SEARCH

SEARCH BY CITATION

Keywords:

  • anion exchanger 2;
  • EGR1;
  • gastric cancer;
  • gastrin;
  • intracellular pH

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. Conflict of interest
  9. References

The essential anion exchanger (AE) involved in bicarbonate secretion is AE2/SLC4A2, a membrane protein recognized to be relevant for the regulation of the intracellular pH in several cell types. Here we report that gastrin, a major gastrointestinal hormone, upregulates the expression of AE2 mRNA and protein in a cholecystokinin B receptor dependent manner in gastric cancer cells. The upregulated species of AE2 mRNA originates from the classical upstream promoter of the AE2 gene (here referred to as AE2a1) which provides the binding site for transcription factors early growth response 1 (EGR1) and SP1. EGR1 upregulated the AE2 expression that can be competitively inhibited by SP1 in co-transfection experiments. This competitive inhibition was avoided in cells because the SP1 expression was time-staggered to EGR1 in response to gastrin. Overexpression or knockdown of EGR1 consistently increased or decreased the expression of AE2. Our data linked a novel signal pathway involved in gastrin-stimulated AE2 expression.


Abbreviations
AE2,

anion exchanger 2

BCECF-AM,

2′,7′-bis-(2-carboxyethyl)-5-(and 6)-carboxyfluorescein acetoxymethyl ester

CCKBR,

cholecystokinin B receptor

EGR1,

early growth response 1

EMSA,

electrophoretic mobility shift assay

ERK,

extracellular signal-regulated kinase

GAPDH,

glyceraldehyde-3-phosphate dehydrogenase

GC,

gastric cancer

MAPK,

mitogen-activated protein kinase

pHi,

intracellular pH

siRNA,

small interfering RNA

SLC4A2,

solute carrier family 4, anion exchanger, member 2

Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. Conflict of interest
  9. References

The anion exchanger 2 (AE2) gene (also known as SLC4A2), a member of the Na+-independent, electroneutral Cl/HCO3 exchanger family, consists of 23 exons and 22 introns and encompasses about 17 kb [1]. The human AE2 gene encodes four transcript variants which express three N-terminal variant polypeptides including AE2a, AE2b1 and AE2b2 isoforms, as the transcript variants AE2a1 and AE2a2 encode the same AE2a isoform [2, 3]. Human AE2a is widely expressed in all tissues tested, particularly in gastric parietal cells, and AE2b1 and AE2b2 are restricted to liver and kidney [4, 5]. Intracellular acidification appears to be a major function of AE2, since its activity is more responsive to increased intracellular pH (pHi). In addition, AE2 regulates intracellular chloride concentration, bicarbonate metabolism and cell volume in a wide variety of cell types [6-8].

So far, no hereditary human diseases have been mapped to the AE2 gene, but targeted disruption of the AE2 gene in mouse leads to severe growth retardation, achlorhydria, osteopetrosis and impaired spermiogenesis [9-12]. Recent studies have demonstrated that AE2 plays a role in carcinogenesis. AE2 was increased in malignant hepatocellular carcinoma and inhibition of AE2 activity induced the apoptosis of the cells [13-15]. We previously reported that AE2 was upregulated and largely accumulated in cytoplasm in colon cancer cells. Induction of AE2 is involved in colonic carcinogenesis through activation of the extracellular signal-regulated kinase (ERK) pathway which can be blocked by AE2-targeted small interfering RNA (siRNA) or gastrin treatment [16]. In contrast, we found that AE2 was downregulated in gastric cancer (GC) cells, which correlated with the carcinogenesis and can be blocked by gastrin [17]. These results suggested a possibility that gastrin might suppress GC cells by causing an increase in the expression of AE2. In this paper we report that gastrin stimulates the expression of AE2 in GC cells via early growth response 1 (EGR1), in a cholecystokinin B receptor (CCKBR) dependent manner. Our data link a novel signal pathway involved in regulation of pHi and provide new insight for the treatment of GC.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. Conflict of interest
  9. References

Gastrin upregulates expression of AE2 protein in a CCKBR-dependent manner

To investigate the effect of gastrin on AE2 expression, human GC SGC7901 cells were treated with 10−7 m gastrin for different times. As shown in Fig. 1A, gastrin increased the expression of AE2 from 12 h onwards and the increase was sustained up to the 24 h tested in the experiment. The induction of AE2 was accompanied by intracellular acidification of the cells.

