SEARCH

SEARCH BY CITATION

Keywords:

  • brain tumor;
  • gene regulation;
  • metallopeptidase;
  • siRNA;
  • transcription

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References

Dipeptidyl-peptidase III (DPP III) is a cytosolic metallo-aminopeptidase implicated in various physiological and pathological processes. A previous study from our laboratory indicated an elevated expression of DPP III in glioblastoma (U87MG) cells. In the present study we investigated the role of interleukin-6 (IL-6), a pleiotropic cytokine produced by glial tumors, in the regulation of DPP III expression. Immunohistochemistry, western blotting and quantitative RT-PCR were used for quantitation of DPP III and IL-6 in human glioblastoma cells and tumors. Cell transfections and DPP III promoter reporter assays were performed to study the transcriptional regulation of DPP III by IL-6. Promoter deletion analysis, site directed mutagenesis, chromatin immunoprecipitation assays and small interfering RNA (siRNA) technology was employed to elucidate the molecular mechanism of IL-6 mediated regulation of DPP III expression in glioblastoma cells. Our results for the first time demonstrate a negative correlation (= 0.632, = 0.01) between DPP III and IL-6 in both human tumors and cultured glioblastoma cells. Treatment of U87MG cells with IL-6 significantly decreased DPP III expression with a concomitant increase in the levels of transcription factor CCAAT/enhancer binding protein beta (C/EBP-β). Deletion/mutagenesis of C/EBP-β binding motif of DPP III promoter significantly increased its activity and abolished its responsiveness to IL-6. This effect could also be mimicked by C/EBP-β siRNA. In conclusion our study for the first time demonstrates C/EBP-β mediated transcriptional downregulation of DPP III by IL-6. Our results demonstrating a negative correlation between IL-6 and DPP III taken together with the previously reported prognostic significance of this cytokine in glioblastoma suggests that DPP III may prove useful as a prognostic marker.


Abbreviations
C/EBP-β

CCAAT/enhancer binding protein beta

ChIP

chromatin immunoprecipitation

DPP III

dipeptidyl-peptidase III

GAPDH

glyceraldehyde 3-phosphate dehydrogenase

IL-6

interleukin-6

siRNA

small interfering RNA

Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References

Interleukin-6 (IL-6), a pleiotropic cytokine, regulates diverse processes such as cell proliferation and survival, neuronal differentiation, inflammation, bone metabolism, hematopoiesis and nociception [1-6]. It has also been demonstrated to promote the growth of several human tumors including glioblastoma [7-10]. The expression of this cytokine is often elevated in glial tumors and plays an important role in malignant progression by facilitating tumor angiogenesis and invasion [11, 12]. Chang et al. [13] observed variable expression of IL-6 in glioblastoma multiforme and linked its elevated expression with poor prognosis of the disease.

Dipeptidyl-peptidase III (DPP III), a cytosolic aminopeptidase implicated in a number of physiological and pathological processes, is ubiquitously expressed in human tissues [14]. A strong positive correlation has been reported between DPP III and ovarian cancer and its activity increases with increase in the histological aggressiveness of the disease [15]. In a previous study the highest DPP III promoter activity was observed in glioblastoma cells as compared to other cell lines thereby indicating its elevated expression in these cells [16]. Glioblastoma cells also produce IL-6 in vivo as well as in vitro and its elevated levels of expression distinguish glioblastoma from low grade astrocytoma [17]. Our laboratory previously cloned DPP III promoter and demonstrated a critical role of Ets-1/Elk-1 in transcription of this peptidase in U87MG cells [16]. The present study was planned to investigate the role of IL-6 in regulation of DPP III expression and to elucidate its molecular mechanism. Our results for the first time demonstrate transcriptional downregulation of DPP III expression by IL-6 and conclusively establish the role of CCAAT/enhancer binding protein beta (C/EBP-β) in this process.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References

Expression of DPP III and IL-6 in human glioblastoma cells

IL-6 is a pleiotropic cytokine which alters the expression of a variety of proteins in glioblastoma cells. Since previous studies from our laboratory indicated an elevated expression of DPP III in human glioblastoma (U87MG) cells [16] it was of interest to study the role of IL-6 (if any) in regulating the expression of this peptidase. In order to investigate if any correlation exists between the two we assessed the expression of DPP III and IL-6 in several human glioblastoma cells (LN229, LN18, U373MG and U87MG) by western blotting and the results are shown in Fig. 1. These results revealed detectable levels of DPP III and IL-6 expression in all human glioblastoma cells. However, the levels varied between different cell lines. Of all the cell lines studied U87MG cells express the highest levels of DPP III followed by U373MG cells, LN229 and LN18 (Fig. 1). Interestingly the levels of IL-6 were found to be maximum in LN18 followed by LN229, U373MG and U87MG. Densitometry of the specific bands followed by normalization with the levels of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) revealed an inverse relationship between the expression of DPP III and IL-6 (Fig. 1B). Spearman's correlation analysis revealed a significant negative correlation (= 0.832;  0.05) between the two. To further corroborate these results, expression of DPP III and IL-6 was assessed by immunohistochemistry in glioblastoma stage IV tumors (= 25). As shown in Fig. 2, consistent with our findings in various glioblastoma cells, variable expression of DPP III and IL-6 found in glial tumors exhibited a significant negative correlation (= 0.632; = 0.01).

