SEARCH

SEARCH BY CITATION

Keywords:

  • breast cancer;
  • EGFR ;
  • ERs;
  • estradiol;
  • heparan sulfate proteoglycans;
  • IGFR

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References

Estradiol (E2)–estrogen receptor (ER) actions are implicated in initiation, growth and progression of hormone-dependent breast cancer. Crosstalk between ERs, epidermal growth factor receptor (EGFR) and/or insulin-like growth factor receptor (IGFR) is critical for the observed resistance to endocrine therapies. Cell surface heparan sulfate proteoglycans (HSPGs) are principal mediators of cancer cell properties and the E2–ER pathway as well as those activated by EGFR and IGFR have significant roles in regulating the expression of certain cell surface HSPGs, such as syndecan-2 (SDC-2), syndecan-4 (SDC-4) and glypican-1. In this study, we therefore evaluated the role of EGFR-IGFR signaling on the constitutive expression and E2-mediated expression of ERs and HSPGs as well as the effect of E2–ERs and IGFR/EGFR-mediated cell migration in ERα+ (MCF-7) and ERβ+ (MDA-MB-231) breast cancer cells using specific intracellular inhibitors of EGFR and IGFR. We report that the expression of ERα is mainly enhanced by IGFR, whereas ERβ expression is mainly coordinated by EGFR. Moreover, constitutive SDC-2 expression in ERα+ and ERβ+ cells is mainly mediated through the IGFR, whereas in ERα+ E2-treated cells EGFR is the active one. In contrast, SDC-4 expression is regulated by IGFR in the presence and absence of E2. E2 also seems to diminish the inhibitory effect of EGFR and IGFR inhibitors in breast cancer cell migration. These data suggest that the coordinated action of ERs with EGFR and/or IGFR is of crucial importance, providing potential targets for designing and developing novel multi-potent agents for endocrine therapies.


Abbreviations
E2

estradiol

ECM

extracellular matrix

EGF

epidermal growth factor

EGFR

EGF receptor

ER

estrogen receptor

GAPDH

glyceraldehyde-3-phosphate dehydrogenase

GPC-1

glypican-1

HSPG

heparan sulfate proteoglycan

IGF

insulin-like growth factor

IGFR

IGF receptor

SDC-2

syndecan-2

SDC-4

syndecan-4

Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References

Breast cancer is a hormone-dependent malignancy accounting for most of the cancer-related mortality in women [1, 2]. In response to this, the scientific community has focused its interest on discovering new molecular targets. Steroid sex hormones, such as estradiol (E2), and their receptors seem to play very important roles in the development and progression of breast cancer. Two main forms of estrogen receptor (ER) exist, ERα and ERβ, which belong to the superfamily of nuclear receptors for steroid/thyroid hormones [3].

Both ER subtypes are normally expressed in mammary tissue. The presence of high levels of ERα in benign breast epithelium is highlighted throughout the literature and has long been determined to be a prognostic marker for breast cancer, suggesting a role for ERα in breast cancer initiation, promotion and progression [4]. The role of ERβ in breast cancer is less elucidated compared with that of ERα. Studies have revealed that the ratio of ERα/ERβ expression is higher in breast tumors than in normal tissues due to lower expression of ERβ [5, 6]. ERα and ERβ play distinct roles, sometimes antagonistic, in breast cancer initiation and progression. Estrogens trigger cell proliferation in breast cancer cells in the presence of ERα, whereas the expression of ERβ appears to reduce the cell proliferation and tumor formation induced by ERα [7].

Their major biological actions involve genomic and non-genomic actions [8]. The genomic actions of estrogens are mediated via ERs, which either interact directly with estrogen response elements in the promoters of target genes and recruit various coactivators or act themselves as coactivators of transcription factors to mediate transcriptional regulation [9]. ERs can also function independently of estrogens, modified by extracellular signals. Growth factors like epidermal growth factor (EGF) and insulin-like growth factor (IGF) via their receptor-associated intracellular signaling effectors lead to the activation of several phosphorylation sites of the ER protein [10, 11]. Apart from their nuclear localization, ERs also reside in the cytoplasm and the membrane compartments, establishing protein nature interactions and subsequently inducing rapid non-genomic effects via signaling pathways more commonly associated with growth factor activation of cell surface receptors [12, 13]. The research group of Song et al. reported that the estrogen-mediated activation of ERs induces a linear signaling cascade, involving IGF-I receptor activation and subsequent production of matrix metalloproteinases, resulting in mitogen-activated protein kinase (MAPK) signaling via EGF receptor (EGFR) activation [14].

The extracellular matrix (ECM) is a mixture of several glycoproteins, proteoglycans, glycosaminoglycans and other macromolecules that provide not only the essential physical scaffolding to host tissue but also initiate crucial biochemical and biomechanical signals that are required for tissue morphogenesis, differentiation and homeostasis [15]. Breast cancer is characterized by significant quantitative changes of extracellular network components. Consequently, changes in the microenvironment of tumor cells may lead to changes in their behavior. Such ECM molecules are the cell surface heparan sulfate proteoglycans (HSPGs) [16-19]. Syndecans and glypicans represent two major subfamilies of HSPGs, which are type I transmembrane and glycosyl-phosphatidylinositol anchored to the cell membrane, respectively. They are involved in fundamental biological processes such as cell–cell and cell–ECM interactions and the control of cell proliferation, differentiation and morphogenesis [20, 21].

Following pilot experiments in our laboratories, where we examined the involvement of cell surface HSPGs in breast cancer malignancy under various treatment conditions, it was observed that syndecan-2 (SDC-2) and syndecan-4 (SDC-4) as well as glypican-1 (GPC-1) were overexpressed in the breast cancer cell lines tested compared with normal mammary cells. Furthermore, under treatment with growth factors (EGF and IGF) HSPG gene expression was upregulated and breast cancer cell proliferation was enhanced [22, 23]. Previous studies in our laboratory have shown that E2 can modulate gene and protein expression of major ECM macromolecules such as the HSPGs [24]. Apart from the well-studied pathways that E2 uses to signal (genomic and non-genomic pathways), this hormone can induce crosstalk between ERs, IGF receptor (IGFR) and EGFR. The E2-induced interplay between the ERs, IGFR and EGFR appears to play an important role in breast cancer progression [14, 24]. Data revealed that breast cancer cells under estrogen deprivation therapy develop resistance as they increase their utilization of non-genomic signaling pathways mediated by IGFR and EGFR signaling [24, 25].