image

Figure 1. Gastrin-induced cellular acidification through upregulation of AE2 protein. (A) The pHi of SGC7901 cells decreased after incubation with gastrin for increasing time. Data are representative of experiments performed three times in triplicate, *< 0.05, compared with 0 h (upper panel). Time-dependent increase in AE2 polypeptide abundance in SGC7901 cells was measured by immunoblot (lower panel). (B) SGC7901 cells were treated with or without 10−7 m of gastrin in the presence of increasing concentrations of proglumide, and tested for AE2 polypeptide levels. (C) SGC7901 cells after treatment with gastrin for 24 h exhibited a lower pHi value and increased dpHi/dt. Cells were untreated (upper panel), treated with 10−7 m of gastrin in synchronization with Cl containing buffer (5 min) (middle panel) and incubated with 10−7 m of gastrin for 24 h (lower panel). Experiments shown are representative of three similar experiments. (pHi values > 8.0 shown in gray are approximations, as they lie beyond the range of BCECF pH calibration.)

Download figure to PowerPoint

In general, gastrin plays its role through the CCKBR pathway. To test whether the gastrin-induced AE2 upregulation is CCKBR dependent, SGC7901 cells were co-treated with 10−7 m gastrin and various concentrations of CCKBR antagonist proglumide for 24 h. As indicated in Fig. 1B, gastrin-induced expression of AE2 was progressively blocked by increasing concentrations of proglumide, suggesting that gastrin upregulates the expression of AE2 via the CCKBR pathway.

Gastrin enhanced the acidity of GC cells

AE2 is known to play a role in regulating pHi; we therefore measured the pHi of SGC7901 cells using the ion imaging technique. Cells were treated with (5 min or 24 h) or without 10−7 m gastrin. Resting pHi in SGC7901 cells was about 7.9, suggesting that the GC cells were alkalized which is consistent with our previous observation [18]. The resting pHi or anion transport activity was not changed after the cells were treated with gastrin for 5 min. However, on increasing the gastrin treatment to 24 h, the resting pHi of SGC7901 cells was decreased from 7.86 ± 0.30 to 7.22 ± 0.25, and dpHi/dt following Cl removal was increased from 0.09 ± 0.03 min−1 to 0.23 ± 0.06 min−1, consistent with increased AE2 activity (Fig. 1C). The results suggested that gastrin did not directly act on AE2 protein but elevated the expression of AE2 protein.

Transcript variant AE2a1 plays a major role in AE2 mRNA levels in response to gastrin

Although there are three isoforms of AE2 in human beings, only AE2a is expressed in stomach [19]. Real-time quantitative PCR on total RNA indicated that the expression of AE2 mRNA increased with 10−7 m gastrin treatment (Fig. 2A). As previously reviewed [3], two different transcript variants AE2a1 and AE2a2 may encode the same AE2 polypeptide (Fig. 2B). In order to clarify which AE2a transcript variant is upregulated in SGC7901 cells in response to gastrin, we designed two pairs of primers for the two transcript variants respectively (Fig. 2C). After SGC7901 cells were treated with 10−7 m gastrin for 12 h, the mRNA expression levels of the two transcript variants were analyzed by conventional PCR. We found that AE2a1 mRNA levels were significantly increased in response to gastrin, which was not observed for the AE2a2 variant (Fig. 2D). These results suggested that transcript variant AE2a1 played a critical role in gastrin-dependent upregulation of AE2 mRNA in SGC7901 cells.

image

Figure 2. Transcript variant AE2a1 plays a major role in AE2 mRNA levels in response to gastrin. (A) Time-dependent increase in AE2 mRNA in SGC7901 cells exposed to 10−7 m of gastrin was measured by real-time quantitative PCR. Values are means ± SD from three separate experiments, *< 0.05, compared with 0 h. (B) Schematic diagram of two different transcript variants AE2a1 and AE2a2. (C) Schematic diagram of two pairs of primers and the amplified fragment for the transcript variants AE2a1 and AE2a2. Gray and black boxes represent non-coding exons and coding exons respectively. ITS, initiation of transcription. ATG, initiation of translation. (D) The mRNA level of AE2a1 was significantly increased in SGC7901 after treatment with gastrin for 12 h, while there was no apparent change in the mRNA level of AE2a2 in response to gastrin. The size of each amplicon and the respective number of cycles are as follows: AE2a1, 346 bp and 30 cycles; AE2a2, 367 bp and 35 cycles; GAPDH, 226 bp and 25 cycles.