image

Figure 1. Expression of DPP III and IL-6 in different glioblastoma cell lines. (A) Endogenous DPP III and IL-6 expression in various glioblastoma cell lines was assessed by western blotting using specific monoclonal antibodies. Simultaneously western blot for GAPDH was performed and used as internal control to normalize for equal loading. Representative blots are shown. (B) The specific bands of DPP III and IL-6 were quantitated densitometrically. The values obtained for GAPDH were used to normalize for equal loading. Values are mean ± SD from at least three independent experiments performed in triplicate. Other details are given in 'IL-6 treatment decreases DPP III expression in U87MG cells'.

Download figure to PowerPoint

image

Figure 2. Expression of DPP III and IL-6 in glioblastoma tissue samples. Endogenous DPP III and IL-6 expression was evaluated by IHC of paraffin embedded sections of human glioblastoma stage IV tumors using specific antibodies. (A) Representative pictures of DPP III immunostaining (original magnification 200 ×). (B) Representative pictures of IL-6 immunostaining (original magnification 200 ×). (C) Representative picture of immunostaining negative control (200 ×  magnification). (D) The expression of DPP III and IL-6 (IHC scores) in patient samples are shown by dot plot. Values are mean ± SEM. (E) Regression analysis between DPP III and IL-6 in glioblastoma samples. This analysis revealed a significant negative correlation between them (= −0.632; ≤ 0.05).

Download figure to PowerPoint

IL-6 treatment decreases DPP III expression in U87MG cells

The results presented in the preceding section established a negative correlation between IL-6 and DPP III expression in glioblastoma cells and tumors. In an attempt to elucidate whether elevated levels of IL-6 are indeed responsible for downregulation of DPP III expression, U87MG glioblastoma cells were treated with 100 nm of recombinant IL-6. After 24 h of this treatment the expression of DPP III in IL-6 treated and untreated cells was assessed by western blotting and real-time PCR. As evident from Fig. 3, IL-6 treatment significantly decreased DPP III expression. Similarly a parallel decrease was observed in its mRNA levels (Fig. 3C). These results conclusively demonstrate the direct involvement of IL-6 in decreasing DPP III levels and suggest that this decrease may be due to either its transcriptional downregulation or decrease in its mRNA stability.

image

Figure 3. Reduction in the levels of DPP III by IL-6 treatment in U87MG cells. (A) Effect of IL-6 on DPP III expression. DPP III levels in IL-6 treated and untreated cells were determined by western blotting using monoclonal antibodies. Simultaneously western blot for GAPDH was performed and used as internal control to normalize for equal loading. Representative blots are shown. (B) The DPP III and GAPDH bands were quantitated densitometrically and the values obtained for GAPDH were used to normalize for equal loading. Values are mean ± SD from at least three independent experiments performed in triplicate. (C) Effect of IL-6 on DPP III mRNA expression. Total cellular RNA isolated from IL-6 untreated or treated cells was reverse transcribed and subjected to real-time PCR using SYBR green and gene-specific primers for DPP III. Similarly real-time RNA for 18 S rRNA was performed and used as an internal control. Cycle threshold (Ct) values were calculated for each RNA and relative fold change was calculated using the 2−δδCt method. Each set of observations was compared with the other set using a paired two-tailed t test, assuming equal variances among the sample means. Values are mean ± SD from three independent experiments performed in triplicate. ≤ 0.05 was considered to be statistically significant and is marked with an asterisk.

Download figure to PowerPoint

Transcriptional downregulation of DPP III expression by IL-6

Shukla et al. cloned and characterized human DPP III promoter. We used human full-length (−1033⁄+ 5 bp) DPP III promoter reporter construct (pAAS-1) to assess the role of transcription in IL-6 mediated reduction of DPP III levels [16]. For this purpose the luciferase activity in U87MG cells transiently transfected with pAAS-1 was assayed after treatment with 100 nm IL-6 or vehicle solution. As shown in Fig. 4, significantly less DPP III promoter activity (= 0.047) was detected in IL-6 treated cells compared with untreated cells. No such effect was observed on SV-40 promoter suggesting the specific effect of IL-6 on DPP III promoter. Furthermore these results demonstrated the role of transcription in downregulation of DPP III expression by IL-6 in U87MG cells.

image

Figure 4. DPP III promoter activity in IL-6 untreated and treated cells. U87MG cells were transfected with DPP III promoter reporter construct (pAAS-1) or pGL3C vector (Promega) containing SV-40 promoter and enhancer cloned upstream and downstream to the firefly luciferase reporter gene respectively as control. After 24 h the transfected cells were grown in the presence or absence of 100 nm IL-6 for another 24 h and then lysed followed by assaying luciferase activity in the cell lysate. The construct was co-transfected with the pRLTK vector and the renilla luciferase activity was used to normalize for transfection efficiency. Each transfection was done in triplicate and results are expressed as mean ± SD from three independent experiments. Statistically significant (≤ 0.05) reduction in luciferase activity by IL-6 treatment is marked with an asterisk.

