SEARCH

SEARCH BY CITATION

Keywords:

  • apoptosis;
  • Candida albicans ;
  • Cap1p;
  • GLR1 ;
  • reactive oxygen species

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References
  9. Supporting Information

Candida albicans is the most common opportunistic fungal pathogen and its apoptosis is inducible by environmental stress. Based on our previous finding that transcription factor Cap1p was involved in baicalein-induced apoptosis, the present study aimed to further clarify the role of Cap1p in apoptosis by observing the impact of CAP1 deletion on cell fate. It was found that apoptotic stimulation with amphotericin B, acetic acid and hydrogen peroxide increased the number of apoptotic and necrotic cells, caspase activity and the accumulation of reactive oxygen species, whereas it decreased the mitochondrial membrane potential and intracellular ATP level in the cap1Δ/Δ mutant. The cell fate was, at least partly, caused by glutathione depletion and attenuation of the expression of the glutathione reductase gene in the cap1Δ/Δ mutant. Collectively, our data suggest that Cap1p participated in the apoptosis of C. albicans by regulating the expression of the glutathione reductase gene and glutathione content.


Abbreviations
AA

acetic acid

AMB

amphotericin B

GLR1

glutathione reductase gene

GSH

reduced glutathione

GSSG

glutathione disulfide

H2O2

hydrogen peroxide

JC-1

5,5′,6,6′-tetrachloro-1,1′,3,3′-tetraethylbenzimidazolcarbocyanine iodide

PI

propidium iodide

ROS

reactive oxygen species

SOD2

manganese superoxide dismutase gene

TRR1

thioredoxin reductase gene

TUNEL

terminal deoxynucleotidyltransferase-mediated dUTP-biotin nick end-labelling

Δψm

mitochondrial membrane potential

Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References
  9. Supporting Information

Candida albicans is the most common opportunistic fungal pathogen that causes a range of diseases from superficial infections to life-threatening systemic disorders [1-5]. Recently, apoptosis has been observed in C. albicans after exposure to environmental stresses, such as low doses of anti-fungal agent amphotericin B (AMB), acetic acid (AA) or hydrogen peroxide (H2O2) [6-8]. Uncovering the mechanistic basis of apoptosis may provide a new strategy of antifungal treatment.

Apoptosis is a complex progress involving many pathways and factors [7-22], including caspase [9-12], mitochondria [13-18], reactive oxygen species (ROS) [7, 8, 11-13, 19, 20] and reduced glutathione (GSH) [21-23]. In Saccharomyces cerevisiae, YCA1 encodes a metacaspase that is functionally similar to mammalian caspase [9, 10]. Upon apoptotic stimulation, metacaspase is activated, leading to the occurrence of apoptosis. A previous study found that H2O2-induced apoptosis in C. albicans was accompanied by the activation of CaMCA1, an orthologue of YCA1 [11]. Mitochondria may participate in apoptosis through several pathways [13-18]. Some studies have demonstrated that the mitochondrial membrane potential (Δψm) transitorily increased upon apoptotic stimulation in both mammalian cells and yeast, resulting in ROS accumulation, mitochondrial fragmentation and, ultimately, a decrease of Δψm in the subsequent apoptosis process [13-18]. With the decrease of Δψm, intracellular ATP decreased accordingly [13-18]. Mitochondria are the primary source of endogenous ROS, and ROS accumulation is considered to be a typical hallmark of apoptosis [13, 19, 20]. It has been reported that ROS accumulates in yeast cells in response to various apoptotic stimulations, which is necessary and sufficient to induce apoptosis [19, 20]. Apoptosis has also been reported to be associated with GSH depletion, which may cause oxidative stress of cells [21-23]. GSH plays a key role in protecting cells by detoxifying free radicals [24]. Glutathione reductase, encoded by the glutathione reductase gene (GLR1), can catalyse the reduction of glutathione disulfide (GSSG), resulting in the rapid provision of GSH [21-24].

