein extracts of HCT116 cells transduced with scramble shRNA or Nrf1 shRNA were subjected to western blotting using the antibodies indicated. (E) Histograms showing the mean ± standard deviation for the percentage of abnormal and micronuclei in control and Nrf1 knockdown HCT116 cells.

Download figure to PowerPoint

Knockdown of Nrf1 in SAOS–2 cells leads to increased chromosome mis-segregation

Next we determined whether reduction in Nrf1 function leads to defective chromosome segregation during mitosis. Control and knockdown mitotic cells were stained for DNA, and the frequency of the aberrant mitotic phenotype was found to be twofold higher in Nrf1 knockdown cells compared to shScramble control cells (Fig. 3). These abnormalities included lagging chromosomes, anaphase bridges and mis-aligned chromosomes (Fig. 3). A similar spectrum of mitotic aberrations was also observed in knockout MEF cells (data not shown). These results suggest that loss of Nrf1 disrupts normal mitosis.

image

Figure 3. Knockdown of Nrf1 in SAOS–2 cells leads to abnormal chromosome segregation. (A) Micrographs of DAPI-stained SAOS–2 cells transduced with Nrf1 shRNA showing atypical anaphase figures (multipolar centrosomes, abnormal chromosome segregation and anaphase bridges). (B) Histogram showing the percentage of abnormal mitotic figures in control and Nrf1 knockdown cells.

Download figure to PowerPoint

Nrf1−/− MEF cells exhibit increased chromosomal instability

Micronuclei formation often leads to genomic instability, and is considered a hallmark of aneuploidy. We next examined whether Nrf1-deficient cells are prone to aneuploidy by comparing metaphase spreads of wild-type and Nrf1−/− MEF cells. At early passage (P3), wild-type MEF cells included cells with a diploid number of chromosomes (Fig. 4B). However, in contrast to wild-type MEF cells, low-passage Nrf1−/− cells exhibited an abnormal chromosome number (Fig. 4B). Metaphase spreads of two independent high-passage wild-type and Nrf1−/− MEF cell cultures were also analyzed. At later passages, the frequency of wild-type cells with an abnormal number of chromosomes was slightly increased (Fig. 4B,C). In contrast, Nrf1−/− MEF cells showed a significant increase in the frequency of aneuploidy (Fig. 4B,C). The aneuploidy observed in Nrf1−/− MEF cells is consistent with genetic instability.

image

Figure 4. Nrf1−/− cells exhibit increased chromosomal instability. (A) Representative Giemsa-stained metaphase spreads of wild-type MEF cells showing a normal (40) number of chromosomes, and of Nrf1−/− MEF cells showing aneuploidy. (B) Distribution of chromosome numbers of wild-type and Nrf1−/− MEF lines. Data shown are combined values from two independent MEF lines per genotype. (C) Analysis of the percentage of aneuploid cells in MEF cultures. Values are from three independent wild-type and Nrf1−/− MEF cultures, and 95 metaphases were counted for each MEF line.

Download figure to PowerPoint

Nrf1-deficient cells show abnormal expression of kinetochore and spindle assembly checkpoint genes

As Nrf1 is a transcription factor, we investigated whether loss of Nrf1 function affects the expression of genes involved in the maintenance of genomic stability. RNA was extracted from wild-type and Nrf1−/− MEF cells, and the expression levels of various genes encoding components of the kinetochore and the SAC were analyzed by quantitative RT–PCR. In Nrf1−/− MEF cells, expression of the kinetochore genes Ndc80, Nuf2 and Spc25 and the SAC gene Sgol1 was reduced approximately twofold compared to wild-type cells (Fig. 5A). However, expression of other kinetochore and SAC genes, such as Bub1, Bub3 and CENP genes, was not altered (Fig. 5A, and data not shown). In accordance with the RT–PCR results, western blotting revealed reduced NDC80 levels in Nrf1−/− MEF cells (Fig. 5C). SPC25 and NUF2 protein levels were not analyzed due to lack of suitable antibodies.