Download figure to PowerPoint

Identification of IL-6 response element(s) in DPP III promoter

Shukla et al. performed 5′ deletion analysis to characterize DPP III promoter and generated several promoter reporter constructs. Some of these constructs (pASS-1, pAAS-2 and pASS-3) were used in the present study for the identification of IL-6 response element(s). As shown in Fig. 5, deletion of the promoter region between 1033 and 781 did not have any effect on promoter activity or responsiveness to IL-6 treatment. However, further deletion of the promoter region up to −495 (pRS-1) significantly reduced promoter activity but retained responsiveness to IL-6. Interestingly, deletions of 10 bp from the 5′ end of pRS-1 led to a dramatic increase in promoter activity with a concomitant loss of responsiveness to IL-6 (Fig. 5). These results suggested that the above mentioned 10 bp region contains potential negative regulatory and IL-6 response element(s). Nucleotide sequence analysis of DPP III promoter by an online tool transfac 6.0 revealed the presence of a single C/EBP-β binding motif (5′ GCTTTGCAAC 3′) spanning between nucleotides −487 and −478 and an NF-1 binding motif between −476 and −467 nucleotides (Fig. 6). Since 5′ deletion of the promoter region up to −485 bp resulted in the deletion of nucleotides AG which were part of only the C/EBP-β binding motif and not that of NF-1 motif, the possibility of later being part of the IL-6 response element was ruled out. To further confirm this hypothesis we specifically mutated C/EBP-β binding motif by site directed mutagenesis in the full-length promoter reporter construct pAAS-1. This mutagenesis led to a significant increase in promoter activity and abolished its responsiveness to IL-6 (Fig. 7). From these results we concluded that C/EBP-β binding motif functions as a negative regulatory element and it alone was sufficient for conferring responsiveness to IL-6.

image

Figure 5. Identification of IL-6 response elements in DPP III promoter by deletion analysis. U87MG cells were transfected with various DPP III promoter reporter deletion constructs and after 24 h these cells were grown in the presence or absence of IL-6 as described earlier and luciferase activity was assayed. All constructs were co-transfected with the pRLTK vector and the renilla luciferase activity was used to normalize for the transfection efficiency. Each transfection was done in triplicate and results are expressed as mean ± SD from three independent experiments. Statistically significant ( 0.05) reduction in luciferase activity by IL-6 treatment has been marked with an asterisk.

Download figure to PowerPoint

image

Figure 6. Schematic diagram indicating the positions of the probable transcription factor binding motifs as analyzed by transfac in human DPP III promoter region from −313 bp to −553 bp upstream of the transcription initiation site. Deletion constructs used in this study are marked by an arrow (image). Potential regulatory motifs are underlined by dotted lines. Promoter deletion analysis and in silico analysis revealed the presence of a single C/EBP-β binding motif in the IL-6 response region.

Download figure to PowerPoint

image

Figure 7. Mutagenesis of C/EBP-β binding motif increases DPP III promoter activity and abolishes its responsiveness to IL-6. The C/EBP-β binding motif was mutated and the resulting construct was transfected in U87MG cells. After 24 h these cells were grown in the presence or absence of IL-6 for another 24 h as described earlier and luciferase activity was assayed. All constructs were co-transfected with the pRLTK vector and the renilla luciferase activity was used to normalize for the transfection efficiency. Each transfection was done in triplicate and results are expressed as mean ± SD from three independent experiments. Statistically significant (≤ 0.05) reduction in luciferase activity by IL-6 treatment is marked with an asterisk.

Download figure to PowerPoint

Binding of C/EBP-β to its cognate motif on DPP III promoter

Chromatin immunoprecipitation (ChIP) assays were performed to assess the in vivo binding of C/EBP-β to its cognate motifs on DPP III promoter. For these assays chromatin from U87MG cells was immunoprecipitated using C/EBP-β antibody and subjected to semiquantitative PCR using specific primers designed on the basis of the nucleotide sequence flanking the C/EBP-β binding motif on DPP III promoter. Analysis of the PCR products revealed the amplification of the expected size DNA fragment (196 bp) when chromatin immunoprecipitated with C/EBP-β antibody or input chromatin was used as template respectively (Fig. 8). These amplified fragments were subjected to double-stranded DNA sequencing and the nucleotide sequence thus obtained exhibited complete homology to the DPP III promoter region expected to be amplified (data not shown). However, when chromatin immunoprecipitated using the total rabbit anti-mouse IgG was used as template no such amplification by PCR was evident (Fig. 8, lane 6). Interestingly, when PCR was performed using C/EBP-β antibody immunoprecipitated chromatin from IL-6 treated cells as template we observed a perceptible increase in the intensity of the amplified band (Fig. 8, lane 3) compared with when similar chromatin of the untreated cell was used as template (Fig. 8, lane 5).