No literature data, however, exist on the effects of this crosstalk on the expression of ECM macromolecules. For this purpose, we used two epithelial breast cancer cell lines with different metastatic capacities and different ER expression profiles in order to evaluate whether ER crosstalk with IGFR and EGFR controls the expression of ECM macromolecules and mediates breast cancer cell migration. Specifically, we evaluated the constitutive as well as the E2-mediated gene expression of ERs and HSPGs (syndecans, glypicans) via IGFR and EGFR.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References

Evaluation of EGFR/IGFR in the expression of ERs in breast cancer cells

We first evaluated the role of ERs in two breast cancer cell lines with different ER status, MCF-7 (ERα+) and MDA-MB-231 (ERα–/ERβ+) cells. To exclude the estrogenic effect of the serum, all experiments were conducted under serum-free conditions. We have previously reported that E2 significantly stimulated the proliferation of MCF-7 cells up to a concentration of 20 nm [22] and that the expression of ERs was coordinated by the action of E2, as it downregulated the expression of ERα and upregulated the expression of ERβ in breast cancer cells [26]. To strengthen the concept of ERs–IGFR–EGFR crosstalk, in unpublished data of our laboratory and other studies it has been documented that EGF and IGF significantly enhanced breast cancer cell proliferation at the level of 60–70% of control, where, for example, the IGFR growth-related functions may depend on ER expression [27, 28].

For this purpose, we examined the ERα/β expressions following treatment of breast cancer cells in the absence and presence of E2 with and without specific intracellular inhibitors of EGFR (AG1478) and IGFR (AG1024). The results obtained are presented in Fig. 1. In MCF-7 (ERα+) breast cancer cells, following treatment with AG1478 and AG1024 inhibitors a significant upregulation of ERα expression (+23%) and a significant downregulation (–32%) respectively were noticed compared with untreated cells. Interestingly, treatment with both inhibitors exhibited a downregulation of ERα expression at the level of 53%. These data indicate that EGFR exerts a suppressive effect on ERα expression, whereas IGFR has a stimulatory role on ERα expression. Notably, the inhibition of both growth factor receptors resulted in the suppression of ERα expression, suggesting that IGFR plays a major role to enhance the expression of ERα. On the other hand, E2 significantly reduced ERα expression (−24%) and in the presence of AG1478 it exhibited a significant upregulation compared with the E2-treated cells. Moreover, incubation of MCF-7 cells with E2 and AG1024 led to a further downregulation of ERα mRNA level compared with the E2-treated or the inhibitor-treated cells. As shown in Fig. 1A, upon exposure of MCF-7 cells to the combination of both inhibitors in the presence of E2, no significant differentiation compared with E2-treated or inhibitor-treated cells was noted (Fig. 1A). Therefore, it seems that the E2-treated cells followed a similar tendency to the non-treated ones, but an enhanced impact on ERα expression profile was exhibited with either the EGFR-suppressive or the IGFR-stimulatory effects. However, when both receptors were blocked, E2 exerted the same suppressive effect on ER expression as in absence of inhibitors, indicating that the E2–ER-mediated axis apparently plays a crucial suppressive role in ERα gene expression, which supports the idea that both EGFR and IGFR are part of a regulatory mechanism for ERα suppression in E2-treated cells.

image

Figure 1. Effects of EGFR and IGFR on the expression of ERs in breast cancer cells. (A) Evaluation of the gene expression of ERα in MCF-7 cells: (i) constitutive expression of ERα upon treatment with 1 μm AG1478 (EGFR inhibitor) and 1 μm ΑG1024 (IGFR inhibitor); (ii) E2-mediated (10 μm) expression of ERα under treatment with EGFR and IGFR inhibitors. (B) ERβ gene expression in MDA-MB-231 breast cancer cells: (i) constitutive ERβ gene expression upon treatment with 1 μm AG1478 (EGFR inhibitor) and 1 μm AG1024 (IGFR inhibitor); (ii) RT-PCR analysis for ERβ expression mediated by E2 (10 μm), AG1478 (1 μm) and AG1024 (1 μm). The results are expressed as mean ± SD of three separate experiments in triplicate. Statistically significant differences compared with control, E2-treated cells and cells treated with the respective inhibitors are shown by * 0.05, † 0.05 and # 0.05, respectively.

Download figure to PowerPoint

The expression of ERβ in the MDA-MB-231 breast cancer cell line exhibited a stimulatory profile as depicted in Fig. 1B. Specifically, the expression level of ERβ in the AG1478-treated cells resulted in increased expression (+34%) compared with control cells. In contrast, no significant change was observed when AG1024 inhibitor was added. The mixture of both inhibitors stimulated the expression of ERβ receptor up to 45%, a profile similar to the stimulatory effect obtained with the AG1478 inhibitor. It is therefore plausible to suggest that in MDA-MB-231 ERα−/ERβ+ cells EGFR is the major suppressive player of the two tyrosine kinase receptors for ERβ expression. In E2-treated cells, however, E2 caused a significant upregulation (+40%) of ERβ expression (Fig. 1B). Notably, treatment with AG1478 in the presence of E2 revealed a significant increase in ERβ expression compared with the AG1478-treated cells. A similar expression pattern was also observed for the (E2+ AG1024)-treated MDA-MB-231 cells. These data suggest that EGFR as well as IGFR exerts significant suppression effects on ERβ expression. In the presence of both EGFR and IGFR inhibitors in the E2-treated cells, the levels of ERβ were further increased compared with E2-treated or inhibitor-treated cells, showing an additive mode of action (Fig. 1B). It is therefore concluded that for E2-enhanced ERβ expression both EGFR- and IGFR-mediated signaling are required to keep the E2-enhanced expression.

