SEARCH

SEARCH BY CITATION

Keywords:

  • adipogenesis;
  • C3H10T1/2;
  • commitment;
  • Gdf6;
  • Runx1t1

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Mesenchymal stem cells have the potential to undergo commitment and differentiation into a variety of cell types, including osteoblasts, chondrocytes, myocytes and adipocytes. Growth differentiation factor 6 (Gdf6) is a member of the transforming growth factor β superfamily. We have examined the potential role of Gdf6 in adipogenesis of mesenchymal stem cells, and found that over-expression of Gdf6 induced commitment of pluripotent mesenchymal C3H10T1/2 cells to the adipocyte lineage. The type I receptor Bmpr1a and the type II receptors Bmpr2 and Acvr2a mediate the Gdf6 signaling pathway. RNAi silencing of Smad4 and p38 MAPK suggested that both Smad and p38 MAPK pathways are involved in this process. The expression of Runx1t1 was down-regulated in committed pre-adipocytes, and forced expression of Runx1t1 blocked the adipocytic commitment. The results demonstrate a role for Gdf6 in adipocytic commitment and differentiation.


Abbreviations
422/aP2

fatty acid-binding protein

BMP4

bone morphogenetic protein 4

Gdf6

growth differentiation factor 6

MAPK

mitogen-activated protein kinase

MSC

mesenchymal stem cell

PPARγ

peroxisome proliferator-activated receptor γ

Pref-1

pre-adipocyte factor 1

Runx1t1

runt-related transcription factor 1

Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Obesity results from caloric intake persistently exceeding energy expenditure, leading to adipocyte hypertrophy and hyperplasia due to recruitment of stem cells and subsequent differentiation of stromal-vascular pre-adipocytes [1]. Mesenchymal stem cells (MSCs) are multipotent stem cells that can differentiate into many cell types, including osteoblasts, chondrocytes, myocytes and adipocytes [2, 3]. The developmental pathway that gives rise to mature adipocytes involves two distinct stages: commitment and terminal differentiation [4]. Extracellular signaling factors are key in regulating MSC commitment to the adipocyte lineage. The C3H10T1/2 mesenchymal cell line derived from C3H mouse embryos [5] has characteristics that make it suitable for studying MSC commitment and differentiation.

Bone morphogenetic proteins (BMPs) play important roles in stem cell biology, regulating cell proliferation and differentiation during development [6, 7]. BMPs bind to two distinct type II and type I serine/threonine kinase receptors, mediatig their signals through Smad-dependent and Smad-independent pathways [8, 9]. Seven type I receptors and four type II receptors have been identified in mice and humans [8, 9]. Notably, BMP4 treatment of C3H10T1/2 cells induces almost complete commitment to the adipocyte lineage [10, 11], and both BMP/Smad and BMP/p38 MAPK (mitogen-activated protein kinase) pathways are involved in the transcriptional activation of the target genes in the commitment process [12].

Growth differentiation factor 6 (Gdf6), also known as BMP13, is another member of the BMP family of secreted signaling molecules [13]. Its expression occurs in many mesenchymal derivatives, such as tendon and cartilage, and to a lesser degree in intestine, skeletal muscle and placenta [14]. This factor may induce formation of tendon- and ligament-like tissues when expressed ectopically in rodent models and may enhance tendon repair [15], and may inhibit osteogenic differentiation of human bone marrow multipotent MSCs [16]. However, its role in adipogenic commitment and differentiation of MSCs remains to be investigated.

Runx1t1 (runt-related transcription factor 1), also known as eight twenty one protein, was first described due to its involvement in a chromosomal translocation that causes the t(8;21) form of acute myeloid leukemia [17-19]. Runx1t1 is expressed in a number of normal human tissues, including brain, heart, skeletal muscle and adipose tissue [20]. Runx1t1 is also an inhibitor of terminal differentiation in 3T3–L1 pre-adipocytes [21, 22], but its role in the commitment process from pluripotent mesenchymal cells to pre-adipocytes is unclear.