A previous study [6] demonstrated that bZip transcription factor Cap1p was involved in baicalein-induced apoptosis. CAP1 was up-regulated by 24-fold after baicalein treatment, and CAP1 over-expression significantly increased the survival of C. albicans upon baicalein treatment. It is generally accepted that Cap1p plays a key role in the oxidative stress response of C. albicans [24-27] and that GLR1 is a regulation target of Cap1p [26-28]. However, the exact role of Cap1p in apoptosis remains unclear.

In the present study, we further investigated the role of Cap1p in apoptosis by using the wild-type (CAP1/CAP1) strain CAF2-1, cap1Δ/Δ mutant CJDADH and CAP1-reintegrated (cap1Δ/CAP1) strain CJDCAP1. The results obtained suggest that Cap1p participates in apoptosis by regulating GLR1 expression and glutathione content in C. albicans.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References
  9. Supporting Information

CAP1 deletion increases apoptosis upon apoptotic stimulation

To better understand the role of Cap1p in apoptosis, the differences in apoptosis upon apoptotic stimuli were compared between the CAP1/CAP1 wild-type strain CAF2-1, cap1Δ/Δ mutant strain CJDADH and cap1Δ/CAP1 reintegrated strain CJDCAP1. First, disruption of CAP1 in the cap1Δ/Δ mutant was confirmed by quantitative real-time RT-PCR. After treatment with 2 μg·mL−1 AMB for 3 h, a 3.9-fold increase in CAP1 expression was observed in the AMB-treated wild-type strain, and a 4.4-fold increase was observed in the cap1Δ/CAP1 reintegrated strain. By contrast, CAP1 expression was undetectable in the cap1Δ/Δ mutant (data not shown).

Given the different expressions of CAP1, the impact of apoptotic stimulation on the fate of the three strain cells was investigated further by determining (a) apoptotic cells using the terminal deoxynucleotidyltransferase-mediated dUTP-biotin nick end-labelling (TUNEL) assay and (b) necrotic cells using the propidium iodide (PI) uptake assay (Fig. 1). After AMB treatment, a larger proportion of apoptotic or necrotic cells was observed in the cap1Δ/Δ mutant (Fig. 1A). Similar results were observed with AA (Fig. 1B) and H2O2 (Fig. 1C) as the apoptotic stimuli, indicating that CAP1 deletion increased apoptosis in C. albicans.

image

Figure 1. The impact of CAP1 deletion on the fate of C. albicans cells after apoptotic stimulation. The number of live cells (white bars), apoptotic cells (grey bars) and necrotic cells (black bars), respectively, was assessed after apoptotic stimulus treatment for 3 h. (A) Cells treated with 2 μg·mL−1 AMB. (B) Cells treated with 60 mm AA. (C) Cells treated with 5 mm H2O2. Data are shown as the mean ± SD of three independent experiments.

Download figure to PowerPoint

CAP1 deletion increases caspase activity and induces a greater expression of MCA1 upon apoptotic stimulation

To determine whether Cap1p protected cells against apoptosis through regulating caspase pathways, the impact of CAP1 deletion on caspase activity was investigated by D2R staining and confocal laser microscopy. After 2 μg·mL−1 AMB treatment for 3 h, the percentage of CAP1/CAP1 cells stainable by D2R was 21.10% versus 43.47% for cap1Δ/Δ cells (P < 0.05) (Table S1). The reintegration of CAP1 restored D2R stainable cells to 20.94%. These results indicate that caspase activity was increased in cap1Δ/Δ mutant cells. Confocal laser microscopy also confirmed the above result, showing that there was a greater number of D2R staining positive cells from the cap1Δ/Δ mutant than from CAP1/CAP1 or cap1Δ/CAP1 cells after the same treatment (Fig. S1).