image

Figure 8. Chromatin immunoprecipitation assay to assess the binding of C/EBP-β to its cognate motif on DPP III promoter. Crosslinked chromatin isolated from IL-6 treated and untreated U87MG cells was sonicated and subjected to immunoprecipitation using C/EBP-β antibody. After reversal of the crosslinking these immunoprecipitates were subjected to PCR using gene-specific primers flanking the C/EBP-β binding motifs on DPP III promoter. The amplified products were resolved on agarose gel. Lane 1, DNA molecular weight marker (100 bp ladder); lane 2, PCR of input control from IL-6 treated cells; lane 3, PCR of C/EBP-β immunoprecipitated chromatin from IL-6 treated U87MG cells; lane 4, PCR of input control from untreated cells; lane 5, PCR of C/EBP-β immunoprecipitated chromatin from untreated U87MG cells; lane 6, PCR of chromatin immunoprecipitated with normal rabbit IgG (PCR negative control); lane 7, PCR performed without template (negative control).

Download figure to PowerPoint

Silencing of C/EBP-β increases DPP III expression and its promoter activity

The results of the preceding section clearly demonstrated increased binding of C/EBP-β to its cognate motif on DPP III promoter in response to IL-6 treatment in U87MG cells. However, it was not clear whether IL-6 treatment induces C/EBP-β expression or facilitates the binding of existing C/EBP-β to its motif. Similarly there was no information about whether an increase in C/EBP-β levels alone was sufficient to downregulate DPP III expression in response to IL-6. In the present study we assessed the expression of C/EBP-β in IL-6 treated U87MG cells and employed small interfering RNA (siRNA) mediated silencing of C/EBP-β to address these questions. As is evident from Fig. 9, treatment of U87MG cells with 100 nm of IL-6 resulted in a statistically significant increase ( 0.05) in C/EBP-β expression with a concomitant decrease in DPP III levels ( 0.05) while the expression of GAPDH remained unaltered.

image

Figure 9. IL-6 increases the expression of C/EBP-β and thus decreases the expression of DPP III. (A) Effect of IL-6 on C/EBP-β and DPP III expression. DPP III and C/EBP-β levels in IL-6 treated and untreated cells were determined by western blotting using monoclonal antibodies. Simultaneously western blot for GAPDH was performed and used as internal control to normalize for equal loading. Representative blots are shown. (B) The specific bands of C/EBP-β and DPP III were quantitated densitometrically. The values obtained for GAPDH were used to normalize for equal loading. Values are mean ± SD from at least three independent experiments performed in triplicate. A P value of ≤0.05 was considered to be statistically significant and is marked with an asterisk.

Download figure to PowerPoint

We constructed three C/EBP-β siRNA expression vectors (shC/EBP-β 259, shC/EBP-β 269 and shC/EBP-β 1417) to silence C/EBP-β expression and a scrambled siRNA vector (shSc). The details of the construction of these vectors are given in 'IL-6 treatment decreases DPP III expression in U87MG cells' and nucleotide sequences are given in Table 1. These vectors were independently transfected into U87MG cells and the expressions of C/EBP-β, DPP III and GAPDH were assessed 48 h post transfection by western blotting. The results are presented in Fig. 10. As shown in Fig. 10A,B, transfection of U87MG cells with shC/EBP-β 259 or shC/EBP-β 1417 led to a statistically significant decrease in the levels of C/EBP-β with a parallel and significant increase in DPP III expression compared with mock transfected cells. However, neither the expression of C/EBP-β nor that of DPP III was altered in these cells after the transfection of shC/EBP-β 269 or shSc. Similarly the expression of GAPDH was not affected by C/EBP-β siRNA confirming its specificity against C/EBP-β alone.