We report that Gdf6 signals through the type I receptor Bmpr1a and the type II receptors Bmpr2 and Acvr2a, which activates Smad and p38 MAPK pathways in pluripotent mesenchymal C3H10T1/2 cells and induces their commitment to the adipocyte lineage. Down-regulation of Runx1t1 is required for the adipocyte lineage commitment process.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Over-expression of Gdf6 promotes commitment of C3H10T1/2 cells to the adipocyte lineage

To explore the role of Gdf6 in adipocyte lineage commitment of MSCs, stable C3H10T1/2 cells expressing Gdf6 were established using a retroviral system (MSCV, murine stem cell virus). Expression of Gdf6 protein was significantly increased in Gdf6 over-expressing cells compared with control cells (Fig. 1A). Pre-adipocyte factor 1 (Pref–1), a pre-adipocyte marker protein [23], was induced by Gdf6 and BMP4 (Fig. 1A). After reaching post-confluence, the cells were subjected to a standard adipocyte differentiation protocol (MDI). C3H10T1/2 cells over-expressing Gdf6 acquired a mature adipocyte phenotype seen as an increased accumulation of cytoplasmic triglyceride by Oil Red O staining (Fig. 1B) and the adipocyte-specific marker proteins peroxisome proliferator-activated receptor γ (PPARγ) and the fatty acid-binding protein 422/aP2 (Fig. 1C), thereby indicating that Gdf6 promotes adipocyte lineage commitment of C3H10T1/2 cells.

image

Figure 1. Over-expression of Gdf6 activates Smad and p38 MPAK signaling pathways to induce commitment of C3H10T1/2 cells to the adipocyte lineage. C3H10T1/2 cells were infected with retrovirus harboring Gdf6 or empty vector, cultured with or without BMP4 until post-confluence, and subjected to the adipocyte differentiation protocol (MDI). (A) Western blot analysis at post-confluence using the antibodies indicated, with β–actin as a loading control. The effect of Gdf6 over-expression on adipocytic commitment and subsequent differentiation was assessed by Oil Red O staining (B) and 422/aP2 and PPARγ expression (C). C3H10T1/2 cells infected with retrovirus Gdf6 were plated at 30% confluence, and transfected with Smad4 or p38 MAPK stealth RNAi™siRNA. Knock-down of expression of Smad4 or p38 MAPK was confirmed by Western blotting (D). After reaching post-confluence, the cells were induced to differentiate (MDI). The effect on the adipocyte lineage commitment and subsequent differentiation was assessed at day 6 by Oil Red O staining (E) and 422/aP2 and PPARγ expression (F). The blots are representative of at least three independent experiments with identical results.

Download figure to PowerPoint

Smad and p38 MAPK pathways are required for Gdf6-induced adipocytic commitment of C3H10T1/2 cells

BMPs signal through Smad pathways and non-Smad pathways, such as MAPKs, including p38 MAPK, extracellular signal-regulated protein kinase and c–Jun N–terminal kinase [25]. We found previously that both Smad and p38 MAPK pathways are involved in BMP2/4 induction of the adipocytic commitment of MSCs [12]. Over-expressing Gdf6 induced phosphorylation/activation of Smad1/5/8 and p38 MAPK (Fig. 1A). To assess their roles in Gdf6-induced adipocytic commitment, Smad4 and p38 MAPK expression was knocked down in Gdf6-expressing cells by RNAi (Fig. 1D). At post-cofluence, the cells were induced by a standard MDI protocol. Smad4 RNAi blocked commitment/differentiation into adipocytes, whereas p38 MAPK RNAi partially disrupted cytoplasmic triglyceride accumulation and expression of PPARγ and 422/aP2 (Fig. 1E,F). The data suggest that both Smad and p38 MAPK pathways are required for Gdf6-induced adipocytic commitment of pluripotent mesenchymal C3H10T1/2 cells, and that the Smad pathway plays a dominant role in this process.