image

Figure 5. Nrf1-deficient cells show abnormal expression of kinetochore and spindle assembly checkpoint genes. Comparison of mRNA encoding kinetochore and spindle assembly checkpoint genes in (A) wild-type and Nrf1−/− MEF cells and (B) DMSO- and 4OHT-treated Nrf1flox/flox;Cre-ERT2 fibroblasts by real-time RT–PCR analysis. The expression levels of genes were quantifited relative to endogenous β–tubulin5 (Tub5) levels as an internal reference, and calculated as inline image. The fold change in expression was determined from the difference between the mean expression levels relative to control. Mean values ± SD for each genotype are shown. Statistically significant differences between wild type and Nrf1−/− cells, and between DMSO- and 4OHT-treated Nrf1flox/flox;Cre-ERT2 cells are indicated by asterisks. (C) Whole-cell lysates of two independent cultures of wild-type and Nrf1−/− MEF cells were immunoblotted using antibody against NDC80, using β–actin as a loading control.

Download figure to PowerPoint

To determine whether the cause of variance in gene expression observed in Nrf1−/− MEF cells is a direct result of Nrf1 deficiency, quantitative RT–PCR analysis was performed on Nrf1flox/flox;Cre-ERT2 MEF cells. Inducible inactivation of Nrf1 by 4OHT was verified by quantitative RT–PCR (Fig. 5B). Transcripts of Ndc80, Nuf2, Spc25 and Sgol1 were similarly reduced in Nrf1flox/flox;Cre-ERT2 MEF cells after 4OHT treatment (Fig. 5B). These data suggest that down-regulation of Ndc80, Nuf2, Spc25 and Sgol1 is specific to loss of Nrf1 function.

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Primer sequences
  8. Acknowledgements
  9. References

The function of Nrf1 has been defined in terms of its role in regulating the transcription of genes involved in cellular stress responses. However, there is evidence to suggest a role for Nrf1 in other cellular functions such as development and inflammation. In the present study, we examined the effects of Nrf1 deficiency on genomic stability in cultured cells. We demonstrate here that loss of Nrf1 function using either primary Nrf1−/− MEF cells or MEF cells rendered acutely Nrf1-deficient by a tamoxifen-inducible conditional system led to increased formation of micronuclei, abnormal nuclei and multi-nucleated cells. Moreover, shRNA-mediated knockdown of Nrf1 produced a similar result in SAOS–2 and HCT116 cells, indicating that the defects are specific to Nrf1 deficiency. The influence Nrf1 has on genomic integrity was further highlighted by the fact that all three Nrf1-deficient fibroblast cell lines exhibited an increased incidence of aneuploidy with each passage of cells. It is known that altered expression of genes encoding components of the kinetochore and the SAC may trigger aneuploidy [7-9]. Our results demonstrate that expression of the kinetochore genes Ndc80, Nuf2 and Spc25 and the SAC gene Sgo1 are down-regulated in Nrf1−/− MEF cells.

The Nrf1-associated mechanisms that underlie the maintenance of genome integrity are largely unknown, but they may play an integral role in prevention of abnormal kinetochore formation or the reduction of SAC function. In eukaryotic cells, faithful chromosome segregation during mitosis is crucial for maintaining genomic integrity. This function is mediated by the kinetochore, which resides at the centromere and binds to spindle microtubules for chromosome segregation. It has been shown that altered expression of genes encoding components of the kinetochore apparatus may lead to chromosome segregration defects and consequent aneuploidy [7-9]. The NDC80 complex is an important component of the kinetochore that mediates proper metaphase chromosome alignment and anaphase segregation. [18-20]. It consists of four proteins: NDC80/HEC1, NUF2, SPC24 and SPC25. Dysregulated expression of Ndc80 has been observed in a variety of human cancers [21, 22]. In addition, the NDC80 complex is required for SAC function through localization of kinetochore proteins CENP–A, MAD1, MAD2, BUB1, ZW10 and BUB3 to the kinetochore.

Segregation is also monitored by the SAC, a surveillance mechanism that is part of the kinetochore apparatus that blocks progression of mitosis unless all chromosomes are properly assembled to the spindle [6]. A key protein in SAC function is SGOL1, which protects sister chromatids from precocious separation. Failure of the spindle assembly checkpoint machinery to detect and signal for repair results in aneuploidy, which is frequently observed in many types of cancer cells [9]. Our results show a reduction in the level of Sgol1 transcripts in Nrf1−/− MEF cells, and decreased levels of Sgol1 expression led to chromosomal instability in colon cancer cells [23]. Therefore, our observation of increased micronuclei formation and aneuploidy in Nrf1-deficient cells may be the result of segregation defects caused by abnormal kinetochore formation or SAC function. Thus, it is likely that reduction in NDC80, NUF2, SPC24 and SGOL1 exerts a synergistic effect on genomic stability in Nrf1 knockout cells.