Similar results were obtained with 60 mm AA and 5 mm H2O2 as the apoptotic stimuli (Table S1). After 60 mm AA treatment for 3 h, the percentage of D2R stainable cells in the wild-type strain was 33.35% versus 57.04% in the cap1Δ/Δ mutant (P < 0.05) (Table S1). After 5 mm H2O2 treatment for 3 h, the percentage of D2R stainable cells in wild-type strain was 27.61% versus 61.96% in the cap1Δ/Δ mutant (P < 0.05) (Table S1). After treatment with 60 mm AA and 5 mm H2O2, the reintegration of CAP1 restored D2R stainable cells to 30.62% and 26.48%, respectively. These results indicate that CAP1 deletion increased caspase activity in the cap1Δ/Δ mutant.

We further investigated the expression of MCA1, a gene that encodes a metacaspase, by real-time RT-PCR. Increased expression of MCA1 was observed in all three strains (CAP1/CAP1, cap1Δ/Δ and cap1Δ/CAP1) after AMB treatment. Notably, a 4.6-fold increase was observed in the cap1Δ/Δ mutant versus a 1.8-fold increase in CAP1/CAP1 and a 2.1-fold increase in cap1Δ/CAP1. The results indicate that MCA1 was up-regulated to a greater extent in the cap1Δ/Δ mutant upon apoptotic stimulation.

CAP1 deletion decreases Δψm and intracellular ATP

Because mitochondria play an important role in apoptosis [13-18], we further tested Δψm using the fluorescent reagent 5,5′,6,6′-tetrachloro-1,1′,3,3′-tetraethylbenzimidazolcarbocyanine iodide (JC-1). After 2 μg·mL−1 AMB treatment for 3 h, the Δψm decreased in all three strains tested. The Δψm of the cap1Δ/Δ mutant decreased more significantly compared to the wild-type strain after AMB treatment (P < 0.05) (Fig. 2A) and no significant difference was observed between the wild-type strain and the cap1Δ/CAP1.

image

Figure 2. Mitochondrial membrane potential Δψm (A) and intracellular ATP concentration (B) in C. albicans after apoptotic stimulation. The wild-type strain (CAP1/CAP1), cap1Δ/Δ mutant and CAP1-reintegrated strain (cap1Δ/CAP1) were exposed to 2 μg·mL−1 AMB for 3 h, and the mitochondrial Δψm and intracellular ATP concentration were determined. Data are shown as the mean ± SD of three independent experiments. *P < 0.05 compared to the wild-type strain (CAP1/CAP1) with the same treatment.

Download figure to PowerPoint

Additionally, we measured the intracellular ATP concentration. The intracellular ATP concentration decreased in all three strains tested after 2 μg·mL−1 AMB treatment for 3 h, which is consistent with the results for Δψm. After AMB treatment, ATP in the cap1Δ/Δ mutant decreased more significantly compared to the wild-type strain (P < 0.05) (Fig. 2B) and no significant difference was observed between the wild-type strain and the cap1Δ/CAP1 after the same treatment.

CAP1 deletion increases ROS accumulation upon apoptotic stimulation

Knowing that ROS is a typical hallmark of apoptosis, we further investigated the impact of CAP1 deletion on ROS content. Confocal laser microscopy showed that the fluorescence signal indicating intracellular ROS was obviously strong in the cap1Δ/Δ mutant after 2 μg·mL−1 AMB treatment for 3 h, whereas it was relatively weak in the wild-type strain and CAP1-reintegrated strain (Fig. S2). These results were confirmed by quantitative measurement of ROS production. CAP1 deletion increased ROS accumulation after 2 μg·mL−1 AMB treatment (Fig. 3A). Similar results were obtained by using 60 mm AA (Fig. 3B) or 5 mm H2O2 (Fig. 3C) as the apoptotic stimuli. These results indicate that CAP1 deletion increased ROS accumulation upon various apoptotic stimuli, including AMB, AA and H2O2 treatment.

image

Figure 3. Intracellular ROS accumulation after apoptotic stimulation. Cells were exposed to apoptotic stimuli for 3 h, and intracellular ROS was detected by using DCFH-DA. (A) Quantitative assay of ROS accumulation after 2 μg·mL−1 AMB treatment. (B) Quantitative assay of ROS accumulation after 60 mm AA treatment. (C) Quantitative assay of ROS accumulation after 5 mm H2O2 treatment. Data shown are the mean ± SD of three independent experiments, and repeated analysis of variance was performed to determine the statistical significance. CAP1/CAP1, white square; cap1/cap1 mutant, white triangle; cap1/CAP1, black square.