Gdf6 uses the type I receptor Bmpr1a to activate the Smad and p38 MAPK pathways

BMPs bind to two distinct type II and type I serine/threonine kinase receptors. To determine which of these receptors initiates Gdf6 signaling, their expression in C3H10T1/2 cells was assessed by RT–PCR. C3H10T1/2 cells expressed the type I receptor Bmpr1a and the type II receptors Bmpr2 and Acvr2a (Fig. 2A). Bmpr2 expression was higher than Acvr2a expression, whereas Bmpr1b and Acvr2b were not detected. To assess the involvement of endogenous Bmpr1a in Gdf6 signaling, its expression was knocked down in Gdf6-expressing C3H10T1/2 cells with RNAi (Fig. 2B), which resulted in reduced phosphorylation/activation of Smad1/5/8 and p38 MAPK induced by Gdf6 (Fig. 2C). It also prevented commitment and terminal adipocyte differentiation, as indicated by the accumulation of cytoplasmic triglycerides and expression of PPARγ and 422/aP2 (Fig. 2D,E).

image

Figure 2. Gdf6 uses the type I receptor Bmpr1a to activate Smad and p38 MAPK pathways. (A) C3H10T1/2 cells were cultured in Dulbecco's modified Eagle's medium with 10% fetal bovine serum. Total RNA was isolated and subjected to RT–PCR. (B) C3H10T1/2 cells infected with retrovirus Gdf6 were plated at 30% confluence and transfected with Bmpr1a Stealth RNAi™siRNA. Knockdown of expression of Bmpr1a was confirmed by RT–PCR, and 18S rRNA used as a loading control. (C) Western blot analysis of the cells at post-confluence was performed using the antibodies indicated, with β–actin as a loading control. After reaching post-confluence, the cells were induced to differentiate using the MDI protocol. The effect of Bmpr1a knockdown on the adipocyte lineage commitment and subsequent differentiation was assessed at day 6 by Oil Red O staining (D) and 422/aP2 and PPARγ expression (E). The blots are representative of at least three independent experiments with identical results.

Download figure to PowerPoint

Gdf6 uses the type II receptors Bmpr2 and Acvr2a to activate the Smad and p38 MAPK pathways

To examine in more detail the involvement of endogenous Bmpr2 and Acvr2a in Gdf6 signaling, their expression was suppressed by RNAi (Fig. 3A). Knockdown of Bmpr2 strongly suppressed phosphorylation/activation of Smad1/5/8 and p38 MAPK, whereas knockdown of Acvr2a partially prevented phosphorylation/activation of Smad1/5/8 and p38 MAPK (Fig. 3B). After inducing differentiation to adipocytes by MDI, Bmpr2 RNAi almost completely blocked commitment and differentiation of C3H10T1/2 into adipocytes, but knockdown of Acvr2a expression only partially reduced cytoplasmic triglyceride accumulation (Fig. 3C) and expression of PPARγ and 422/aP2 (Fig. 3D). These findings suggest a major role for endogenous Bmpr2 in Gdf6 signaling in pluripotent mesenchymal C3H10T1/2 cells during adipocytic commitment.

image

Figure 3. Gdf6 uses the type II receptors Bmpr2 and Acvr2a to activate Smad and p38 MAPK pathways. C3H10T1/2 cells infected with retrovirus Gdf6 were plated at 30% confluence and transfected with Bmpr2 and/or Acvr2a Stealth RNAi™siRNA. (A) Knockdown of expression of Bmpr2 and/or Acvr2a was confirmed by RT–PCR, with 18S rRNA used as a loading control. (B) Western blot analysis of the cells at post-confluence was performed using the antibodies indicated, with β–actin as a loading control. After reaching post-confluence, the cells were induced to differentiate using the MDI protocol. The effects of Bmpr2 and/or Acvr2a knockdown on the adipocyte lineage commitment and subsequent differentiation were assessed at day 6 by Oil Red O staining (C) and 422/aP2 and PPARγ expression (D). The blots are representative of at least three independent experiments with identical results.