Table 1. Oligonucleotides used for various experiments in the present study.
OligonucleotidesNucleotide sequence (5′[RIGHTWARDS ARROW]3′)Remarks
For real time PCR
DPP III F-20 (sense) GCAGGAAGTGAGTTTCGAAC Amplicon size 155 bp
AAS1 (antisense) GACAGGTGGTAGGCATAGAG
β-actin (sense) AGAAAATCTGGCACCACACC Amplicon size 173 bp
β-actin (antisense) TAGCACAGCCTGGATAGCAA
For promoter deletion analysis
DPP III F 495 GACTCGAGGCACCGAGAGCTTT Contains XhoI site
DPP III NR (antisense) CCCAAGCTTAACTCACTTCCTGCTTC Contains HindIII site
For site directed mutagenesis of C/EBP-β motif
DPP III F2 (sense) AGCCTCGAGACCGTGCGGGATTTCA Contains XhoI site
DPP III C/EBP-β Mut F (sense) CCGGCACCGAGAGCccTGCAACTTCCAAGTC Mutated bases are in lower case
DPP III C/EBP-β Mut R (antisense) GACTTGGAAGTTGCAggGCTCTCGGTGCCGG Mutated bases are in lower case
DPP III NR (antisense) CCCAAGCTTAACTCACTTCCTGCTTC Contains HindIII site
For ChIP assays
ChIPF (sense) CTACACGGGTGGGACCACCTCA Amplicon size 195 bp
ChIPR (antisense) GGGTTTCTCCTCAGAGGACCCGA
For construction of C/EBP-β siRNA and scrambled siRNA expression vectors
sh259 (sense) ATCCATGGAAGTGGCCAACTTCAAGAGAGTTGGCCACTTCCATGGATTTTTTTG Target region 259–277 on mRNA
sh259 (antisense) AATTCAAAAAAATCCATGGAAGTGGCCAACTCTCTTGAAGTTGGCCACTTCCATGGATGGCC ApaI and EcoRI adaptor sequences are shown in bold
sh269 (sense) GTGGCCAACTTCTACTACGTTCAAGAGACGTAGTAGAAGTTGGCCACTTTTTTG Target region 269-287 on mRNA
sh269 (antisense) AATTCAAAAAAGTGGCCAACTTCTACTACGTCTCTTGAACGTAGTAGAAGTTGGCCACGGCC ApaI and EcoRI adaptor sequences are shown in bold
sh1417 (sense) ACCAACCGCACATGCAGATTTCAAGAGAATCTGCATGTGCGGTTGGTTTTTTTG Target region 1417-1435 on mRNA
sh1417 (antisense) AATTCAAAAAAACCAACCGCACATGCAGATTCTCTTGAAATCTGCATGTGCGGTTGGTGGCC ApaI and EcoRI adaptor sequences are shown in bold
shSc (sense) CTTAAGTCATAGCTATTGAATTCAAGAGAT TCAATAGCTATGACTTAAG
shSc (antisense) AATTCTTAAGTCATAGCTATTGAATCTCTTGAATTCAATAGCTATGACTTAAGGGCC ApaI and EcoRI adaptor sequences are shown in bold
image

Figure 10. Silencing of C/EBP-β expression increase DPPIII levels by enhancing its promoter activity in U87MG cells. (A) U87MG cells were transiently transfected with C/EBP-β siRNA or scrambled siRNA expression vector. After 48 h, the expressions of C/EBP-β and DPP III were assessed by western blotting using monoclonal antibodies. Simultaneously western blot for GAPDH was performed and used as internal control to normalize for equal loading. Representative blots are shown. (B) The specific bands of C/EBP-β and DPP III were quantitated densitometrically and normalized against the densitometeric values of GAPDH. Values are mean ± SD from at least three independent experiments performed in triplicate. Transfection of C/EBP-β siRNA expression vectors (shC/EBP-β 259 and shC/EBP-β 1417) into U87MG cells significantly decreased C/EBP- expression (#) with a concomitant significant increase in the expression of DPPIII (*) as compared to their levels in scrambled siRNA expression vector (sh/Sc) transfected or un-transfected U87MG cells (C) DPP III promoter reporter construct (pAAS-1) was co-transfected with C/EBP-β siRNA or scrambled siRNA expression vectors and luciferase activity was assayed 48 h post transfection. Each transfection was performed in triplicates and results are expressed as mean ±SD from three independent experiments. Values significantly (P ≤ 0.05) different from control (sh/Sc) have been marked by an asterisk.

Download figure to PowerPoint

To further corroborate our findings we co-transfected the above mentioned siRNA expression vectors with DPP III promoter reporter construct pAAS-1 in U87MG cells followed by assaying luciferase activity. Consistent with the above results shC/EBP-β 259 or shC/EBP-β 1417 which silenced the expression of C/EBP-β led to a significant ( 0.05) increase in DPP III promoter activity compared with shSc (Fig. 10C) whereas shC/EBP-β 269 did not have any effect on promoter activity. These findings convincingly establish that IL-6 treatment increases C/EBP-β levels which alone is sufficient for transcriptional downregulation of DPP III expression.