Currently, it is not known whether any of the genes identified by RT–PCR are direct targets of Nrf1. Sequence analyses revealed potential ARE sites located upstream of the transcription start sites of Ndc80, Nuf2 and Spc25 genes that may explain the decrease in expression of these transcripts in Nrf1 knockout cells. Moreover, it is interesting to note that transcription of the human Ndc80/Hec1 gene promoter is regulated by activating transcription factor 4 (ATF4) [24], and ATF4 has been implicated as a binding partner for Nrf1 [25]. The possibility that expression of these genes is Nrf1-dependent requires further experimentation.

Our results also provide a potential molecular link between Nrf1 and cancer. Previously, it was shown that Nrf1LKO mice spontaneously developed steatohepatitis and liver tumors [17]. However, the precise mechanism of tumorigenesis in Nrf1LKO livers remains uncertain. It is accepted that tumorigenesis is a multi-step process involving accumulation of mutations at various genetic loci, as well as acquisition of genomic instability [26]. The prevalence of cancer in Nrf1LKO mice may stem from sustained proliferation of hepatocytes in an inflammatory environment, combined with DNA damage caused by increased oxidative stress. Our current findings suggest that dysregulation of mitotic checkpoint genes may also contribute by abating genomic integrity in Nrf1-deficient cells. The existence of aneuploidy in cells may result in the loss of tumor suppressors or the gain of oncogenes, aiding initiation and progression of tumorigenesis in Nrf1LKO livers. Nonetheless, our observations have provided insight suggesting that further experimentation in Nrf1KO animals will be useful.

Finally, it is widely known that soy products have beneficial properties that help battle many diseases. Genistein, the most abundant isoflavone compound found in soy products, has been shown to have therapeutic effects on a multitude of diseases, including cancer [27]. Moreover, pre-treatment with genistein has been shown to protect against dimethylbenz[a]anthracene-induced micronuclei formation and chromosomal structural abnormalities in the bone marrow [28], while a recent study indicated the ability of genistein to activate Nrf1 [29]. Overall, the protective effects of genistein have been attributed to activation of the oxidative stress response and expression of antioxidant genes. However, these studies, together with our results, suggest the possibility that the beneficial health effects of genistein in prevention of cancer development arise from induction of Nrf1, which leads to the improvement of genetic stability. Further studies exploring the mechanism underlying Nrf1 activation by genistein would be of great interest.

In summary, this study shows that loss of Nrf1 function may cause genomic instability, and suggests that the role of Nrf1 in cellular homeostasis extends beyond the oxidative and proteolytic stress response to include maintenance of genomic integrity. Thus Nrf1 may have important implications for the understanding of how genome stability is promoted.

Experimental procedures

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Primer sequences
  8. Acknowledgements
  9. References

Reagents

Dulbecco's modified Eagle's medium, McCoy's 5a medium, Pen-Strep, and fetal bovine serum were purchased from Invitrogen (Carlsbad, CA, USA). The antibody for Nrf1 has been described previously [30]. Biotinylated anti-rabbit IgG was purchased from Vector Labs (Burlingame, CA). The chemiluminescent detection system was purchased from Piercenet (Rockford, IL, USA).

Cell lines

The HCT116 colon cancer cell lines were a generous gift from Bert Vogelstein (Johns Hopkins University Medical Institutions, Baltimore, MD, USA), and SAOS–2 cells were obtained from the American Type Culture Collection (Manassas, VA, USA). HCT116 cells were cultured in McCoy's 5a medium containing 10% fetal bovine serum, 1% non-essential amino acids, 1% HEPES and 1% Pen–Strep. SAOS–2 cells were cultured in 15% fetal bovine serum, 1% l–glutamine and 1% Pen–Strep. Nrf1−/− MEF cells were cultured in Dulbecco's modified Eagle's medium as described previously [13].