Download figure to PowerPoint

Gastrin-induced transcriptional regulation of AE2a

We have shown that gastrin affected the expression of AE2a at the mRNA level. Therefore, gastrin response elements in AE2 gene promoter were further investigated. Luciferase assays demonstrated that the promoter activity in the AE2 gene was located between nucleotides −1097 and −201 relative to the ATG translation start site (Fig. 3A) and a candidate gastrin response element lying between nucleotides −587 and −279 (Fig. 3B). Bioinformatics analysis demonstrated that several transcription factors including nuclear factor κB (NF-κB) p65, HSF, AP1, EGR2, SP1 and EGR1 may act on the region from nucleotides −587 to −279 (Fig. 3C). Expression vectors encoding these transcription factors were co-transfected with the AE2a-luc vector (−587) into SGC7901 cells. Luciferase assays showed that EGR1 strongly, and NF-κB p65 and SP1 slightly, increased AE2 promoter activity (Fig. 3D). Western blot showed that gastrin treatment upregulated the expressions of SP1 and EGR1 in an orderly fashion, but did not affect the expression of NF-κB p65 (Fig. 3E). These results suggested that EGR1 and SP1 may play a role in the upregulation of AE2a promoter in gastrin-stimulated cells.

image

Figure 3. Gastrin-induced transcriptional regulation of AE2a. (A), (B) The presence in the AE2a1 variant promoter of a basal response element was between nucleotides −1097 and −201 (A), and a candidate gastrin response element was between nucleotides −587 and −279 (B). Data are representative of experiments performed three times in triplicate, *< 0.05, compared with basic or control. (C) Map of transcription factor consensus binding sites related to sites that may be important for transcriptional activation of the AE2 gene by gastrin. ITS, initiation of transcription. ATG, initiation of translation. (D) EGR1 strongly and NF-κB p65 and SP1 slightly increased AE2 promoter activity. Data are representative of experiments performed three times in triplicate, *< 0.05, compared with control. (E) Western blot showed that the upregulated expressions of EGR1 and SP1 were not synchronized in response to gastrin, while the expression of NF-κB p65 did not change significantly under gastrin treatment.

Download figure to PowerPoint

EGR1 is responsible for the upregulation of AE2a promoter activity in cells treated with gastrin

As shown in Fig. 3C, there are three putative SP1 sites and one putative EGR1 site (including an overlapping sequence of EGR1 and SP1 binding site) between nucleotides −587 and −279. In order to further clarify the effects of EGR1 and SP1 on AE2a promoter activity, SGC7901 cells were co-transfected with EGR1 and SP1 expression constructs and the AE2a-luc vector (−587). Interestingly, co-transfection of EGR1 and SP1 nearly abolished the effect of EGR1 on AE2a promoter activity (Fig. 4A), suggesting that SP1 may compete with or otherwise affect EGR1 binding to AE2a promoter. The overlapping sequences of EGR1 and SP1 binding site (EGR1/SP1 element), which is highly conserved in mammals, may be the core region of AE2a promoter (Fig. 4B, lower panel). To test this, an AE2a-luc mutant vector (−587 Mut) was designed, in which the core binding motif of the putative EGR1 and SP1 binding site was mutated (Fig. 4B, upper panel). Luciferase assay revealed a significant decrease in the promoter activity of the AE2a-luc mutant vector (−587 Mut) compared with the wild-type AE2a-luc vector (−587) (Fig. 4C). This finding supported our previous view that the EGR1/SP1 element displays a dominant role in AE2 gene regulation. To further study the role of the overlapping EGR1/SP1 site in AE2a promoter, analysis of nuclear protein binding to the EGR1/SP1 element was performed in electrophoretic mobility shift assay (EMSA) experiments using nuclear extracts prepared from SGC7901 cells. EMSA analysis of SGC7901 nuclear proteins demonstrated that the bindings to the complete EGR1/SP1 element (EGR1/SP1 probe) were significantly enhanced in samples prepared from gastrin-treated cells (Fig. 4D, left panel). To extend this finding, different mutation probes were introduced to study the binding capacity of EGR1 and/or SP1 to the overlapping EGR1/SP1 site of the AE2a promoter (Fig. 4E). Interestingly, we found that mutation in the EGR1 binding region reduced EGR1/SP1 DNA binding capacity more than mutation in the SP1 binding region, and mutation of both sites abolished the probe binding (Fig. 4D, right panel). Taken together, the findings further suggested a role of EGR1 in the regulation of AE2 gene expression in SGC7901 cells with gastrin treatment.