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References

Glioblastoma cells produce IL-6 in vitro and in vivo, which in turn promotes their proliferation and invasive ability and inhibits apoptosis [11, 12, 17, 18]. Some of these effects are mediated by the induced expression of STAT-3, VEGF, MMP-2 and facin-1 etc. [11, 19, 20]. Li et al. demonstrated that IL-6 augments the invasiveness of U87MG cells by upregulation of MMP-2 and fascin-1 expression [11]. Similarly, increased expression of a number of other endopeptidases (proteinases) and exopeptidases confers invasive ability to these tumor cells [21-23]. The expression of metallo-aminopeptidase DPP III also increases with increase in the histological aggressiveness of human ovarian carcinoma [15]. We have previously observed that of all the cell lines studied U87MG cells displayed highest DPP III promoter activity thereby indicating its highest expression in these cells [16]. Interestingly, the results of the present study for the first time demonstrate a wide variation in the expression of this peptidase in human glioblastoma and even in various cell lines derived from it. The levels of DPP III mRNA and protein exhibit an inverse correlation with that of IL-6. Of all the glioblastoma cells used in the present study we observed lowest expression of IL-6 in U87MG cells. As these cells harbor wild type p53 (Wtp53) our findings are consistent with those of Margulies and Sehgal who observed repression of IL-6 promoter by Wtp53 [24]. However, we did not observe any correlation between the levels of IL-6 and p53 status in other lines (LN18, LN229 and U373MG). Treatment of U87MG cells with IL-6 led to a significant ( 0.05) decrease in the levels of DPP III mRNA and protein, thereby establishing a direct role of IL-6 in downregulation of DPP III expression. IL-6 has also been demonstrated to downregulate the expression of aldolase B, albumin, fibronectin, transferrin, PXR (pregnane X receptor), CAR (constitutively activated receptor) and human type II collagen genes [25-29].

Our laboratory previously cloned human DPP III promoter and established the critical role of Ets-1/Elk-1 in the transcription of this peptidase in human glioblastoma cells. In the present study we observed a statistically significant decrease in DPP III promoter activity by IL-6 treatment. C/EBP-β can function as a transcriptional activator as well as repressor [30-38]. By deletion analysis and ChIP assays we identified a single functional C/EBP-β binding motif in the IL-6 response region of DPP III promoter whose mutagenesis completely abolished its responsiveness to IL-6. Thus, our results are in agreement with the reports where C/EBP-β has been shown to downregulate the expression of albumin and CD200R1 [33, 37]. IL-6 treatment increased the expression of C/EBP-β in human astrocytoma, glioblastoma, hepatocellular carcinoma, renal cell carcinoma and breast cancer cells [39-43]. We observed elevated expression and binding of C/EBP-β to its cognate motif on DPP III promoter in response to IL-6 treatment. Aigueperse et al. [30] demonstrated the involvement of NF-1 and Sp-1 along with C/EBP-β in regulation of mouse aldose reductase like gene expression. DPP III promoter contains NF-1 (−476 to −467) and Sp-1(−468 to −459) binding motifs in close vicinity to the C/EBP-β motif. However, mutagenesis of these two binding sites did not have any effect on reduction of promoter activity by IL-6 (data not shown). So it was inferred that the C/EBP-β motif alone was sufficient to confer IL-6 responsiveness to the DPP III promoter. Our laboratory has previously demonstrated the role of C/EBP-α in acetaldehyde mediated downregulation of human cathepsin L in hepatocytes by silencing of C/EBP-α expression [44]. In the present study also we designed an siRNA expression vector for silencing C/EBP-β expression and our results demonstrate that expression vectors which reduce C/EBP-β expression induce DPP III promoter activity and expression without having any effect on GAPDH levels. From these results we conclude that downregulation of DPP III expression by IL-6 is mediated by C/EBP-β and alteration in the level of this transcription factor alone is sufficient for this effect.

Endogenous opioid peptide synthesized and secreted by the central nervous system produces diverse effects including relief from pain. Bezerra et al. demonstrated entropy driven binding of opioid peptides (endomorphin-1 and leu-enkephalin) to DPP III and proposed them to be the natural substrate of this peptidase [45]. Consistent with this report Barsun et al. reported cleavage of endomorphins by human DPP III [46]. Thus increased activity/levels of this peptidase may be expected to result in decreased concentration of these analgesic peptides thereby increasing the perception of pain. Downregulating the expression of this opioid cleaving peptidase may be a conceivable physiological response to minimize pain. Sato et al. indeed observed a significant reduction in DPP III activity in the cerebrospinal fluid of patients with acute pain thereby again suggesting its involvement in pain modulation [47]. The majority of glioblastoma patients experience pain due to increased intracranial pressure exerted by the large tumor volume. Our results demonstrating reduction of DPP III in glioblastoma by IL-6 may thus be a patient's physiological response to minimize the pain associated with the aggressive form of glioblastoma. Elevated expression of IL-6 exhibits a strong correlation with a very aggressive form of glioblastoma and shortened survival of the patients [11-13, 48]. The results of the present study for the first time demonstrate a strong negative correlation between IL-6 and DPP III expression in glioblastoma tumors and cultured cells. Our results in view of the known prognostic significance of IL-6 suggest an association between decreased DPP III level and poor outcome in glioblastoma patients.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References

Cell culture

Human glioblastoma cells U87MG, U373MG, LN18 or LN229 obtained from the National Centre for Cell Science, Pune, India, were grown in Dulbecco's modified Eagle's medium (Gibco Life Technologies, Karlsruhe, Germany) containing high glucose (4.5 g·L−1) and supplemented with 20 μg·mL−1 ciprofloxacin and 10% fetal bovine serum (Gibco Life Technologies) in a humidified atmosphere containing 5% CO2 at 37 °C. The cells were subcultured or harvested for analysis after they achieved 75–80% confluence.