Lentivirus production and infection

MISSION shRNA lentiviral constructs for Nrf1 were purchased from Sigma (St Louis, MO, USA). Virus production was performed according to the manufacturer's protocol. Briefly, HEK293 cells were co-transfected with LKO.1 lentiviral, Delta VPR 8.9 and VSV–G plasmids using Lipofectamine 2000 (Invitrogen). Virus-containing supernatant was collected 48 h after transfection and filtered through a 0.45 um cellulose acetate filter (Millipore, Billerica, MA, USA). Infections of cells were performed in the presence of 10 μg·mL−1 polybrene and 10 mm HEPES. After transduction, puromycin was used to select for stable clones.

Western analysis

Protein lysates from cells were prepared using Nonidet P-40 lysis buffer, and subjected to SDS/PAGE. Proteins were subsequently transferred onto nitrocellulose membranes and blocked in 5% milk at room temperature for 1 h. Primary antibody incubation was performed overnight at 4 °C, followed by incubation with a horseradish peroxidase-conjugated secondary antibody. Proteins were detected by chemiluminescence.

Preparation and examination of metaphase spreads

Cells were harvested after treatment with 100 ng·mL−1 nocodazole and swollen in a hypotonic buffer (10 mm Tris/HCl pH 7.5, 10 mm NaCl, 5 mm MgCl2) for 15 min at 37 °C. Cells were fixed with freshly prepared Carnoy's solution (75% methanol, 25% acetic acid), and the fixative was changed several times. For spreading, cells were dropped on to slides. Slides were air-dried at room temperature and stained with 5% Giemsa at pH 6.8 for 7 min, washed briefly in deionized water, air-dried, and mounted using Permount (eBioscience, San Diego, CA, USA).

RNA isolation and quantitative RT–PCR

RNA was extracted using UltraSpec RNA (BiotecX, Houston, TX, USA). cDNAs were synthesized from 10 μg total RNA in 20 μL reactions containing 1 × RT buffer (25 mm Tris-HCl pH 8.3, 75 mm KCl, 3 mm MgCl2, 10 mm dithiothreitol), 1 mm dNTPs, 0.3 μg random hexamer, 40 units RNase inhibitor and 250 units of Moloney murine leukemia virus reverse transcriptase. Reverse transcription reactions were incubated at 72 °C for 5 min, then 25 °C for 10 min, followed by 42 °C for 60 min. Aliquots of cDNA were amplified in a Step One Plus PCR machine (Applied Biosystems, Foster City, CA, USA) using FastStart SYBR Green reagent (Roche, Indianapolis, IN, USA). Each cDNA amplification was performed in duplicate with a 20 μL reaction volume. PCR cycling conditions comprised 95 °C for 15 min and 45 cycles of 95 °C for 30 s, 60 °C for 30 s and 68 °C for 45 s. Expression levels were calculated relative to the endogenous control levels of β–tubulin5 (Tub5). Relative expression was quantified using the following formula inline image.

Statistical analysis

Data were expressed as means ± standard deviation. For statistical comparison, Student's t test was used. P values < 0.05 were considered statistically significant.

Primer sequences

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Primer sequences
  8. Acknowledgements
  9. References

Primer sequences are listed in Table 1.

Table 1. Primer sequences
GeneForward primer (5′[RIGHTWARDS ARROW]3′)Reverse primer (5′[RIGHTWARDS ARROW]3′)
mTubb5GATCGGTGCTAAGTTCTGGGAAGGGACATACTTGCCACCTGT
mSeh1LCACAAGGACCTCATCCACGATTCTCGCTCTTATCCCACACCT
mNdc80CTGAGTACACACAAACCGACATTGTCCGCTAGTCCTTTTCCCA
mNuf2TGCCGATGAACATAGAAGTCACACTGGTAAGAAGCCCTCCATTA
mSpc25GAGCTGACTGCTAAAATCCAGGCTCTTCCTAGCGTACTCTTCCTT
mSgol1CCTCCAGGGCCAACATCAAGGAAGGCTGTGATGGGCGAGAGG
mMad2l1GTGGCCGAGTTTTTCTCATTTGAGGTGAGTCCATATTTCTGCACT
mChek1GTTAAGCCACGAGAATGTAGTGAGATACTGGATATGGCCTTCCCT
mCenpLAACTCACGGATATTGAAGTGCATCACAGAGCCAGGATACTGCTT
mCenpQAGAGCCAATAAGGAAGCGGATAACATACGTTGCTTGTCCTGTTA
mCenpKTGAACTGACAACTAAGATCCGTGAAAAAGCACCCAAGGTAAGCA
mBub1GCTGCCAACCTGCCAGCTCTTTGATGGCTGCACTTTGCATGG
mBub3CACTGAAGCCCTCCGGACGATAGGGACAGCCAAACGGAACCA
mCenpAAGGGCGGACTCCCCTAAGCTGGCGAGTGGGCAGACCTCTGTG