image

Figure 4. EGR1 is responsible for the upregulation of AE2a promoter activity in cells treated with gastrin. (A) Co-transfection of EGR1 and SP1 strongly inhibited the effect of EGR1 on AE2a promoter activity. Data are representative of experiments performed three times in triplicate, *< 0.05, compared with empty vector transfection. (B) The schematic diagram shows the map of the putative EGR1/SP1 site in the AE2a promoter region. AE2a luciferase construct −587 contains a partial sequence of the wild-type EGR1/SP1 site, while construct −587 Mut has a mutation in the EGR1/SP1 site (indicated by underlined nucleotides above the wild-type motif sequence). ITS, initiation of transcription. ATG, initiation of translation. (C) Mutation of the core binding motif of the putative EGR1/SP1 site in AE2a-luc mutant vector (−587 Mut) abolished the AE2a promoter activity. Data are representative of experiments performed three times in triplicate, *< 0.05, compared with basic. (D) EMSA analysis of SGC7901 nuclear proteins showed that the bindings to the EGR1/SP1 probe were significantly enhanced in samples previously treated with gastrin for 5 or 10 min (left panel). Mutations in the EGR1 binding region of AE2a promoter impaired EGR1/SP1 DNA binding to a greater degree than mutations in the SP1 binding region, and mutations of both sites abolished probe binding (right panel). (E) Wild-type and mutant probe sequences are shown.

Download figure to PowerPoint

EGR1 contributes to the regulation of AE2 protein expression

To examine the effect of EGR1 on AE2 protein expression, EGR1 siRNA or EGR1 overexpression vector was transfected into SGC7901 cells for 48 h. Western blot showed that knockdown of EGR1 decreased and overexpression of EGR1 increased the protein abundance of AE2 (Fig. 5A,B), which is consistent with the role of EGR1 in regulation of AE2a mRNA. These findings demonstrate that EGR1 is critical for upregulation of AE2 protein.

image

Figure 5. EGR1 contributes to the regulation of AE2 protein expression. (A), (B) Endogenous AE2 expression was decreased in EGR1 knockdown cells (A) and increased in EGR1 overexpression cells (B). Data are representative of experiments performed three times. The ratio of AE2 and EGR1 protein abundance to that of β-actin was normalized to a value of 1.0 for the siRNA-NC/empty vector, *< 0.05, compared with siRNA-NC/empty vector. (C) Diagram of signaling pathways mediating the effect of gastrin-induced EGR1 and SP1 on AE2a1 promoter in a CCKBR-dependent manner. siRNA-NC, siRNA negative control.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. Conflict of interest
  9. References

Our in vitro experiments with the human GC cell line clearly showed that simultaneous administration of gastrin is associated with upregulated AE2 alternative expression that involves an overlapping EGR1/SP1 binding site in the AE2a promoter (Fig. 5C). Several lines of evidence from our experiments support that EGR1, but not SP1, is a crucial transcription factor for the regulation of gastrin-dependent AE2 gene transactivation. First, co-transfection of EGR1 and SP1 in SGC7901 cells results in only a slight increase in AE2a promoter activity that is far weaker than separate transfection of EGR1, suggesting that SP1 may compete with EGR1 binding to AE2a promoter. Second, gastrin induction of EGR1 takes place in a few minutes before gastrin induction of SP1. Third, mutations in the EGR1 binding region reduce EGR1/SP1 DNA binding capacity more strongly than mutations in the SP1 binding region. Finally, knockdown or overexpression of EGR1 can significantly affect the protein abundance of AE2, while changes in SP1 have no significant effect on AE2 protein (data not shown). Collectively, these findings indicate that EGR1 plays an important role in gastrin-induced upregulation of AE2 protein. In the case of the AE2 gene, SP1, as a ubiquitous transcription factor, may participate in basal transcription [20].

EGR1, a nuclear protein, also known as TIS8, AT225, G0S30, NGFI-A and ZIF-268, belongs to the EGR family of C2H2-type zinc-finger proteins. The unstimulated EGR1 is expressed in low level in most tissues and can be transiently induced by a large number of growth factors, cytokines and stress factors such as injury, radiation or mechanical stress. The upregulation of EGR1 transcription is mediated by the mitogen-activated protein kinases (MAPKs) signal transduction pathway, especially the MEK1/ERK1/2 signaling pathway [21-23]. In the present work, we found that gastrin-dependent upregulation of AE2a expression through EGR1 is CCKBR dependent. CCKBR, as a G-protein-coupled receptor, mainly mediates the Ca2+ release and MEK/ERK pathways [24, 25]. In addition, previous studies have reported that MEK1/ERK1/2 cascades are critical for gastrin-dependent EGR1 protein accumulation in gastric epithelial cells and pancreatic α-cells [26, 27]. Therefore, we speculate that gastrin-dependent upregulation of AE2a via EGR1 may also be involved in the MEK1/ERK1/2 pathway.