E2-mediated HSPG gene expression via EGFR/IGFR signaling

The importance of cell membrane HSPGs in cell adhesion and signaling as well as in cancer progression makes them significant molecules for further investigation. More specifically, SDC-2 is implicated in cell adhesion and signaling [29], whereas SDC-4 is implicated in cell adhesion and cancer promotion [30-32]. Furthermore, GPC-1 has been correlated with activation of the mitogen pathway through growth factors in breast cancer [32, 33]. It is well established that HSPGs are able to bind to various growth factors and subsequently modulate their activities [16, 19, 34]. For this purpose we studied the effect of ER–IGFR–EGFR crosstalk on the gene expression of HSPGs.

Data concerning SDC-2 gene expression in MCF-7 breast cancer cells after treatment with AG1478, AG1024 and their combination showed that the use of AG1024 inhibitor significantly downregulated SDC-2 expression at the level of 56%, whereas no significant effect was observed with AG1478, indicating that IGFR was required for constitutive SDC-2 expression (Fig. 2A). Moreover, treatment with both inhibitors reduced SDC-2 expression further. Incubation of MCF-7 cells with E2 exhibited a significant upregulation of SDC-2 expression at the level of 42% compared with control cells. The results were altered under the treatment with inhibitors in the presence of E2, in contrast to those obtained for the constitutive expression of SDC-2. Specifically, the action of AG1478 in the presence of E2 revealed a statistically significant upregulation of SDC-2. The expression of SDC-2 under E2+ AG1024 was at the same level as for E2-treated cells but significantly higher compared with AG1024-treated cells. The use of both inhibitors in the presence of E2 resulted in a significant upregulation compared with cells treated with a mixture of inhibitors in the absence of E2 (Fig. 2A). These data indicate that IGFR is the key factor for keeping the constitutive SDC-2 expression in the absence of E2; however, EGFR signaling exhibits a significant role in keeping the E2-enhanced SDC-2 expression.

image

Figure 2. Evaluation of E2-mediated SDC-2 expression via EGFR/IGFR. (A) Study of gene expression of SDC-2 in MCF-7 cells: (i) constitutive expression of SDC-2 upon treatment with 1 μm AG1478 (EGFR inhibitor) and 1 μm ΑG1024 (IGFR inhibitor); (ii) E2-mediated (10 μm) expression of SDC-2 under treatment with EGFR and IGFR inhibitors. (B) SDC-2 gene expression in MDA-MB-231 breast cancer cells: (i) constitutive SDC-2 gene expression upon treatment with 1 μm AG1478 (EGFR inhibitor) and 1 μm AG1024 (IGFR inhibitor); (ii) RT-PCR analysis for SDC-2 expression mediated by E2 (10 μm), AG1478 (1 μm) and AG1024 (1 μm). The results are expressed as mean ± SD of three separate experiments in triplicate. Statistically significant differences compared with control, E2-treated cells and cells treated with the respective inhibitors are shown by * 0.05, † 0.05 and # 0.05, respectively.

Download figure to PowerPoint

In ERβ+ MDA-MB-231 breast cancer cells, SDC-2 gene expression was downregulated by 35% and 58% after treatment with AG1478 and AG1024 inhibitor, respectively, compared with control cells. The use of both inhibitors resulted in an almost complete downregulation of SDC-2 gene expression (95%). These data highlight the significance of both growth factor receptors in the SDC-2 constitutive expression by MDA-MB-231 cells. Furthermore, when E2 treatment was utilized an upregulation (25%) for SDC-2 expression was noted. Upon treatment of MDA-MB-231 cells with E2 and AG1478, SDC-2 gene expression was induced compared with E2-treated cells. On the other hand, the culture of cells in the presence of E2 and AG1024 reduced the expression of SDC-2 compared with E2-treated and AG1024-treated cells. The mixture of inhibitors and E2 induced a statistically significant decrease compared with E2- and AG1478-treated cells (Fig. 2B). The inductive profile of SDC-2 E2-induced expression is inhibited by the action of IGFR inhibitor, suggesting a critical role of IGFR in this process.

SDC-4 expression of MCF-7 cells was inhibited by AG1478 (43%), whereas the use of AG1024 resulted in no significant difference compared with control cells (Fig. 3A). The results obtained suggest that the key mediator of SDC-4 constitutive expression in these cells is EGFR. However, the combination of both inhibitors further downregulated the SDC-4 mRNA levels (78%). Upon treatment with E2 in MCF-7 breast cancer cells, gene expression of SDC-4 was downregulated (−60%) compared with untreated cells. Furthermore, the inhibitory effect of AG1478 was reversed in the presence of E2, as an increased SDC-4 gene expression was noted compared with E2- and inhibitor-treated cells. Treatment of MCF-7 cells with E2 and AG1024 resulted in the same expression level for SDC-4 as in E2-treated cells. MCF-7 cells treated with both inhibitors in the presence of E2 showed no statistically significant difference in gene expression of SDC-4 compared with E2- and inhibitor-treated cells (Fig. 3A). It is worth mentioning that the E2-mediated downregulation of SDC-4 expression was abolished by the blockage of EGFR signaling, an effect that was not observed with the blockage of IGFR or both receptors.

image

Figure 3. Constitutive and E2-mediated SDC-4 gene expression via EGFR/IGFR. (A) Study of gene expression of SDC-4 in MCF-7 cells: (i) constitutive expression of SDC-4 upon treatment with 1 μm AG1478 (EGFR inhibitor) and 1 μm ΑG1024 (IGFR inhibitor); (ii) E2-mediated (10 μm) expression of SDC-4 under treatment with EGFR and IGFR inhibitors. (B) SDC-4 gene expression in MDA-MB-231 breast cancer cells: (i) constitutive SDC-4 gene expression upon treatment with 1 μm AG1478 (EGFR inhibitor) and 1 μm AG1024 (IGFR inhibitor); (ii) RT-PCR analysis for SDC-4 expression mediated by E2 (10 μm), AG1478 (1 μm) and AG1024 (1 μm). The results are expressed as mean ± SD of three separate experiments in triplicate. Statistically significant differences compared with control, E2-treated cells and cells treated with the respective inhibitors are shown by * 0.05, † 0.05 and # 0.05, respectively.