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Primer sequences
  8. Acknowledgements
  9. References

We thank Jocelyn Lee for technical assistance. This research was supported by US National Institutes of Health grants CA091907 and NS065223. The content is solely the responsibility of the authors, and they have no conflicts of interest to disclose.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Primer sequences
  8. Acknowledgements
  9. References
  • 1
    Callier P, Faivre L, Cusin V, Marle N, Thauvin-Robinet C, Sandre D, Rousseau T, Sagot P, Lacombe E, Faber V et al. (2005) Microcephaly is not mandatory for the diagnosis of mosaic variegated aneuploidy syndrome. Am J Med Genet A 137, 204207.
  • 2
    Rajagopalan H & Lengauer C (2004) Aneuploidy and cancer. Nature 432, 338341.
  • 3
    Holland AJ & Cleveland DW (2009) Boveri revisited: chromosomal instability, aneuploidy and tumorigenesis. Nat Rev Mol Cell Biol 10, 478487.
  • 4
    Musacchio A (2011) Spindle assembly checkpoint: the third decade. Philos Trans R Soc Lond B Biol Sci 366, 35953604.
  • 5
    Cleveland DW, Mao Y & Sullivan KF (2003) Centromeres and kinetochores: from epigenetics to mitotic checkpoint signaling. Cell 112, 407421.
  • 6
    Musacchio A & Salmon ED (2007) The spindle-assembly checkpoint in space and time. Nat Rev Mol Cell Biol 8, 379393.
  • 7
    Cahill DP, Lengauer C, Yu J, Riggins GJ, Willson JK, Markowitz SD, Kinzler KW & Vogelstein B (1998) Mutations of mitotic checkpoint genes in human cancers. Nature 392, 300303.
  • 8
    Hernando E, Nahle Z, Juan G, Diaz-Rodriguez E, Alaminos M, Hemann M, Michel L, Mittal V, Gerald W, Benezra R et al. (2004) Rb inactivation promotes genomic instability by uncoupling cell cycle progression from mitotic control. Nature 430, 797802.
  • 9
    Weaver BA & Cleveland DW (2007) Aneuploidy: instigator and inhibitor of tumorigenesis. Cancer Res 67, 1010310105.
  • 10
    Nguyen T, Nioi P & Pickett CB (2009) The Nrf2-antioxidant response element signaling pathway and its activation by oxidative stress. J Biol Chem 284, 1329113295.
  • 11
    Motohashi H, O'Connor T, Katsuoka F, Engel JD & Yamamoto M (2002) Integration and diversity of the regulatory network composed of Maf and CNC families of transcription factors. Gene 294, 112.
  • 12
    Biswas M & Chan JY (2010) Role of Nrf1 in antioxidant response element-mediated gene expression and beyond. Toxicol Appl Pharmacol 244, 1620.
  • 13
    Lee CS, Lee C, Hu T, Nguyen JM, Zhang J, Martin MV, Vawter MP, Huang EJ & Chan JY (2011) Loss of nuclear factor E2-related factor 1 in the brain leads to dysregulation of proteasome gene expression and neurodegeneration. Proc Natl Acad Sci USA 108, 84088413.
  • 14
    Radhakrishnan SK, Lee CS, Young P, Beskow A, Chan JY & Deshaies RJ (2010) Transcription factor Nrf1 mediates the proteasome recovery pathway after proteasome inhibition in mammalian cells. Mol Cell 38, 1728.
  • 15
    Xing W, Singgih A, Kapoor A, Alarcon CM, Baylink DJ & Mohan S (2007) Nuclear factor-E2-related factor–1 mediates ascorbic acid induction of osterix expression via interaction with antioxidant-responsive element in bone cells. J Biol Chem 282, 2205222061.
  • 16