The gastrin-induced increase in AE2 protein (Fig. 1A,B) seems larger than both the increase in mRNA (Fig. 2A) and the gastrin-stimulated elevation of luciferase expression (Fig. 3B), suggesting that the gastrin-induced expression of AE2 protein is not completely dependent on the induction of AE2 mRNA. Indeed, we previously found that AE1, the first member of the AE family to be discovered, is abundantly expressed in GC cells and plays a key role in GC progression through sequestration of the tumor suppressor p16 in cytoplasm [18]. On the other hand, the interdependent expression of AE1 and p16 interrupts AE2 trafficking to the plasma membrane (data not shown). Gastrin inhibits the expression of p16, resulting in degradation of AE1 [28] and release of AE2 to the plasma membrane, suggesting that the cytoplasmic AE2 is unstable (data not shown). Taken together, these findings suggest that gastrin upregulates AE2 expression through induction of AE2 transcription and enhanced stability of the AE2 protein.

In summary, our findings in GC cells give evidence for a relevant role of the gastrin-stimulated alternative expression from AE2 gene. Moreover, the results reveal the potentiality of peptides with therapeutic properties such as gastrin to modulate the alternative expression of AE2. In the case of GC, activation of this mechanism may result in improved treatment.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. Conflict of interest
  9. References

Cell culture and reagents

Human GC cell line SGC7901 was grown at 37 °C in DMEM (Hyclone, Logan, UT, USA) containing 10% fetal bovine serum (Hyclone) and 1% penicillin/streptomycin (Invitrogen, Carlsbad, CA, USA) in humidified 5% CO2. Gastrin was purchased from ChinaPeptides Co. Ltd (Shanghai, China). 2′,7′-bis-(2-carboxyethyl)-5-(and 6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM) was purchased from Dojindo Laboratories (Kumamoto, Japan). SP1 overexpression vector (CMV-SP1) was purchased from Addgene (Cambridge, MA, USA). EGR1 siRNA was obtained from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA). Antibodies used for immunoblot analysis included anti-AE2 C-terminal peptide (provided by Seth L. Alper), anti-EGR1 (Santa Cruz), anti-SP1 (Santa Cruz), anti-p65 (Santa Cruz) and anti-β-actin (Sigma-Aldrich, St. Louis, MO, USA).

Cl/HCO3 exchange assay and measurement of pHi

Cl/HCO3 exchange was measured in BCECF-AM-loaded cells subjected to cycles of bath Cl removal and restoration as previous described [29]. SGC7901 cells were grown overnight in 35 mm coverslip-bottom glass dishes, rinsed in serum-free DMEM, and incubated for 30 min at 37 °C in 1 mL serum-free DMEM containing 2 μm BCECF-AM. The glass dishes were then superfused with Ringer's buffer (140 mm NaCl or Na gluconate, 5 mm glucose, 5 mm potassium gluconate, 1 mm calcium gluconate, 1 mm MgSO4, 2.5 mm NaH2PO4, 25 mm NaHCO3, 10 mm HEPES, pH 7.4) with a pinch valve superfusion system (DAD-8VC, ALA Scientific Instruments, Westbury, NY, USA). BCECF-labeled cells were excited at alternating wavelengths of 440 and 490 nm, and fluorescence excitation ratios were converted to pHi by linear regression to a calibration curve generated by the high K+-nigericin method at bath pH values of 6.5, 7.0, 7.5 and 8.0. Cl/HCO3 exchange activity was estimated from the initial rate of change of pHi (dpHi/dt) upon bath Cl removal. The pHi was measured with BCECF-AM in a Synergy H4 Hybrid Multi-Mode Microplate Reader (BioTek, Winooski, VT, USA) as previously described, with modifications [30]. SGC7901 cells were seeded in 96-well plates (black for fluorescence, Greiner Bio-One GmbH, Frickenhausen, Germany) and grown overnight. After washing with serum-free DMEM, cells were incubated for 30 min at 37 °C in humidified 5% CO2 in serum-free DMEM containing 1 μm BCECF-AM. The plates were then washed with Ringer's buffer and pHi was measured by exciting cells at 440 and 490 nm using the Multi-Mode Microplate Reader and measuring emission at 530 nm.