Download figure to PowerPoint

CAP1 deletion decreases GSH content and GLR1 expression

Given the role of GSH in decreasing ROS and the association between GSH depletion and apoptosis, we further investigated the impact of CAP1 deletion on intracellular GSH content. The results indicate that CAP1 deletion decreased GSH content upon apoptotic stimulation (Fig. 4). In detail, the GSH content was stable in the CAP1/CAP1 wild-type strain and the cap1Δ/CAP1 reintegrated strain after 2 μg·mL−1 AMB treatment for 3 h (Fig. 4). By contrast, GSH in the cap1Δ/Δ mutant decreased after AMB treatment (Fig. 4). After 2 μg·mL−1 AMB treatment for 3 h, GSH in the cap1Δ/Δ mutant decreased to 16% of the original content. Collectively, intracellular GSH was decreased in the cap1Δ/Δ mutant compared to that in the CAP1/CAP1 wild-type strain upon the same apoptotic stimulation, which is in accordance with the above result for ROS accumulation and the increased susceptibility of the cap1Δ/Δ mutant to apoptotic stimulation.

image

Figure 4. The impact of CAP1 deletion on intracellular glutathione level after apoptotic stimulation. Cells were exposed to 2 μg·mL−1 AMB for 3 h, and intracellular glutathione was determined. Data are shown as the mean ± SD of three independent experiments, and repeated analysis of variance was performed to determine the statistical significance. CAP1/CAP1, white square; cap1/cap1 mutant, white triangle; cap1/CAP1, black square.

Download figure to PowerPoint

Because GLR1 encodes glutathione reductase and function with respect to reducing GSSG to produce GSH, we further tested the impact of CAP1 deletion on GLR1 expression upon apoptotic stimulation by real-time RT-PCR. After treatment with 2 μg·mL−1 AMB for 3 h, a 6.7-fold increase in GLR1 expression was observed in the CAP1/CAP1 wild-type strain and a 7.0-fold increase was observed in the cap1Δ/CAP1 strain. By contrast, no change in GLR1 expression was observed in the cap1Δ/Δ mutant (Fig. 5). We also tested the impact of CAP1 deletion on the expression of the other two genes functioning in the antioxidant system, TRR1 (thioredoxin reductase gene) [29-32] and SOD2 (manganese superoxide dismutase gene) [33, 34]. Interestingly, no significant change was observed after AMB treatment in all three strains tested, and there was no significant change between the strains. Taken together, our results indicate that the cap1Δ/Δ mutant was defective with respect to activating GLR1 expression upon apoptotic stimulation.

image

Figure 5. Real-time RT-PCR analysis of gene expression. C. albicans cells in the apoptotic stimulation group were treated with 2 μg·mL−1 AMB for 3 h. Gene expression is indicated as the fold change relative to that of the control group without AMB treatment. Data are shown as the mean ± SD of three independent experiments.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References
  9. Supporting Information

Our previous study [6] showed that Cap1p was involved in baicalein-induced apoptosis. To better understand the role of Cap1p in apoptosis, we studied the impact of CAP1 deletion on apoptosis and revealed that the cap1Δ/Δ mutant trended to develop more apoptotic cells and more necrotic cells, as well as a lower survival, compared to the wild-type cells upon apoptotic stimulation. In addition, caspase activity was increased, mitochondrial Δψm and intracellular ATP were decreased, and more ROS was accumulated in the cap1Δ/Δ mutant compared to the wild-type strain upon the same apoptotic stimulation. Interestingly, the GSH content and GLR1 expression decreased in the cap1Δ/Δ mutant, which is in accordance with more ROS accumulation and increased apoptosis. Knowing that GLR1 encodes glutathione reductase and is regarded as the target of Cap1p, our data suggest that Cap1p was, at least partly, involved in apoptosis through regulating GLR1 expression and intracellular redox homeostasis in C. albicans.