Download figure to PowerPoint

In ERβ+ breast cancer cell line MDA-MB-231 the constitutive expression of SDC-4 in AG1478- and AG1024-treated cells was downregulated (48% and 18%, respectively) (Fig. 3B). Incubation of cells with the mixture of inhibitors resulted in a significant reduction of the SDC-4 mRNA level (53%). The respective results highlight the significant contribution of EGFR signaling in the expression of SDC-4, whereas IGFR exhibited a minor effect. It is noted that MDA-MB-231 cells treated with E2 showed a significant reduction (–24%) in SDC-4 gene expression. Similarly, when MDA-MB-231 cells were treated with AG1478 in the presence of E2 the SDC-4 expression levels were downregulated compared with E2-treated cells. No remarkable differences compared with E2-treated cells were observed when MDA-MB-231 cells were cultured in the presence of E2 and AG1024. The combination of both inhibitors, in the presence of E2, downregulated SDC-4 expression compared with E2-treated cells. It is concluded that, apart from the E2-mediated downregulation of SDC-4 expression, the signaling pathways of the two receptors do not seem to contribute to their possible crosstalk.

In MCF-7 ERα+ breast cancer cell line, the constitutive expression of GPC-1 under treatment with AG1478 inhibitor was not affected, in contrast to the slightly enhanced expression reported after the treatment with AG1024 inhibitor (16%) compared with control cells (Fig. 4A). The mixture of AG1478 and AG1024 resulted in a reduction of GPC-1 mRNA expression (32%). According to the results, the EGFR and IGFR signaling pathways do not seem to be correlated with GPC-1 expression. Treatment of MCF-7 with E2 resulted in a slight but statistically important reduction of GPC-1 gene expression. No significant changes were reported following treatment with AG1478 or AG1024 in the presence of E2. As shown in Fig. 4A, the use of both inhibitors with E2 suppressed GPC-1 expression in comparison with E2-treated cells, whereas no important changes were observed compared with inhibitor-treated cells. It is therefore plausible to suggest that the E2-mediated downregulation of GPC-1 is attributed to the action of ERs, whereas when both signaling pathways are blocked the action of E2 is enhanced.

image

Figure 4. Evaluation of the role of EGFR and IGFR in constitutive and E2-mediated GPC-1 expression. (A) Study of gene expression of GPC-1 in MCF-7 cells: (i) constitutive expression of GPC-1 upon treatment with 1 μm AG1478 (EGFR inhibitor) and 1 μm ΑG1024 (IGFR inhibitor); (ii) E2-mediated (10 μm) expression of GPC-1 under treatment with EGFR and IGFR inhibitors. (B) GPC-1 gene expression in MDA-MB-231 breast cancer cells: (i) constitutive GPC-1 gene expression upon treatment with 1 μm AG1478 (EGFR inhibitor) and 1 μm AG1024 (IGFR inhibitor); (ii) RT-PCR analysis for GPC-1 expression mediated by E2 (10 μm), AG1478 (1 μm) and AG1024 (1 μm). The results are expressed as mean ± SD of three separate experiments in triplicate. Statistically significant differences compared with control, E2-treated cells and cells treated with the respective inhibitors are shown by * 0.05, † 0.05 and # 0.05, respectively.

Download figure to PowerPoint

Moreover, GPC-1 expression in MDA-MB-231 cells was suppressed under treatment with AG1478 and/or AG1024 (40%, 38% and 28% of control cells, respectively) (Fig. 4B). These data reveal the contribution of both receptors' signaling pathways to the constitutive expression of GPC-1 in these cells. However, the treatment with E2 had no significant effect on GPC-1 expression, but treatment with AG1478 in the presence of E2 indicated a significant overexpression compared with cells treated with AG1478 alone. On the other hand, upon exposure to E2 and AG1024, GPC-1 expression was suppressed compared with E2-treated cells. The use of both inhibitors in the presence of E2 resulted in statistically important downregulation of GPC-1 compared with E2-treated cells. In terms of E2-mediated effects, it is suggested that there is no correlation between the action of E2 and the growth factor receptors EGFR and IGFR and GPC-1 expression.

Role of E2 in breast cancer cell migration upon treatment with specific inhibitors of EGFR and IGFR

In order to evaluate the role of ERs and IGFR/EGFR coordinated signaling on important breast cancer cell properties involved in cancer progression, breast cancer cell motility was evaluated with a wound healing assay upon treatment with the EGFR- and IGFR-specific inhibitors in the presence and absence of E2. MCF-7 cells showed a significantly reduced motility (~50%) upon treatment with either EGFR or IGFR inhibitor, but in the presence of both inhibitors the motility efficiency was slightly upregulated compared with untreated cells. The action of E2 had a distinct role in cell motility, although it had no effect alone, since in the presence of inhibitors it markedly reduced the inhibitory effect of each inhibitor alone (Fig. 5A).

image

Figure 5. Role of E2–ERs, EGFR and IGFR in breast cancer cell migration. (A) Study of cell motility in MCF-7 cells: (i) constitutive cell migration upon treatment with 1 μm AG1478 (EGFR inhibitor) and 1 μm ΑG1024 (IGFR inhibitor); (ii) E2-mediated (10 μm) migration effect under treatment with EGFR and IGFR inhibitors. (B) Cell motility in MDA-MB-231 breast cancer cells: (i) constitutive migratory potential upon treatment with 1 μm AG1478 (EGFR inhibitor) and 1 μm AG1024 (IGFR inhibitor); (ii) cell migration mediated by E2 (10 μm), AG1478 (1 μm) and AG1024 (1 μm). The results are expressed as mean ± SD of three separate experiments in triplicate. Statistically significant differences compared with control and cells treated with the respective inhibitors are shown by * 0.05 and # 0.05, respectively.

Download figure to PowerPoint

The migration of MDA-MB-231 cells was significantly suppressed with the use of either EGFR inhibitor alone or both inhibitors (Fig. 5B). The inhibitory effect of MDA-MB-231 breast cancer cells in the absence of E2 was reduced upon treatment with E2. It should be noticed that treatment of cells with both inhibitors in the presence of E2 upregulated the cell motility of MDA-MB-231 breast cancer cells.