RT-PCR and real-time quantitative PCR

Total RNA preparation and real-time quantitative PCR were performed as previously described [28]. Total RNA obtained from SGC7901 cells was reverse-transcribed into cDNA using random primers and ReverTra Ace-α-reverse transcriptase (Toyobo, Osaka, Japan). Real-time quantitative PCR (Applied Biosystems 7500 FAST Real-Time PCR System, Applied Biosystems Shanghai, Shanghai, China) was performed with 10 μm of each primer and Power SYBR® Green PCR Master Mix (Applied Biosystems).

Oligodeoxynucleotide primers for real-time PCR and RT-PCR were as follows: AE2 forward (5′-GTTGGACGCAGTGTTGGAG-3′) and AE2 reverse (5′-TCTTGAGCATCTGGCGCT-3′);AE2a1 forward (5′-GTTGGGAGAAGTTGGGAG-3′) and AE2a1 reverse (5′-AGGATCTCCTCAAACCGC-3′);AE2a2 forward (5′-TCTTGAGGGCTATGGACC-3′) and AE2a2 reverse (5′-AACGAGGCGGAGGCATAA-3′);glyceraldehyde-3-phosphate dehydrogenase (GAPDH) amplification served as internal standard.

AE2a promoter reporter plasmid construction and luciferase assay

Five different human AE2a promoter constructs (−1097/−64, −769/−64, −587/−64, −279/−64 and −201/−64 relative to the initiation codon) were generated by PCR and cloned into the pGL3-basic (Promega, Madison, WI, USA). This numbering does not include intron 1. The core binding motif (underlined) of the putative EGR1 and SP1 site, GAAGCGCGCCCCCGCCCCGG, was mutated to GAAGCGCGTCACTACCCCGG (−587 Mut). Integrity of all constructs was confirmed by DNA sequencing. For luciferase assays, SGC7901 cells were co-transfected with an AE2a-luc vector and the pRL-TK reporter construct. Following transfection, Opti-MEM was replaced with DMEM containing 10% fetal bovine serum in the presence or absence of 10−7 m gastrin, and luciferase activity in cell lysates was assayed according to the manufacturer's protocol (Promega), with normalization to TK activity.

Electrophoretic mobility shift assay (EMSA)

Double-strand AE2a promoter oligonucleotides containing the putative binding sites for EGR1 and SP1 were synthesized by Sangon Biotech (Shanghai, China) and 100 nm oligonucleotide was labeled using a Biotin Labeling Kit (Pierce, Rockford, IL, USA). Crude nuclear extracts prepared from SGC7901 cells were analyzed by EMSA using a Light Shift Chemiluminescent EMSA kit (Pierce). Equal amounts of nuclear extracts were incubated with 2 μL of 10× binding buffer, 1 μL (1 μg·μL−1) poly(dI.dC) and 2 μL (20 fmol) biotin labeled probe for 30 min at 37 °C, in the absence or presence of 200-fold excess of unlabeled competitor oligo. The biotinylated oligonucleotide–DNA complex was electrophoresed (100 V) on a 5% nondenaturing polyacrylamide gel containing 0.25× Tris/borate/EDTA, transferred to a positively charged nylon membrane in the same buffer, then crosslinked for 15 min on a UV transilluminator and detected by chemiluminescence.

Western blot analysis

Protein samples separated by SDS/PAGE were transferred to nitrocellulose membranes. Membranes were blocked for 1 h at room temperature in 5% skimmed milk in TBST before incubation with primary antibodies overnight at 4 °C. After washing in TBST three times for 10 min each, the membranes were incubated for 1 h at room temperature with secondary antibodies and then washed again as before. Immune signal was detected using a chemiluminescence phototope-horseradish peroxidase kit according to the manufacturer's instructions (Pierce).

Statistical analysis

SPSS 13.0 statistical package (SPSS Inc., Chicago, IL, USA) was used to analyze the experimental data. The data were expressed as the mean ± SD. The χ2 test was used to analyze the rank data. Comparisons between two groups were performed with a t test. Non-parametric tests were used when the data (= 3) lacked a normal distribution. Statistical differences were considered to be significant for < 0.05.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. Conflict of interest
  9. References

We thank Seth L. Alper (Harvard Medical School, USA) for providing the anti-AE2 antibody, and Ian de Belle (Laval University, Canada) for providing the EGR1 overexpression construct. This work was supported in part by the National Natural Science Foundation of China (NO30570697; NO30770960); Shanghai Municipal Science and Technology Commission Research Project (NO11JC1406700).