Download figure to PowerPoint

Down-regulation of Runx1t1 is required for adipocytic commitment of C3H10T1/2 cells

Runx1t1 inhibits brown fat adipogenesis [26], and is an inhibitor of CCAAT enhancer binding protein β and adipocyte terminal differentiation in 3T3–L1 pre-adipocytes [21, 22]. To assess its role in adipocytic commitment of pluripotent mesenchymal C3H10T1/2 cells, Runx1t1 expression was assessed. Quantitative RT–PCR analysis showed that Runx1t1 mRNA decreased in Gdf6-expressing cells and BMP4-treated cells (Fig. 4A), and, consistent with this, Runx1t1 protein was decreased by Gdf6 and BMP4 (Fig. 4B).

image

Figure 4. Down-regulation of Runx1t1 is required for Gdf6-induced adipocytic commitment of C3H10T1/2 cells. (A) C3H10T1/2 cells were infected with retrovirus harboring Gdf6 or empty vector, and cultured with or without BMP4 until post-confluence, at which time total RNA was isolated. Real-time quantitative PCR analysis of Runx1t1 was performed. Values are means ± SD of at least three independent experiments. Asterisks indicate a statistically significant difference compared with the control group (MSCV) (< 0.05). (B) Western blot analysis of the cells at post-confluence was performed using the antibodies indicated, with β–actin being used as a loading control. (C) C3H10T1/2 cells were co-infected with retrovirus harboring Gdf6 or empty vector and retrovirus harboring Runx1t1 or empty vector, and cultured until post-confluence. Western blot analysis at post-confluence was performed using the antibodies indicated, with β–actin acting as a loading control. After reaching post-confluence, the cells were induced to differentiate using the MDI protocol. The effect of Runx1t1 over-expression on the adipocyte lineage commitment and subsequent differentiation was assessed at day 6 by Oil Red O staining (D) and 422/aP2 and PPARγ expression (E). The blots are representative of at least three independent experiments with identical results.

Download figure to PowerPoint

To test whether down-regulation of Runx1t1 is required for adipocytic commitment, Runx1t1 was over-expressed in Gdf6-expressing cells using a retrovirus vector (Fig. 4C). Forced expression of Runx1t1 inhibited adipocytic commitment of C3H10T1/2 cells, observed as decreased expression of Pref-1 at post-confluence (Fig. 4C), less Oil Red O staining (Fig. 4D), and decreased expression of PPARγ and 422/aP2 (Fig. 4E) after induction by MDI. Similar data (not shown) were obtained from over-expression studies on BMP4-induced adipocyte lineage commitment. These results indicate that down-regulation of Runx1t1 is required for adipocytic commitment of pluripotent mesenchymal C3H10T1/2 cells.

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Increased adipocyte formation from MSCs is a characteristic of obesity [27]. Our previous studies indicated that BMP2 and BMP4 induce commitment of pluripotent mesenchymal C3H10T1/2 cells to the adipocyte lineage [11, 12], but the role of the BMP family member Gdf6 had yet to be determined. We have now demonstrated that Gdf6 induces commitment of C3H10T1/2 cells to the adipocyte lineage. Both the Smad and p38 MAPK pathways are involved in the Gdf6 induction of adipocytic commitment. The Smad pathway may play a dominant role as knockdown of p38 MAPK has relatively little effect on Gdf6-induced adipogenesis. RNAi treatment also demonstrated the role of the type I receptor Bmpr1a and the type II receptors Bmpr2 and Acvr2a in mediating Gdf6 signaling. Expression of Runx1t1 decreased in Gdf6-expressing or BMP-treated committed pre-adipocytes and over-expression studies, suggesting that down-regulation of Runx1t1 is required for adipocytic commitment of C3H10T1/2 cells.