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References

In recent years, both clinical observations and experimental studies pinpointed that estrogens and ERs possess critical roles in the development and progression of breast tumors. Breast cancer is a classical hormone-dependent tumor, as nearly 70% of breast tumors express ER and/or the progesterone receptor [35]. The mode of estrogen action is defined by the presence or not of ERs and their localization not only in the nucleus but also in the cytoplasm and the cell membrane [36]. E2 biological actions on transcription are characterized by genomic action via nuclear ERs and by non-genomic actions outside the nuclear compartment [8]. Hormonal therapies are currently used to treat ER-positive breast cancer; however, intrinsic and acquired resistance to these endocrine therapies is still a common feature. Emerging evidence suggests, apart from the well-studied nuclear functions, a remarkably complex interactive signaling with growth factor receptors such as EGFR and IGFR [11, 37, 38]. In a study on uterine leiomyoma cells, a high convergence of the growth regulatory pathways E2/ERα and IGF/IGFR has been proposed. More specifically IGF expression is coordinated by the genomic action of E2/ERα. Moreover, in the non-genomic E2-mediated pathway the presence of IGFR is required for cell proliferation promoting effects via MAPKp44/42 activation and subsequent association with the nuclear ERaser118. However, upon IGFR blockage, alternative pathways involving EGFR are activated to mediate E2 signals [39]. It has also been reported that diminished expression levels of IGFR alter the ERα/ERβ balance in favor of ERβ expression, resulting in high activated levels of p38 MAPK and p53, leading to apoptosis [40].

Work conducted by several research groups strengthens the notion that linear signaling crosstalk unites ER effects via IGFR and EGFR transduced signals. More specifically, this process involves the sequential events of IGFR phopshorylation via Src, activation of matrix metalloproteinases that shed EGFR natural ligand by the cell membrane and subsequent induction of EGFR tyrosine kinase activity leading finally to E2-induced MAPK activation [14, 41-43]. Going a step further, inhibition of the EGFR signaling leads to enhanced IGFR signaling, suggesting that both EGFR and IGFR pathways can mediate ERα signaling [24]. The importance of the ECM in physiological as well as pathological conditions like breast cancer is well established throughout the literature. HSPGs, examined in this project, participate in numerous biological functions, such as cell proliferation, adhesion, migration and differentiation [16, 18]. In addition, their expression pattern is seen to alter under the effect of E2 [26]. Considering the above, within this research project we evaluated the effects of IGFR- and EGFR-dependent constitutive gene expression, as well as E2-mediated IGFR- and EGFR-dependent gene expression of ERs as well as HSPGs (syndecans, glypicans) in MCF-7 (ERα+/ERβ− low) and MDA-MB-231 (ERα−/ERβ+) breast cancer cells with different metastatic capacity and different ER status.

The ERα and ERβ expression pattern is of utmost significance in breast cancer initiation and progression [5, 6]. Initially, we reported that in MCF-7 ERα+ breast cancer cells the constitutive expression of ERα is mediated mainly through IGFR, as the IGFR signaling axis is beneficial with regard to gene expression. Treatment with E2 led to the downregulation of ERα in accordance with the data reported by Kousidou et al. [26]. Similarly, the E2-mediated ERα expression profile was characterized by EGFR-suppressive or IGFR-enhanced effects. However, when both receptors are blocked, the E2–ER-mediated axis plays a crucial suppressive role in ERα gene expression, supporting the idea that both EGFR and IGFR are principal regulators in E2-treated cells. On the other hand, in MDA-MB-231 ERα–/ERβ+ cells, EGFR was shown to be the major suppressive player of the two tyrosine kinase receptors for ERβ expression since EGFR inhibition resulted in a significant decrease of ERβ expression. However, concerning E2-enhanced ERβ expression both EGFR- and IGFR-mediated signaling are required to keep the E2-enhanced expression. Overall, the data obtained suggest that the expression of ERα is mainly coordinated by IGFR, whereas ERβ expression is coordinated by EGFR.

At the level of matrix macromolecules, SDC-2 not only possesses a pivotal role in cell signaling [44], but also its overexpression is implicated in cancer progression [45]. On the other hand, SDC-4 expression is correlated with cell adhesion [31]. Considering the above, in accordance with previous studies we report that E2 enhanced and suppressed the expression of SDC-2 and SDC-4, respectively, in both breast cancer cell lines tested. The data strengthen the notion that estrogens contribute to the interplay of the tumor with the corresponding stroma and subsequent cancer progression [26]. Moreover, in ERα+ MCF-7 cells the results indicate that IGFR is the principal mediator of constitutive SDC-2 expression, whereas the EGFR axis is the principal mediator in E2-mediated SDC-2 expression. On the other hand, in ERβ+ MDA-MB-231 cells SDC-2 constitutive expression is coordinated by both growth factor receptors, whereas IGFR signaling has a critical role for E2-mediated SDC-2 expression. Concerning SDC-4, both ERα+ MCF-7 and ERβ+ MDA-MB-231 cells' constitutive expression is coordinated by EGFR. In a previous study at our laboratory, it was reported that the expression of SDC-4 is not mediated via the action of ERα [26]. In the present study, in ERα+ MCF-7 the E2-mediated downregulation of SDC-4 expression is abolished by the blockage of EGFR signaling, an effect that is not observed with the blockage of IGFR or both receptors. In ERβ+ MDA-MB-231 cells the signaling pathways of the two receptors do not seem to contribute to the E2-mediated possible crosstalk on SDC-4 expression.

It has been reported that GPC-1 suppression is correlated with slow growing tumors in vivo [46]. Here, we observed that E2-mediated effects on GPC-1 expression may be attributed to the action of ERs. However, the ER mode of action on GPC-1 is not clear.

At a functional level, it is reported in the literature that E2-mediated extranuclear actions promote cell migration and metastasis [47]. In the present study, directional cell migration assessed by a wound healing assay is suppressed by blockage of EGFR and IGFR. However, in general, E2-induced effect further diminish the inhibitory effect of EGFR and IGFR inhibitors in breast cancer cell migration.