Similar to Yap1p in S. cerevisiae, Cap1p belongs to the AP-1 family of transcriptional activators [25-28]. Various AP-1 components have been shown to be involved in a variety of biological processes, including apoptosis [35-42]. It has been demonstrated that the AP-1 component had both pro-apoptotic and anti-apoptotic effects depending on the cell type and apoptotic stimulation [36]. Over-expression of the AP-1 protein component c-Jun was sufficient to induce apoptosis in sympathetic neurones [40]. However, Ebi/AP-1 suppressed pro-apoptotic gene expression and permitted the long-term survival of Drosophila sensory neurones [41]. In our previous study [6], Cap1p was shown to be involved in baicalein-induced apoptosis in C. albicans. Consistently, Sharma et al. [43] observed that Cap1p was involved in the curcumin-induced apoptosis of C. albicans. In the present study, we demonstrated that both apoptosis and caspase activity were increased in the cap1Δ/Δ mutant upon apoptotic stimulation, which further confirmed that Cap1p could attenuate apoptosis of C. albicans cells.

The present study showed that the increased apoptosis of the cap1Δ/Δ mutant was linked to the increased caspase activity. Caspase activation has been recognized as the most important process associated with apoptosis in mammalian cells [44]. Activation of the initiator caspases further activated a second group of caspases upon apoptotic stimulation, leading to apoptosis [44-46]. In the present study, we further confirmed that increased apoptosis was linked to increased caspase activity.

Decreased Δψm and less intracellular ATP were observed in the cap1Δ/Δ mutant upon apoptotic stimulation in the present study, which is consistent with the role of mitochondria in apoptosis [13-18]. Mitochondria are confirmed to be implicated in the apoptosis process of S. cerevisiae [14, 47-49]. Apoptotic stimulation from AA, H2O2, amiodarone and hyperosmotic stress stimulated mitochondrial respiration, promoted ROS production, and initiated mitochondrial fragmentation. These changes may ultimately contribute to caspase activation and apoptosis [13-18, 47-49]. With the fragmentation of mitochondria, both Δψm and intracellular ATP decreased [13-18, 47-49]. Recent evidence has demonstrated that mitochondria-mediated apoptotic cell death also exists in C. albicans [50, 51]. Medioresinol could lead to intracellular ROS accumulation and mitochondria-mediated apoptotic cell death in C. albicans [50]. Silver nanoparticles play an antifungal role by initiating mitochondrial dysfunctional apoptosis in C. albicans [51]. Similarly, our previous study [6] found that baicalein induced C. albicans apoptosis with the breakdown of Δψm. The association between mitochondria and apoptosis has been confirmed in the present study. Our data suggest that the increased apoptosis in the cap1Δ/Δ mutant may be associated with the mitochondrial apoptotic pathway.

More ROS accumulation occurred in the cap1Δ/Δ mutant upon apoptotic stimulation, which is consistent with previous studies [7, 8, 11-13, 19, 20, 52-54] demonstrating that ROS accumulation occurred in both mammalian and yeast cells after various apoptotic stimuli and was essential for almost all apoptotic pathways. Some apoptotic pathways involve ROS upstream of caspases in metazoans [20]. In addition, ROS damaged many cellular components that may act as primary triggers of apoptosis [7, 8, 11-13, 19, 20]. The association between ROS accumulation and apoptosis has been confirmed in the present study.