Pluripotent mesenchymal C3H10T1/2 cells constitutively express Bmpr1a, Bmpr2 and Acvr2a, but not Bmpr1b or Acvr2b (Fig. 2A), indicating that their receptors may not be essential for the action of Gdf6 in adipocytic commitment. A previous study identified a major role for endogenous Bmpr1a and Bmpr2 in Gdf6 signaling in MC3T3 cells [28]. Consistent with these findings, we also show that Bmpr1a and Bmpr2 play a dominant role in initializing Gdf6 signaling in the commitment of C3H10T1/2 cells to the adipocyte lineage (Figs 2 and 3).

Previous studies identified Runx1t1 as a negative regulator in adipocyte differentiation of 3T3-L1 pre-adipocytes [21, 22] and primary brown pre-adipocytes [26], but its role in adipocytic lineage commitment remained unknown. At post-confluence, Runx1t1 expression decreased in Gdf6-expressing C3H10T1/2 cells compared with control cells (Fig. 4A,B). Over-expression studies showed that decreased expression of Runx1t1 is required for adipocytic commitment, as forced expression of Runx1t1 almost completely disrupted adipogenesis of pluripotent mesenchymal C3H10T1/2 cells (Fig. 4C,D). Overall, these novel findings demonstrate that Runx1t1 is a negative regulator of the adipocytic commitment process.

Experimental procedures

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Cell culture and induction of commitment/differentiation

To induce adipocyte lineage commitment, C3H10T1/2 cells were plated at low density and cultured in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum with or without purified recombinant BMP4 (20 ng·mL−1). To induce differentiation, 2-day post-confluent cells were provided with Dulbecco's modified Eagle's medium containing 10% fetal bovine serum, 1 μg·mL−1 insulin, 1 μm dexamethasone and 0.5 mm 3–isobutyl-1–methylxanthine for 2 days, and Dulbecco's modified Eagle's medium with 10% fetal bovine serum and 1 μg·mL−1 insulin for another 2 days, after which they were cultured in Dulbecco's modified Eagle's medium with 10% fetal bovine serum.

Plasmids and retroviral infection

Gdf6 and Runx1t1 cDNA were generated by PCR using the following primers: Gdf6, 5′-GAAGAT CTGCCACCATGGACACTCCTAGGGTCC-3′ (forward) and 5′-CCGGAATTCCTACCTACAGCCGCAGGACTCC-3′ (reverse), and Runx1t1, 5′-CGCGGATCCGCCACCATGCCTGATCGTACCGAG-3′ (forward) and 5′-CCCTCGAGCTAGCGAGGCGTCGTCTC-3′ (reverse). The PCR products were cloned into MSCV retroviral vectors using BglII and EcoRI or BglII and XhoI. 293T cells cultured in serum-free Dulbecco's modified Eagle's medium were transfected with MSCV, MSCV–Gdf6 or MSCV–Runx1t1 and pMCV-Ecopac plasmids [29] at 95% confluency. Fresh medium containing 10% fetal bovine serum was provided 4–6 h after transfection, and the viral medium was collected at 48–72 h. C3H10T1/2 cells were infected with virus at 20–30% confluency with polybrene (Sigma-Aldrich, St Louis, MO, USA) (8 μg·mL−1).