Antibodies

Antibodies against human C/EBP-β and GAPDH were purchased from Abcam (Cambridge, UK), DPP III from Thermo Fisher Scientific Inc. (Rockford, IL, USA) and IL-6 from Santa Cruz Inc. (Dallas, TX, USA).

Tumor and biopsy specimens

Histologically confirmed grade IV archival glioblastoma tissue samples (= 25) were included in the present study after obtaining formal approval from the Institutional Human Ethics Committee of the All India Institute of Medical Sciences, New Delhi, India.

Immunohistochemistry

Paraffin-embedded sections (5 μm) of grade IV human glioblastoma (= 25) were collected on gelatin-coated slides, deparaffinized in xylene, hydrated in descending grades of alcohol, and pretreated in a microwave oven for 15 min in citrate buffer (0.01 m, pH 6.0) containing 0.025% Tween 20 for antigen retrieval. The sections were incubated with hydrogen peroxide (0.3% v/v) in methanol for 30 min to quench the endogenous peroxidase activity, followed by blocking with 1% bovine serum albumin to preclude non-specific binding. Thereafter, the slides were incubated with rabbit polyclonal DPP III antibody (1 : 200 dilution) or goat polyclonal IL-6 antibody (1 : 100) for 16 h at 4 °C. The primary antibody was detected using the streptavidin–biotin complex using the Dako LSAB plus kit (Dako Cytomation, Glostrup, Denmark) and diaminobenzidine as the chromogen. All procedures were carried out at room temperature unless otherwise specified. Slides were washed with Tris-buffered saline (0.1 m, pH 7.4) three times after every step. Finally, the sections were counterstained with Mayer's hematoxylin and mounted with DPX Mountant. Tissue sections incubated with isotype-specific non-immune mouse IgG in place of primary antibody served as negative control. The immunostained sections were evaluated by light microscopy examination.

Evaluation of immunohistochemical staining

Each slide was evaluated for DPP III and IL-6 immunostaining using a scoring system for both staining intensity and the percentage of positive epithelial cells. Immunostaining was evaluated in five randomly selected areas of the tissue section. For DPP III and IL-6 protein expression, sections were scored as positive cells exhibiting cytoplasmic expression when observed independently by the senior pathologist (MCS), who was blinded to the grading of the tissue samples. The tissue sections were scored based on the percentage of DPP III and IL-6 immunopositive cells as 0–24%, 0; 25–49%, l; 50–74%, 2; and 75–100%, 3. Sections were also scored on the basis of staining intensity as negative = 0; mild = 1; moderate = 2; and intense = 3. Finally, a total score was obtained by adding the score of percentage positivity and intensity.

Constructions of DPP III promoter reporter construct and site directed mutagenesis of the C/EBP-β binding motif

In the present study we used three promoter reporter constructs (pAAS-1, pAAS-2 and pAAS-3) described by Shukla et al. [16] without any modification and generated a new deletion construct (pRS-1) by using the same PCR based strategy. The nucleotide sequences of the PCR primers (DPP III-494F and DPP III-NR) used for making this construct are shown in Table 1.

The mutagenesis of the C/EBP-β binding motif was essentially carried out by the PCR based strategy described by Rodriguez et al. [49]. The C/EBP-β binding motifs at −487 and −478 5′ GCTTTGCAAC 3′ of the DPP III promoter were mutated to 5′ GCccTGCAAC 3′. The mutated bases are in lower case. The nucleotide sequences of primers used for mutagenesis are given in Table 1. Mutagenesis of the desired nucleotides in the resulting construct was confirmed by double-stranded DNA sequencing.

Transfection and luciferase assay

U87MG cells were seeded in a six-well plate (1.5 × 106 cells per well). The next day they were transfected with 1 μg of control or test plasmid DNA. After 48 h, transfected cells were processed for preparation of cell lysates and measurement of luciferase activity in the cell lysates. The details of transfection and luciferase assay have been described earlier [16].

For transfection of siRNA expression constructs, 4 × 106 U87MG cells were plated in a T25 flask. The next day the cells were transfected with 5 μg of control or test plasmid DNA FuGENE® HD Transfection Reagent (Promega, Madison, WI, USA), according to the manufacturer's protocol.