In conclusion, we report here that the expression of HSPGs is mediated through the tyrosine kinase receptors EGFR and IGFR, in coordination with the action of E2–ERs. Moreover, different growth factor signaling pathways are implicated in the expression of each HSPG. The ER status of the breast cancer cell lines also seems to play a significant role in their expression. The overall effect on the expressions of ERs and HSPGs, constitutive and E2-treated, considering EGFR and IGFR actions, is summarized in Fig. 6. This research project provides insights concerning the role of ERs and ER–IGFR–EGFR crosstalk in the expression of bioactive ECM macromolecules involved in cancer progression, proposing potential targets for the design of more advanced treatment to overcome the observed resistance to endocrine therapies in breast cancer by using alternative signaling pathways.

image

Figure 6. Schematic representation summarizing the overall effects of IGFR/EGFR and the involvement of E2 in the expressions of ERs and cell surface HSPGs. (A) Literature proposed mode of action via ERs–IGFR–EGFR crosstalk. The genomic actions of estrogens are mediated via nuclear ERs, regulating transcriptional regulation. Apart from their nuclear localization, ERs may also reside in the cytoplasm and the membrane compartments, inducing non-genomic effects via IGFR and EGFR signaling pathways. The estrogen activation of ERs induces IGFR phosphorylation, activation of matrix metalloproteinases that shed EGFR natural ligand by the cell membrane and subsequent induction of EGFR tyrosine kinase activity leading finally to E2-induced MAPK gene transcription. (B) ERα+ breast cancer cells. (i) The constitutive gene expressions of ERα and SDC-2 as well as SDC-4 are mediated mainly through the IGFR and EGFR signaling axis, respectively. GPC-1 gene expression, on the other hand, is not significantly affected by the studied growth factor receptors. (ii) E2-mediated SDC-2 and SDC-4 as well as ERα expression profiles are coordinated by the EGFR and IGFR signaling axis, respectively. E2-mediated effects on GPC-1 expression may be attributed to the action of ERs. However, the ER mode of action (represented by - - -) on GPC-1 is not known. (C) ERβ+ breast cancer cells. (i) The constitutive gene expressions of ERβ and SDC-4 are mediated mainly through the EGFR signaling axis, whereas SDC-2 expression is regulated by both EGFR and IGFR pathways. GPC-1 gene expression is not significantly affected by the studied growth factor receptors. (ii) E2-mediated ERβ gene expression is regulated by both EGFR and IGFR pathways. SDC-2 expression mediated by E2 is coordinated by IGFR. Concerning SDC-4 expression, none of the receptors contributes significantly to the E2-mediated effect. E2-mediated actions on GPC-1 expression may be attributed to the action of ERs with a not yet known mode of action (- - -).

Download figure to PowerPoint

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References

Chemicals, biochemicals and reagents

E2 was supplied by Sigma Chemical Co. (St Louis, MO, USA). Stock solutions of 1 mm E2 were prepared by dissolving E2 in H2O. Allosteric inhibitors AG1478 (EGFR) and AG1024 (IGFR) were supplied by Sigma Chemical Co. (St Louis, MO, USA). Eagle's minimal essential medium (EMEM), fetal bovine serum (FBS), sodium pyruvate, sodium bicarbonate, l-glutamine, nonessential amino acids, penicillin, streptomycin, amphotericin B and gentamycin were all obtained from Biochrom KG (Berlin, Germany). Insulin was obtained from Sigma Chemicals (Steinhelm, Germany). All other chemicals used were of the best commercially available grade.

Cell lines and cell culture conditions

MCF-7 (low metastatic ERα+), MDA-MB-231 (highly invasive ERα−) breast cancer cell lines were obtained from the American Type Culture Collection (ATCC) and cultured as monolayers at 37 °C in a humidified atmosphere of 5% (v/v) CO2 and 95% air. All cancer cells were cultured in EMEM supplemented with 10% FBS, 2 mm l-glutamine, 1.0 mm sodium pyruvate, 1.5 g·L−1 sodium bicarbonate, 0.1 mm nonessential amino acids, 0.01 mg·mL−1 insulin and a cocktail of antimicrobial agents (100 IU·mL−1 penicillin, 100 mg·mL−1 streptomycin, 10 mg·mL−1 gentamicin sulfate and 2.5 mg·mL−1 amphotericin B).

All experiments were conducted in serum-free conditions. It is noted that treatment with the receptor inhibitors (1 μm) for 20 min was made prior to the E2 (10 nm) addition.

RNA isolation and RT-PCR

Breast cancer cells were first grown in serum-containing medium up to 70–75% confluence and then the agents were added according to the experimental plan in serum-free culture medium for 16 h. Total cellular RNA was isolated after cell lysis using NucleoSpin RNA II Kit (Macherey-Nagel, Düren, Germany). The amount of isolated RNA was quantified by measuring its absorbance at 260 nm. All total RNA preparations were free of DNA contamination as assessed by RT-PCR analysis. Total RNA was reverse transcribed using the PrimeScript 1st strand cDNA synthesis kit (Takara) and DyNAzyme II DNA Polymerase kit (Finnzymes). Semiquantitative analysis of cDNA sequences was carried out based on simultaneous amplification of a ‘housekeeping gene’, glyceraldehyde-3-phosphate dehydrogenase (GAPDH). All amplification products were separated by electrophoresis in a 2% agarose gel containing Gel Star® stain (BioWhittaker, Rockland, ME, USA). Bands were visualized on a UV lamp and gels were photographed with a charge-coupled device camera. The sequences of primers as well as their prime characteristics for the genes of interest are provided in Table 1. For semiquantitative analysis, gene expression was determined as the relative fluorescence obtained for each molecule compared with the reference gene (GAPDH). Image analysis was performed using the program unidocmv version 99.03 for Windows (UVI Tech, Cambridge, UK).

Table 1. PCR primers used to amplify the genes under investigation
GeneUpstream/DownstreamBase pairs of PCR productAnnealing temperature of primers Tan (°C)Cycles
ERα AATTCAGATAATCGACGCCAG/GTGTTTCAACATTCTCCCTCCTC 3455835
ERβ GTCCATCGCCAGTTATCACATC/GCCTTACATCCTTCACACGA 2426035
SDC-2 GGGAGCTGATGAGGATGTAG/CACTGGATGGTTTGCGTTCT 3946035
SDC-4 CTCCTAGAAGGCCGATACTTCT/GGACCTCCGTTCTCTCAAAGAT 3456035
GPC-1 ATCACCGACAAGTTCTGGGGTA/CATCTTCTCACTGCACAGTGTC 3176035
GAPDH ACATCATCCCTGCCTCTACTGG/AGTGGGTGTCGCTGTTGAAGTC 261  

In vitro wound healing assay

Breast cancer confluent cell layers were wounded by scratching with a sterile 10 μL pipette tip. Detached cells were removed by washing twice with NaCl/Pi and fresh culture medium serum free was added following the incubation periods with the agents. The wound closure was monitored at 0 and 24 h using a digital camera connected to a microscope. Wound surface area was quantified by image analysis (imagej 1.4.3.67 Launcher Symmetry Software).