GSH is a known to function with respect to protecting cells against ROS attacks through decreasing free radicals [24, 55, 56]. GSH depletion is reported to be associated with apoptosis, which may be related to redox status alteration and intracellular oxidative stress [21-24]. Interestingly, GSH depletion is also reported to be involved in farnesol-induced apoptosis in C. albicans. Farnesol conjugates with intracellular GSH and the conjugates were pumped out of C. albicans cells through Cdr1p transporters, resulting in GSH depletion, oxidative stress and, ultimately, fungal cell death [22]. In the present study, GSH depletion was also observed in the cap1Δ/Δ mutant upon apoptotic stimulation, which further confirmed the association between GSH depletion and apoptosis.

The data obtained in the present study suggest that Cap1p was involved in apoptosis of C. albicans through up-regulating GLR1 expression and GSH content. Upon apoptotic stimulation, GLR1 was up-regulated in the CAP1/CAP1 wild-type strain, and the GSH content was stable even upon apoptotic stimulation. By contrast, GLR1 was defective with respect to activation in the cap1Δ/Δ mutant upon the same apoptotic stimulation, which is in accordance with the finding that GLR1 is the regulation target of Cap1p in C. albicans [26-28]. In addition, the GSH content decreased and tended to deplete in the cap1Δ/Δ mutant upon apoptotic stimulation. Knowing that glutathione reductase is encoded by GLR1 and catalyses the reduction of GSSG to produce GSH [21-24], it could be inferred that, upon apoptotic stimulation in the cap1Δ/Δ mutant, GLR1 is defective with respect to activation and GSSG cannot be reduced rapidly to provide GSH. Collectively, our data suggest that Cap1p attenuates the apoptosis of C. albicans cells through up-regulating GLR1 expression and increasing GSH content (Fig. 6).

image

Figure 6. A model for the role of CAP1 in regulating apoptosis in C. albicans. Upon apoptotic stimulation, CAP1 was activated and GLR1 expression was up-regulated. Up-regulation of GLR1 increased the GSH content. Increased GSH decreased ROS accumulation and, ultimately, decreased apoptosis.

Download figure to PowerPoint

In summary, we have demonstrated that Cap1p could attenuate apoptosis upon apoptotic stimuli by up-regulating GLR1 expression, increasing GSH content, decreasing ROS accumulation, protecting mitochondria and inhibiting caspase activation in C. albicans. These findings may provide new insights into the relationship between redox homeostasis and the apoptosis of C. albicans.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References
  9. Supporting Information

Strains and growth conditions

The C. albicans strains used in the present study are listed in Table 1 [57, 58]. All strains were stored as frozen stocks with 30% glycerol at −80 °C and subcultured on YPD agar plates (1% yeast extract, 2% peptone and 2% dextrose) at 30 °C. Strains were routinely grown in YPD liquid medium at 30 °C in a shaking incubator. Exponentially growing C. albicans cells were used for experiments. For AMB, AA or H2O2 treatment, C. albicans cells were harvested and resuspended in YPD containing AMB, AA or H2O2.

Table 1. C. albicans strains used in the present study
StrainParental strainGenotypeReference
CAF2-1SC5314 ura3Δ::imm434/URA3 [57]
CJDADHCJD21 cap1Δ::hisG/cap1Δ::hisG/URA3 [58]
CJDCAP1CJD21 cap1Δ::hisG/cap1Δ::hisG/CAP1-URA3 [58]

Drugs

AMB, AA and H2O2 were purchased from Sigma-Aldrich (St Louis, MO, USA).