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. Conflict of interest
  9. References
  • 1
    Medina JF, Acin A & Prieto J (1997) Molecular cloning and characterization of the human AE2 anion exchanger (SLC4A2) gene. Genomics 39, 7485.
  • 2
    Alper SL (2006) Molecular physiology of SLC4 anion exchangers. Exp Physiol 91, 153161.
  • 3
    Alper SL (2009) Molecular physiology and genetics of Na+-independent SLC4 anion exchangers. J Exp Biol 212, 16721683.
  • 4
    Banales JM, Masyuk TV, Bogert PS, Huang BQ, Gradilone SA, Lee SO, Stroope AJ, Masyuk AI, Medina JF & LaRusso NF (2008) Hepatic cystogenesis is associated with abnormal expression and location of ion transporters and water channels in an animal model of autosomal recessive polycystic kidney disease. Am J Pathol 173, 16371646.
  • 5
    Medina JF (2011) Role of the anion exchanger 2 in the pathogenesis and treatment of primary biliary cirrhosis. Dig Dis 29, 103112.
  • 6
    Banales JM, Saez E, Uriz M, Sarvide S, Urribarri AD, Splinter P, Tietz Bogert PS, Bujanda L, Prieto J, Medina JF et al. (2012) Upregulation of microRNA 506 leads to decreased Cl(–)/HCO(3)(–) anion exchanger 2 expression in biliary epithelium of patients with primary biliary cirrhosis. Hepatology 56, 687697.
  • 7
    Beuers U, Maroni L & Elferink RO (2012) The biliary HCO(3)(–) umbrella: experimental evidence revisited. Curr Opin Gastroenterol 28, 253257.
  • 8
    Svastova E, Witarski W, Csaderova L, Kosik I, Skvarkova L, Hulikova A, Zatovicova M, Barathova M, Kopacek J, Pastorek J et al. (2012) Carbonic anhydrase IX interacts with bicarbonate transporters in lamellipodia and increases cell migration via its catalytic domain. J Biol Chem 287, 33923402.
  • 9
    Jansen ID, Mardones P, Lecanda F, de Vries TJ, Recalde S, Hoeben KA, Schoenmaker T, Ravesloot JH, van Borren MM, van Eijden TM et al. (2009) Ae2(a, b)-deficient mice exhibit osteopetrosis of long bones but not of calvaria. FASEB J 23, 34703481.
  • 10
    Josephsen K, Praetorius J, Frische S, Gawenis LR, Kwon TH, Agre P, Nielsen S & Fejerskov O (2009) Targeted disruption of the Cl/HCO3 exchanger Ae2 results in osteopetrosis in mice. Proc Natl Acad Sci USA 106, 16381641.
  • 11
    Recalde S, Muruzabal F, Looije N, Kunne C, Burrell MA, Saez E, Martinez-Anso E, Salas JT, Mardones P, Prieto J et al. (2006) Inefficient chronic activation of parietal cells in Ae2a, b(–/–) mice. Am J Pathol 169, 165176.
  • 12
    Salas JT, Banales JM, Sarvide S, Recalde S, Ferrer A, Uriarte I, Oude Elferink RP, Prieto J & Medina JF (2008) Ae2a, b-deficient mice develop antimitochondrial antibodies and other features resembling primary biliary cirrhosis. Gastroenterology 134, 14821493.
  • 13
    Hwang JM, Kao SH, Hsieh YH, Li KL, Wang PH, Hsu LS & Liu JY (2009) Reduction of anion exchanger 2 expression induces apoptosis of human hepatocellular carcinoma cells. Mol Cell Biochem 327, 135144.
  • 14
    Liu CJ, Hwang JM, Wu TT, Hsieh YH, Wu CC, Hsieh YS, Tsai CH, Wu HC, Huang CY & Liu JY (2008) Anion exchanger inhibitor DIDS induces human poorly-differentiated malignant hepatocellular carcinoma HA22T cell apoptosis. Mol Cell Biochem 308, 117125.
  • 15
    Wu TT, Hsieh YH, Wu CC, Tsai JH, Hsieh YS, Huang CY & Liu JY (2006) Overexpression of anion exchanger 2 in human hepatocellular carcinoma. Chin J Physiol 49, 192198.
  • 16
    Song LJ, Liu RJ, Zeng Z, Alper SL, Cui HJ, Lu Y, Zheng L, Yan ZW & Fu GH (2012) Gastrin inhibits a novel, pathological colon cancer signaling pathway involving EGR1, AE2, and P-ERK. J Mol Med (Berl) 90, 707718.