Statistical analysis

All values are given as mean ± standard deviation of three separate experiments in triplicate. Differences between cell lines were evaluated using the Student t test (graphpad instat version 3.0 software) and considered statistically significant at a level of  0.05.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References

This work was supported by the European Union (European Social Fund) and Greek national funds through the Operational Program ‘Education and Lifelong Learning’ of the National Strategic Reference Framework Research Funding Program: Thalis. Investing in knowledge society through the European Social Fund.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References
  • 1
    Jemal A, Bray F, Center MM, Ferlay J, Ward E & Forman D (2011) Global cancer statistics. CA Cancer J Clin 61, 6990.
  • 2
    Mook S, Van't Veer LJ, Rutgers EJ, Ravdin PM, van de Velde AO, van Leeuwen FE, Visser O & Schmidt MK (2011) Independent prognostic value of screen detection in invasive breast cancer. J Natl Cancer Inst 103, 585597.
  • 3
    McDonnell DP & Norris JD (2002) Connections and regulation of the human estrogen receptor. Science 296, 16421644.
  • 4
    Ali S & Coombes RC (2000) Estrogen receptor alpha in human breast cancer: occurrence and significance. J Mammary Gland Biol Neoplasia 5, 271281.
  • 5
    Fox EM, Bernaciak TM, Wen J, Weaver AM, Shupnik MA & Silva CM (2008) Signal transducer and activator of transcription 5b, c-Src, and epidermal growth factor receptor signaling play integral roles in estrogen-stimulated proliferation of estrogen receptor-positive breast cancer cells. Mol Endocrinol 22, 17811796.
  • 6
    Fox EM, Davis RJ & Shupnik MA (2008) ERbeta in breast cancer – onlooker, passive player, or active protector? Steroids 73, 10391051.
  • 7
    Lazennec G, Bresson D, Lucas A, Chauveau C & Vignon F (2001) ER beta inhibits proliferation and invasion of breast cancer cells. Endocrinology 142, 41204130.
  • 8
    Acconcia F & Kumar R (2006) Signaling regulation of genomic and nongenomic functions of estrogen receptors. Cancer Lett 238, 114.
  • 9
    Nilsson S, Makela S, Treuter E, Tujague M, Thomsen J, Andersson G, Enmark E, Pettersson K, Warner M & Gustafsson JA (2001) Mechanisms of estrogen action. Physiol Rev 81, 15351565.
  • 10
    Shupnik MA (2004) Crosstalk between steroid receptors and the c-Src-receptor tyrosine kinase pathways: implications for cell proliferation. Oncogene 23, 79797989.
  • 11
    Silva CM & Shupnik MA (2007) Integration of steroid and growth factor pathways in breast cancer: focus on signal transducers and activators of transcription and their potential role in resistance. Mol Endocrinol 21, 14991512.
  • 12
    Barletta F, Wong CW, McNally C, Komm BS, Katzenellenbogen B & Cheskis BJ (2004) Characterization of the interactions of estrogen receptor and MNAR in the activation of cSrc. Mol Endocrinol 18, 10961108.
  • 13
    Levin ER (2002) Cellular functions of plasma membrane estrogen receptors. Steroids 67, 471475.
  • 14
    Song RX, Zhang Z, Chen Y, Bao Y & Santen RJ (2007) Estrogen signaling via a linear pathway involving insulin-like growth factor I receptor, matrix metalloproteinases, and epidermal growth factor receptor to activate mitogen-activated protein kinase in MCF-7 breast cancer cells. Endocrinology 148, 40914101.
  • 15
    Theocharis ADGC, Hascall V & Karamanos N (2012) Extracellular Matrix: A Functional Scaffold. De Gruyter, Berlin.
  • 16
    Theocharis AD, Skandalis SS, Tzanakakis GN & Karamanos NK (2010) Proteoglycans in health and disease: novel roles for proteoglycans in malignancy and their pharmacological targeting. FEBS J 277, 39043923.
  • 17
    Iozzo RV & Sanderson RD (2011) Proteoglycans in cancer biology, tumour microenvironment and angiogenesis. J Cell Mol Med 15, 10131031.
  • 18
    Sanderson RD (2001) Heparan sulfate proteoglycans in invasion and metastasis. Semin Cell Dev Biol 12, 8998.
  • 19
    Afratis N, Gialeli C, Nikitovic D, Tsegenidis T, Karousou E, Theocharis AD, Pavao MS, Tzanakakis GN & Karamanos NK (2012) Glycosaminoglycans: key players in cancer cell biology and treatment. FEBS J 279, 11771197.
  • 20
    Xian X, Gopal S & Couchman JR (2010) Syndecans as receptors and organizers of the extracellular matrix. Cell Tissue Res 339, 3146.
  • 21
    Yoneda A, Lendorf ME, Couchman JR & Multhaupt HA (2012) Breast and ovarian cancers: a survey and possible roles for the cell surface heparan sulfate proteoglycans. J Histochem Cytochem 60, 921.
  • 22
    Mitropoulou TN, Tzanakakis GN, Nikitovic D, Tsatsakis A & Karamanos NK (2002) In vitro effects of genistein on the synthesis and distribution of glycosaminoglycans/proteoglycans by estrogen receptor-positive and -negative human breast cancer epithelial cells. Anticancer Res 22, 28412846.
  • 23
    Mitropoulou TN, Theocharis AD, Nikitovic D, Karamanos NK & Tzanakakis GN (2004) IGF-I affects glycosaminoglycan/proteoglycan synthesis in breast cancer cells through tyrosine kinase-dependent and -independent pathways. Biochimie 86, 251259.
  • 24