    Narayanan K, Ramachandran A, Peterson MC, Hao J, Kolsto AB, Friedman AD & George A (2004) The CCAAT enhancer-binding protein (C/EBP)β and Nrf1 interact to regulate dentin sialophosphoprotein (DSPP) gene expression during odontoblast differentiation. J Biol Chem 279, 4542345432.
  • 17
    Xu Z, Chen L, Leung L, Yen TS, Lee C & Chan JY (2005) Liver-specific inactivation of the Nrf1 gene in adult mouse leads to nonalcoholic steatohepatitis and hepatic neoplasia. Proc Natl Acad Sci USA 102, 41204125.
  • 18
    Wigge PA & Kilmartin JV (2001) The Ndc80p complex from Saccharomyces cerevisiae contains conserved centromere components and has a function in chromosome segregation. J Cell Biol 152, 349360.
  • 19
    Bharadwaj R, Qi W & Yu H (2004) Identification of two novel components of the human NDC80 kinetochore complex. J Biol Chem 279, 1307613085.
  • 20
    DeLuca JG, Dong Y, Hergert P, Strauss J, Hickey JM, Salmon ED & McEwen BF (2005) Hec1 and nuf2 are core components of the kinetochore outer plate essential for organizing microtubule attachment sites. Mol Biol Cell 16, 519531.
  • 21
    Bieche I, Vacher S, Lallemand F, Tozlu-Kara S, Bennani H, Beuzelin M, Driouch K, Rouleau E, Lerebours F, Ripoche H et al. (2011) Expression analysis of mitotic spindle checkpoint genes in breast carcinoma: role of NDC80/HEC1 in early breast tumorigenicity, and a two-gene signature for aneuploidy. Mol Cancer 10, 23.
  • 22
    Glinsky GV, Berezovska O & Glinskii AB (2005) Microarray analysis identifies a death-from-cancer signature predicting therapy failure in patients with multiple types of cancer. J Clin Invest 115, 15031521.
  • 23
    Iwaizumi M, Shinmura K, Mori H, Yamada H, Suzuki M, Kitayama Y, Igarashi H, Nakamura T, Suzuki H, Watanabe Y et al. (2009) Human Sgo1 downregulation leads to chromosomal instability in colorectal cancer. Gut 58, 249260.
  • 24
    Cheng L, Li L, Qiao X, Liu J & Yao X (2007) Functional characterization of the promoter of human kinetochore protein HEC1: novel link between regulation of the cell cycle protein and CREB family transcription factors. Biochim Biophys Acta 1769, 593602.
  • 25
    Masuoka HC & Townes TM (2002) Targeted disruption of the activating transcription factor 4 gene results in severe fetal anemia in mice. Blood 99, 736745.
  • 26
    Gordon DJ, Resio B & Pellman D (2012) Causes and consequences of aneuploidy in cancer. Nat Rev Genet 13, 189203.
  • 27
    Wiegand H, Wagner AE, Boesch-Saadatmandi C, Kruse HP, Kulling S & Rimbach G (2009) Effect of dietary genistein on Phase II and antioxidant enzymes in rat liver. Cancer Genomics Proteomics 6, 8592.
  • 28
    Pugalendhi P, Manoharan S, Panjamurthy K, Balakrishnan S & Nirmal MR (2009) Antigenotoxic effect of genistein against 7,12-dimethylbenz[a]anthracene induced genotoxicity in bone marrow cells of female Wistar rats. Pharmacol Rep 61, 296303.
  • 29
    Hernandez-Montes E, Pollard SE, Vauzour D, Jofre-Montseny L, Rota C, Rimbach G, Weinberg PD & Spencer JP (2006) Activation of glutathione peroxidase via Nrf1 mediates genistein's protection against oxidative endothelial cell injury. Biochem Biophys Res Commun 346, 851859.
  • 30
    Wang W, Kwok AM & Chan JY (2007) The p65 isoform of Nrf1 is a dominant negative inhibitor of ARE-mediated transcription. J Biol Chem 282, 2467024678.