RNA interference

Stealth RNAi™ siRNA duplexes specific for Smad4, p38 MAPK, Bmpr1a, Bmpr2 and Acvr2a were designed and synthesized by Invitrogen (Carlsbad, CA, USA). The silencing effects of several siRNA duplexes were screened and tested for their ability to knockdown expression of target genes by Western blotting or RT–PCR. The sequences used for successful RNAi knockdown were as follows: CAUACACACCUAAUUUGCCUCACCA for Smad4, CCUUUGAAAGCAGGGACCUUCUCAU for p38 MAPK, UAUACAGACAGCCAUGGAAAUGAGC for Bmpr1a, AUAUCUUGUUC-UGAACAUGGAUUGC for Bmpr2, and AUAACCUG-GCUUCUGCAUCAUGAUC for Acvr2a. Stealth RNAi™ siRNA negative control duplexes with a similar GC content were used as control. C3H10T1/2 cells at 30–50% confluence were transfected with siRNA duplexes using Lipofectamine RNAi MAX (Invitrogen).

Oil Red O staining

Cells were washed three times with NaCl/Pi at room temperature, and fixed for 10 min in 3.7% formaldehyde. Oil Red O (Sigma-Aldrich) (0.5% in isopropanol) was diluted with water (3 : 2), passed through a 0.45 μm filter, and incubated with the cells for 1 h at room temperature. The cells were washed with water at room temperature, and the stained fat droplets in adipocytes were examined by light microscopy.

Western blotting

Cells were washed with cold NaCl/Pi (pH 7.4) and scraped into lysis buffer containing 50 mm Tris/HCl (pH 6.8), 2% SDS, phosphatase inhibitors (10 mm Na3VO4 and 10 mm NaF), and protease inhibitor mixture (Roche Applied Science, Basel, Switzerland). Lysates were heated at 100 °C for 10 min, and clarified by centrifugation at 12 000 g for 10 min at 4° C. Equal amounts of protein were subjected to SDS/PAGE, and immunoblotted using specific primary antibodies. Monoclonal antibody against actin was obtained from Sigma (St Louis, MO, USA), antibody against 422/aP2 was from M. Daniel Lane's laboratory (Johns Hopkins, Baltimore, USA), antibody against PPARγ was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA), antibodies against Smad4, Smad1 and Gdf6 were purchased from Abcam (Cambridge, UK), antibodies against phospho-p38 MAPK, p38 MAPK kinase, phospho-Smad1/5/8 and Runx1t1 were obtained from Cell Signaling Technology (Beverly, MA, USA).

Real-time quantitative PCR and RT–PCR

Total RNA was isolated using TRIzol reagent (Invitrogen). First-strand cDNA synthesis performed using PrimeScript RT Master Mix (TaKaRa, Shiga, Japan) using random primers. Real-time quantitative PCRs were performed with 2× PCR Master Mix (Power SYBR Green; Applied Biosystems, Foster City, CA, USA) on an Applied Biosystems 7300 real-time PCR system (Applied Biosystems). The threshold cycles (Ct) for the target genes and the 18S rRNA control signals were determined in triplicate experiments, and the relative RNA quantity was calculated by the comparative Ct method. Primers were as follows: 18S rRNA, 5′-CGGCTACCACATCCAAGGAA-3′ (forward) and 5′-GCTGGAATTACCGCGGCT-3′ (reverse); Runx1t1, 5′-ATTTACGCCAACGACATTAACGA-3′ (forward) and 5′-CTGAGTTGCCTAGCACCACA-3′ (reverse). PCR reactions comprised synthesized cDNA as the template in a 25 μL reaction mixture containing specific primers. The primers were as follows: Bmpr1a, 5′-GCGAACTATTGCCAAACAG-3′ (forward) and 5′-GAGGTGGCACAGACCACAAG-3′ (reverse); Bmpr1b, 5′-GACACTCCCATTCCTCATC-3′ (forward) and 5′-GCTATTGTCCTTTGGACCAG-3′ (reverse); Bmpr2, 5′-AATCAAGAACGGCTGTGTGCA-3′ (forward) and 5′-CATGCTGTGAAGACC-CTGTTT-3′ (reverse); Acvr2a, 5′-CGAAGCCACCCTATTACAAC-3′ (forward) and 5′-ATTAGCCACA-GGTCCACATC-3′ (reverse); Acvr2b, 5′-ACCCCC-AGGTGTACTTCTG-3′ (forward) and 5′-CATGGCCGTAGGGAGGTTTC-3′ (reverse).