    Song RX, Chen Y, Zhang Z, Bao Y, Yue W, Wang JP, Fan P & Santen RJ (2010) Estrogen utilization of IGF-1-R and EGF-R to signal in breast cancer cells. J Steroid Biochem Mol Biol 118, 219230.
  • 25
    McClelland RA, Barrow D, Madden TA, Dutkowski CM, Pamment J, Knowlden JM, Gee JM & Nicholson RI (2001) Enhanced epidermal growth factor receptor signaling in MCF7 breast cancer cells after long-term culture in the presence of the pure antiestrogen ICI 182,780 (Faslodex). Endocrinology 142, 27762788.
  • 26
    Kousidou O, Berdiaki A, Kletsas D, Zafiropoulos A, Theocharis AD, Tzanakakis GN & Karamanos NK (2008) Estradiol-estrogen receptor: a key interplay of the expression of syndecan-2 and metalloproteinase-9 in breast cancer cells. Mol Oncol 2, 223232.
  • 27
    Bartucci M, Morelli C, Mauro L, Ando S & Surmacz E (2001) Differential insulin-like growth factor I receptor signaling and function in estrogen receptor (ER)-positive MCF-7 and ER-negative MDA-MB-231 breast cancer cells. Cancer Res 61, 67476754.
  • 28
    Price JT, Tiganis T, Agarwal A, Djakiew D & Thompson EW (1999) Epidermal growth factor promotes MDA-MB-231 breast cancer cell migration through a phosphatidylinositol 3′-kinase and phospholipase C-dependent mechanism. Cancer Res 59, 54755478.
  • 29
    Tkachenko E, Rhodes JM & Simons M (2005) Syndecans: new kids on the signaling block. Circ Res 96, 488500.
  • 30
    Longley RL, Woods A, Fleetwood A, Cowling GJ, Gallagher JT & Couchman JR (1999) Control of morphology, cytoskeleton and migration by syndecan-4. J Cell Sci 112, 34213431.
  • 31
    Chalkiadaki G, Nikitovic D, Berdiaki A, Sifaki M, Krasagakis K, Katonis P, Karamanos NK & Tzanakakis GN (2009) Fibroblast growth factor-2 modulates melanoma adhesion and migration through a syndecan-4-dependent mechanism. Int J Biochem Cell Biol 41, 13231331.
  • 32
    Liu W, Litwack ED, Stanley MJ, Langford JK, Lander AD & Sanderson RD (1998) Heparan sulfate proteoglycans as adhesive and anti-invasive molecules. Syndecans and glypican have distinct functions. J Biol Chem 273, 2282522832.
  • 33
    Matsuda K, Maruyama H, Guo F, Kleeff J, Itakura J, Matsumoto Y, Lander AD & Korc M (2001) Glypican-1 is overexpressed in human breast cancer and modulates the mitogenic effects of multiple heparin-binding growth factors in breast cancer cells. Cancer Res 61, 55625569.
  • 34
    Militsopoulou M, Lamari F & Karamanos NK (2003) Capillary electrophoresis: a tool for studying interactions of glycans/proteoglycans with growth factors. J Pharm Biomed Anal 32, 823828.
  • 35
    Lim E, Metzger-Filho O & Winer EP (2012) The natural history of hormone receptor-positive breast cancer. Oncology 26 (688–694), 696.
  • 36
    Sui M, Zhang H & Fan W (2011) The role of estrogen and estrogen receptors in chemoresistance. Curr Med Chem 18, 46744683.
  • 37
    Cortez V, Mann M, Brann DW & Vadlamudi RK (2010) Extranuclear signaling by estrogen: role in breast cancer progression and metastasis. Minerva Ginecol 62, 573583.
  • 38
    Massarweh S & Schiff R (2006) Resistance to endocrine therapy in breast cancer: exploiting estrogen receptor/growth factor signaling crosstalk. Endocr Relat Cancer 13, S1524.
  • 39
    Yu L, Moore AB, Castro L, Gao X, Huynh HL, Klippel M, Flagler ND, Lu Y, Kissling GE & Dixon D (2012) Estrogen regulates MAPK-related genes through genomic and nongenomic interactions between IGF-I receptor tyrosine kinase and estrogen receptor-alpha signaling pathways in human uterine leiomyoma cells. J Signal Transduct, doi:10.1155/2012/204236.
  • 40
    Mendoza RA, Enriquez MI, Mejia SM, Moody EE & Thordarson G (2011) Interactions between IGF-I, estrogen receptor-alpha (ERalpha), and ERbeta in regulating growth/apoptosis of MCF-7 human breast cancer cells. J Endocrinol 208, 19.
  • 41
    Song RX, McPherson RA, Adam L, Bao Y, Shupnik M, Kumar R & Santen RJ (2002) Linkage of rapid estrogen action to MAPK activation by ERalpha-Shc association and Shc pathway activation. Mol Endocrinol 16, 116127.
  • 42
    Yarden RI, Wilson MA & Chrysogelos SA (2001) Estrogen suppression of EGFR expression in breast cancer cells: a possible mechanism to modulate growth. J Cell Biochem 36, 232246.
  • 43
    Santen RJ, Fan P, Zhang Z, Bao Y, Song RX & Yue W (2009) Estrogen signals via an extra-nuclear pathway involving IGF-1R and EGFR in tamoxifen-sensitive and -resistant breast cancer cells. Steroids 74, 586594.
  • 44
    Tkachenko E, Lutgens E, Stan RV & Simons M (2004) Fibroblast growth factor 2 endocytosis in endothelial cells proceed via syndecan-4-dependent activation of Rac1 and a Cdc42-dependent macropinocytic pathway. J Cell Sci 117, 31893199.
  • 45
    Han I, Park H & Oh ES (2004) New insights into syndecan-2 expression and tumourigenic activity in colon carcinoma cells. J Mol Histol 35, 319326.
  • 46
    Kleeff J, Wildi S, Kumbasar A, Friess H, Lander AD & Korc M (1999) Stable transfection of a glypican-1 antisense construct decreases tumorigenicity in PANC-1 pancreatic carcinoma cells. Pancreas 19, 281288.
  • 47
    Chakravarty D, Nair SS, Santhamma B, Nair BC, Wang L, Bandyopadhyay A, Agyin JK, Brann D, Sun LZ, Yeh IT et al. (2010) Extranuclear functions of ER impact invasive migration and metastasis by breast cancer cells. Cancer Res 70, 40924101.