  • 17
    Yang Y, Wu PP, Wu J, Shen WW, Wu YL, Fu AF, Zheng L, Jin XL & Fu GH (2008) Expression of anion exchanger 2 in human gastric cancer. Exp Oncol 30, 8187.
  • 18
    Shen WW, Wu J, Cai L, Liu BY, Gao Y, Chen GQ & Fu GH (2007) Expression of anion exchanger 1 sequestrates p16 in the cytoplasm in gastric and colonic adenocarcinoma. Neoplasia 9, 812819.
  • 19
    Medina JF, Lecanda J, Acin A, Ciesielczyk P & Prieto J (2000) Tissue-specific N-terminal isoforms from overlapping alternate promoters of the human AE2 anion exchanger gene. Biochem Biophys Res Commun 267, 228235.
  • 20
    Zhao WF, Wang HB, Xie B, Hu LJ, Xu LH, Kuang BH, Li MZ & Zhang X (2012) Sp1 and Sp3 are involved in the full transcriptional activity of centromere protein H in human nasopharyngeal carcinoma cells. FEBS J 279, 27142726.
  • 21
    Zwang Y, Sas-Chen A, Drier Y, Shay T, Avraham R, Lauriola M, Shema E, Lidor-Nili E, Jacob-Hirsch J, Amariglio N et al. (2011) Two phases of mitogenic signaling unveil roles for p53 and EGR1 in elimination of inconsistent growth signals. Mol Cell 42, 524535.
  • 22
    Kumbrink J & Kirsch KH (2012) Regulation of p130(Cas)/BCAR1 expression in tamoxifen-sensitive and tamoxifen-resistant breast cancer cells by EGR1 and NAB2. Neoplasia 14, 108120.
  • 23
    van Loo KM, Schaub C, Pernhorst K, Yaari Y, Beck H, Schoch S & Becker AJ (2012) Transcriptional regulation of T-type calcium channel CaV3.2: bi-directionality by early growth response 1 (Egr1) and repressor element 1 (RE-1) protein-silencing transcription factor (REST). J Biol Chem 287, 1548915501.
  • 24
    Berna MJ, Seiz O, Nast JF, Benten D, Blaker M, Koch J, Lohse AW & Pace A (2010) CCK1 and CCK2 receptors are expressed on pancreatic stellate cells and induce collagen production. J Biol Chem 285, 3890538914.
  • 25
    Chao C, Ives KL, Goluszko E, Kolokoltsov AA, Davey RA, Townsend CM Jr & Hellmich MR (2005) SRC regulates constitutive internalization and rapid resensitization of a cholecystokinin 2 receptor splice variant. J Biol Chem 280, 3336833373.
  • 26
    Raychowdhury R, Schafer G, Fleming J, Rosewicz S, Wiedenmann B, Wang TC & Hocker M (2002) Interaction of early growth response protein 1 (Egr-1), specificity protein 1 (Sp1), and cyclic adenosine 3′5′-monophosphate response element binding protein (CREB) at a proximal response element is critical for gastrin-dependent activation of the chromogranin A promoter. Mol Endocrinol 16, 28022818.
  • 27
    Koehler JA, Baggio LL, Lamont BJ, Ali S & Drucker DJ (2009) Glucagon-like peptide-1 receptor activation modulates pancreatitis-associated gene expression but does not modify the susceptibility to experimental pancreatitis in mice. Diabetes 58, 21482161.
  • 28
    Tian H, Zhang N, Suo WH, Wang T, Song LJ, Wu J, Liu Q, Shen WW & Fu GH (2010) Gastrin suppresses the interdependent expression of p16 and anion exchanger 1 favoring growth inhibition of gastric cancer cells. Int J Cancer 127, 14621474.
  • 29
    Hille C, Berg M, Bressel L, Munzke D, Primus P, Lohmannsroben HG & Dosche C (2008) Time-domain fluorescence lifetime imaging for intracellular pH sensing in living tissues. Anal Bioanal Chem 391, 18711879.
  • 30
    Townsend PD, Holliday PM, Fenyk S, Hess KC, Gray MA, Hodgson DR & Cann MJ (2009) Stimulation of mammalian G-protein-responsive adenylyl cyclases by carbon dioxide. J Biol Chem 284, 784791.