Statistical analysis

Values are expressed as means ± SD of at least three independent experiments. P values were determined by Student's t test, with < 0.05 being considered significant.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

This research is partially supported by National Key Basic Research Project grants 2011CB910201 and 2011CBA01103, State Key Program of National Natural Science Foundation grant 31030048C120114 and Shanghai Key Science and Technology Research Project grant 10JC1401000 to Q.–Q.T., and National Natural Science Foundation grants 31271489 and 81170781 to H.H. The department of Biochemistry and Molecular Biology is supported by Shanghai Leading Academic Discipline Project Number B110.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  • 1
    Otto TC, Bowers RR & Lane MD (2007) BMP–4 treatment of C3H10T1/2 stem cells blocks expression of MMP–3 and MMP–13. Biochem Biophys Res Commun 353, 10971104.
  • 2
    Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD, Moorman MA, Simonetti DW, Craig S & Marshak DR (1999) Multilineage potential of adult human mesenchymal stem cells. Science 284, 143147.
  • 3
    Caplan AI & Bruder SP (2001) Mesenchymal stem cells: building blocks for molecular medicine in the 21st century. Trends Mol Med 7, 259264.
  • 4
    Otto TC & Lane MD (2005) Adipose development: from stem cell to adipocyte. Crit Rev Biochem Mol Biol 40, 229242.
  • 5
    Reznikoff CA, Brankow DW & Heidelberger C (1973) Establishment and characterization of a cloned line of C3H mouse embryo cells sensitive to postconfluence inhibition of division. Cancer Res 33, 32313238.
  • 6
    Shi Y & Massague J (2003) Mechanisms of TGF–β signaling from cell membrane to the nucleus. Cell 113, 685700.
  • 7
    Attisano L & Wrana JL (2002) Signal transduction by the TGF–β superfamily. Science 296, 16461647.
  • 8
    Miyazono K, Maeda S & Imamura T (2005) BMP receptor signaling: transcriptional targets, regulation of signals, and signaling cross-talk. Cytokine Growth Factor Rev 16, 251263.
  • 9
    Sieber C, Kopf J, Hiepen C & Knaus P (2009) Recent advances in BMP receptor signaling. Cytokine Growth Factor Rev 20, 343355.
  • 10
    Tang QQ, Otto TC & Lane MD (2004) Commitment of C3H10T1/2 pluripotent stem cells to the adipocyte lineage. Proc Natl Acad Sci USA 101, 96079611.
  • 11
    Huang HY, Hu LL, Song TJ, Li X, He Q, Sun X, Li YM, Lu HJ, Yang PY & Tang QQ (2011) Involvement of cytoskeleton-associated proteins in the commitment of C3H10T1/2 pluripotent stem cells to adipocyte lineage induced by BMP2/4. Mol Cell Proteomics 10, M110.002691.
  • 12
    Huang H, Song TJ, Li X, Hu L, He Q, Liu M, Lane MD & Tang QQ (2009) BMP signaling pathway is required for commitment of C3H10T1/2 pluripotent stem cells to the adipocyte lineage. Proc Natl Acad Sci USA 106, 1267012675.
  • 13
    Storm EE, Huynh TV, Copeland NG, Jenkins NA, Kingsley DM & Lee SJ (1994) Limb alterations in brachypodism mice due to mutations in a new member of the TGFβ-superfamily. Nature 368, 639643.
  • 14