Quantitative real-time RT-PCR

Real-time RT-PCR was used to investigate gene expression. RNA isolation, cDNA synthesis and real-time RT-PCR amplification were performed as described previously [6, 59]. Exponentially growing C. albicans cells were treated with 2 μg·mL−1 AMB (or solvent as the control) for 3 h for RNA isolation. First-strand cDNAs were synthesized from 3 μg of total RNA in a 60-μL reaction volume using the cDNA synthesis kit for RT-PCR (TaKaRa Biotechnology, Dalian, China) in accordance with the manufacturer's instructions. Gene-specific primers were designed in accordance with the manufacturer's protocol. The primers used are shown in Table 2. Triplicate independent quantitative real-time PCRs were performed using the Chromo 4 Real-Time PCR System (Bio-Rad, Hercules, CA, USA). SYBR Green I (TaKaRa Biotechnology) was used to visualize and monitor the amplified product in real time. The CΤ value of 18S rRNA was subtracted from that of the gene of interest to obtain a ΔCΤ value. The ΔCΤ value of an arbitrary calibrator (e.g. an untreated control group) was subtracted from the ΔCΤ value for each sample to obtain a ΔΔCΤ value. The gene expression level relative to the calibrator was expressed as inline image. Three independent experiments were carried out to obtain a mean value.

Table 2. The sequences of the primers used in the present study. F, forward primer; R, reverse primer
Primer nameSequence (5′- to 3′)Amplicon size (bp)
CAP1-F ACCGTGAACGTAAAGAACG 152
CAP1-R GCTACCACCAGTATATTTAGCC
MCA1-F TATAATAGACCTTCTGGAC 118
MCA1-R TTGGTGGACGAGAATAATG
GLR1-F GCTCATCTAAGTCATTGTGACC 174
GLR1-R GCTGGACCAGAAGAAAAAGTTG
TRR1-F ACATTCCAAGGCAGCCATAC 149
TRR1-R AGACCGACGAAGCTGGTTAC
SOD2-F CAGCACTATCGGAAGTAACTC 120
SOD2-R GGCATGTTATCATACTGGAAGG
18S-F TCTTTCTTGATTTTGTGGGTGG 150
18S-R TCGATAGTCCCTCTAAGAAGTG

Apoptosis and necrosis assays

Apoptosis and necrosis assays were performed as described previously [7, 8, 59]. C. albicans cells were grown to the exponential phase in YPD and then treated with different apoptotic stimuli for 3 h. To investigate the occurrence of apoptosis, a TUNEL assay using the In Situ Cell Death Detection Kit (Roche Applied Sciences, Mannheim, Germany) was performed [7, 8, 59]. Briefly, C. albicans cells were washed twice in NaCl/Pi, fixed with 3.6% paraformaldehyde, and then stored at 4 °C until required. To determine the apoptosis, cells were treated in accordance with the manufacturer's instructions, as described previously [7, 8, 59]. The number of cells determined to be positive by the TUNEL assay was quantified using a BD FACSCalibur flow cytometer (Becton-Dickinson Biosciences, Franklin Lakes, NJ, USA) with excitation and emission wavelength settings at 488 nm and 520 nm, respectively. Necrosis was assessed by detecting the PI uptake of C. albicans cells because PI stains necrotic cells specifically, as demonstrated previously [7, 8, 59]. PI was used at a concentration of 20 μg·mL−1.

Caspase activity determination

To determine the caspase activity, D2R staining was detected using the CaspSCREEN Flow Cytometric Apoptosis Detection Kit (BioVision, Mountain View, CA, USA) in accordance with the manufacturer's instructions [59, 60]. The samples were analyzed by flow cytometry with excitation at 488 nm and emission at 530 nm.

Measurement of Δψm

To measure the Δψm, fluorescent dye JC-1 (Molecular Probes, Inc., Eugene, OR, USA) was used as described previously [6]. Briefly, C. albicans cells were grown to the exponential phase, adjusted to 2 × 107 cells·mL−1 in NaCl/Pi, exposed to apoptotic stimuli and incubated at 30 °C with constant shaking (200 r.p.m.). Cell samples were harvested by centrifugation (900 g for 5 min) and treated with 10 μg·mL−1 JC-1 at 30 °C for 15 min in the dark and washed twice with NaCl/Pi. The samples were analyzed with a POLARstar Galaxy (BMG, Labtech, Offenburg, Germany) at an excitation wavelength of 485 nm and an emission wavelength shifting from green (~ 530 nm) to red (~ 590 nm). The Δψm was determined by the ratio of red to green fluorescence. Each experiment was performed in triplicate.