    Chang SC, Hoang B, Thomas JT, Vukicevic S, Luyten FP, Ryba NJ, Kozak CA, Reddi AH & Moos M Jr (1994) Cartilage-derived morphogenetic proteins. New members of the transforming growth factor–β superfamily predominantly expressed in long bones during human embryonic development. J Biol Chem 269, 2822728234.
  • 15
    Jelinsky SA, Li L, Ellis D, Archambault J, Li J, St Andre M, Morris C & Seeherman H (2011) Treatment with rhBMP12 or rhBMP13 increase the rate and the quality of rat Achilles tendon repair. J Orthop Res 29, 16041612.
  • 16
    Shen B, Bhargav D, Wei A, Williams LA, Tao H, Ma DD & Diwan AD (2009) BMP–13 emerges as a potential inhibitor of bone formation. Int J Biol Sci 5, 192200.
  • 17
    Miyoshi H, Shimizu K, Kozu T, Maseki N, Kaneko Y & Ohki M (1991) t(8;21) breakpoints on chromosome 21 in acute myeloid leukemia are clustered within a limited region of a single gene, AML1. Proc Natl Acad Sci USA 88, 1043110434.
  • 18
    Miyoshi H, Kozu T, Shimizu K, Enomoto K, Maseki N, Kaneko Y, Kamada N & Ohki M (1993) The t(8;21) translocation in acute myeloid leukemia results in production of an AML1–MTG8 fusion transcript. EMBO J 12, 27152721.
  • 19
    Erickson P, Gao J, Chang KS, Look T, Whisenant E, Raimondi S, Lasher R, Trujillo J, Rowley J & Drabkin H (1992) Identification of breakpoints in t(8;21) acute myelogenous leukemia and isolation of a fusion transcript, AML1/ETO, with similarity to Drosophila segmentation gene, runt. Blood 80, 18251831.
  • 20
    Wolford JK & Prochazka M (1998) Structure and expression of the human MTG8/ETO gene. Gene 212, 103109.
  • 21
    Rochford JJ, Semple RK, Laudes M, Boyle KB, Christodoulides C, Mulligan C, Lelliott CJ, Schinner S, Hadaschik D, Mahadevan M et al. (2004) ETO/MTG8 is an inhibitor of C/EBPβ activity and a regulator of early adipogenesis. Mol Cell Biol 24, 98639872.
  • 22
    Payne VA, Au WS, Lowe CE, Rahman SM, Friedman JE, O'Rahilly S & Rochford JJ (2010) C/EBP transcription factors regulate SREBP1c gene expression during adipogenesis. Biochem J 425, 215223.
  • 23
    Wang Y & Sul HS (2009) Pref–1 regulates mesenchymal cell commitment and differentiation through Sox9. Cell Metab 9, 287302.
  • 24
    Student AK, Hsu RY & Lane MD. Induction of fatty acid synthetase synthesis in differentiating 3T3-L1 preadipocytes. J Biol Chem 255, 47454750.
  • 25
    Anderson GJ & Darshan D (2008) Small-molecule dissection of BMP signaling. Nat Chem Biol 4, 1516.
  • 26
    Sun L, Xie H, Mori MA, Alexander R, Yuan B, Hattangadi SM, Liu Q, Kahn CR & Lodish HF (2011) Mir193b-365 is essential for brown fat differentiation. Nat Cell Biol 13, 958965.
  • 27
    Lee JS, Ha L, Park JH & Lim JY (2012) Mechanical stretch suppresses BMP4 induction of stem cell adipogenesis via upregulating ERK but not through down-regulating Smad or p38. Biochem Biophys Res Commun 418, 278283.
  • 28
    Mazerbourg S, Sangkuhl K, Luo CW, Sudo S, Klein C & Hsueh AJ (2005) Identification of receptors and signaling pathways for orphan bone morphogenetic protein/growth differentiation factor ligands based on genomic analyses. J Biol Chem 280, 3212232132.
  • 29
    Naviaux RK, Costanzi E, Haas M & Verma IM. The pCL vector system: rapid production of helper-free, high-titer, recombinant retroviruses. J Virol 70, 57015705.