Measurement of intracellular ATP level

The intracellular ATP level was measured using a BacTiter-Glo system (Promega Corp., Madison, WI, USA) as described previously [11]. Briefly, C. albicans cells were grown to the exponential phase, adjusted to 2 × 107 cells·mL−1 in NaCl/Pi, exposed to apoptotic stimuli and incubated at 30 °C with constant shaking (200 r.p.m.). Cell samples were treated in accordamce with the manufacturer's instructions. The luminescent signals were determined on a TD 20/20 luminometer (Turner Biosystem, Sunnyvale, CA, USA). The control tube without cells was used to obtain a value for background luminescence. A standard curve for ATP increments (from 100 nm to 10 pm) was constructed. Signals represented the mean of three experiments, and the ATP content was calculated from the standard curve.

Measurement of ROS

To measure the intracellular levels of ROS, fluorescent dye DCFH-DA (Molecular Probes, Inc.) was used as described previously [6, 59]. In brief, C. albicans cells were collected, washed three times with NaCl/Pi, and then adjusted to 2 × 107 cells·mL−1. After incubation with 20 μg·mL−1 DCFH-DA for 30 min at 30 °C, the cells were exposed to apoptotic stimuli and incubated at 30 °C with constant shaking (200 r.p.m.). At specified intervals, cell samples were observed with a Leica TCS sp2 confocal scanning laser microscope (Leica Microsystems, Wetzlar, Germany) with excitation at 485 nm and emission at 520 nm. Alternatively, a 1-mL cell suspension was harvested and 100 μL of supernatant was transferred to the wells of a flat-bottom microplate (BMG Microplate, 96-well, Blank; BMG Labtech, Offenburg, Germany) to detect fluorescence intensities on a POLARstar Galaxy reader (BMG Labtech) with excitation at 485 nm and emission at 520 nm. Three independent experiments were performed.

Colorimetric determination of GSH

Exponentially growing C. albicans cells were treated with 2 μg·mL−1 AMB for 3 h, collected by centrifugation (9000 g for 1 min at 4 °C), washed once with NaCl/Pi, and then resuspended in the buffer in accordance with the manufacturer's instructions. GSH was determined with the GSH and GSSG Assay Kit (Beyotime, Jiangsu, China) [29]. Colorimetric determination was conducted using a Multiskan MK30 microplate reader (Labsystems, Finland). Triplicate independent experiments were conducted.

Statistical analysis

All experiments were performed in triplicate and at least three independent experiments were carried out. Data are presented as the mean ± SD. Analysis of variance was used to determine statistical significance at P < 0.05.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References
  9. Supporting Information

We thank William A. Fonzi for kindly providing C. albicans strain CAF2-1 and Martine Raymond for kindly providing C. albicans strain CJD21. This work was supported by the National Key Basic Research Program of China (2013CB531602); the National Natural Science Foundation of China (81072678, 81273558 and 30825041); Shanghai Educational Development Foundation (2007CG51); and the Postdoctoral Science Foundation of China (20110491851).

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References
  9. Supporting Information

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References
  9. Supporting Information
FilenameFormatSizeDescription
febs12251-sup-0001-FigS1-S2-TableS1.zipZip archive567K

Fig. S1. Representative confocal scanning laser fluorescence images of CAP1/CAP1, cap1Δ/Δ and cap1Δ/CAP1 cells stained for caspase activity following exposure to 2 μg·mL−1 AMB for 3 h.

Fig. S2. Representative confocal scanning laser fluorescence images of CAP1/CAP1, cap1Δ/Δ and cap1Δ/CAP1 cells stained for ROS accumulation after 2 μg·mL−1 AMB treatment.

Table S1. Caspase activity of C. albicans cells upon apoptotic stimuli.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.