Chromatin immunoprecipitation (ChIP) assay

ChIP assays were performed with CEBP-β antibody using Imprint™ Chromatin Immunoprecipitation Kit (Sigma-Aldrich, St Louis, MO, USA) according to the manufacturer's protocol as described by Mir and Chauhan with the only variation that U87MG cells in place of HepG2 cells were used in the present study [44].

Western blotting

75–85% confluent cells were harvested, washed twice with ice-cold NaCl/Pi and lysed in RIPA buffer (Abcam) with 1 μg·mL−1 protease inhibitor cocktail (Sigma-Aldrich) for 10 min followed by centrifugation at 10 000 g for 10 min at 4 °C to remove debris. Supernatant cell lysates containing 50 μg of total protein were subjected to SDS/PAGE followed by western blotting as described earlier [44].

Treatment of U87MG cells with recombinant IL-6

1.25 × 105 U87MG cells were plated in each well of a six-well plate. The next day, the appropriate volume of recombinant IL-6 stock (eBioscience, San Diego, CA, USA) in NaCl/Pi was added to each well to achieve a final concentration of 100 nm. Cells treated with an equal volume of NaCl/Pi served as controls. After 24 h the cells were washed twice with ice-cold NaCl/Pi and processed for preparation of cell lysates.

To study the effect of IL-6 on DPP III promoter activity U87MG cells transfected with the desired promoter reporter constructs were treated with IL-6 or NaCl/Pi 24 h post transfection and processed for luciferase assays after 48 h, i.e. after 24 h of IL-6 treatment.

Construction of C/EBP-β siRNA expression vector

Three human C/EBP-β siRNA expression vectors, namely sh259, sh269 and sh1417, along with a scrambled siRNA expression vector (shSc) were constructed in the laboratory. The strategy for predicting the siRNA sequence against the target mRNA and construction of these vectors have been described earlier [44]. The oligonucleotides used for this purpose are listed in Table 1. Silencing efficiencies of the vectors were assessed after their transient transfection in U87MG cells by western blotting.

Real-time PCR

DPP III mRNA was quantitated by real-time PCR as described by Shukla et al. [16] using Maxima® SYBR Green/ROX qPCR Master Mix (MBI Fermentas, Vilnius, Lithuania) and ABI Prism 7000 (Applied Biosystems, Foster City, CA, USA) thermal cycler. The primers used for this purpose are described in Table 1.

Statistical analysis

In this study statistical analysis was done using the spss 17.0 software (SPSS, Chicago, IL, USA). Spearman's correlation analysis was applied for correlating two variables of the immunohistochemical data. For comparison the paired two-tailed Student's t test for parametric data and the Mann–Whitney U test for non-parametric data were applied.  0.05 was considered statistically significant.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References

We are grateful to Dr Riyaz A. Mir for helpful discussions while performing the ChIP assays and site directed mutagenesis. This study was supported by research grant BT/PR7146/MED/30/900/2012 from the Department of Biotechnology, Government of India, New Delhi, to SSC.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References
  • 1
    Lam SP, Luk JM, Man K, Ng KT, Cheung CK, Rose-John S & Lo CM (2010) Activation of interleukin-6-induced glycoprotein 130/signal transducer and activator of transcription 3 pathway in mesenchymal stem cells enhances hepatic differentiation, proliferation, and liver regeneration. Liver Transpl 16, 11951206.
  • 2
    Qiu Z, Sweeney DD, Netzeband JG & Gruol DL (1998) Chronic interleukin-6 alters NMDA receptor-mediated membrane responses and enhances neurotoxicity in developing CNS neurons. J Neurosci 18, 1044510456.
  • 3
    Ramsay AJ, Husband AJ, Ramshaw IA, Bao S, Matthaei KI, Koehler G & Kopf M (1994) The role of interleukin-6 in mucosal IgA antibody responses in vivo. Science 264, 561563.
  • 4
    Rodriguez Mdel C, Bernad A & Aracil M (2004) Interleukin-6 deficiency affects bone marrow stromal precursors, resulting in defective hematopoietic support. Blood 103, 33493354.
  • 5
    Mollmann H, Nef HM & Troidl C (2010) ‘Turning the right screw’: targeting the interleukin-6 receptor to reduce unfavourable tissue remodelling after myocardial infarction. Cardiovasc Res 87, 395396.
  • 6
    De Jongh RF, Vissers KC, Meert TF, Booij LH, De Deyne CS & Heylen RJ (2003) The role of interleukin-6 in nociception and pain. Anesth Analg 96, 10961103.
  • 7
    Weissenberger J, Loeffler S, Kappeler A, Kopf M, Lukes A, Afanasieva TA, Aguzzi A & Weis J (2004) IL-6 is required for glioma development in a mouse model. Oncogene 23, 33083316.
  • 8
    Sasaki A, Ishiuchi S, Kanda T, Hasegawa M & Nakazato Y (2001) Analysis of interleukin-6 gene expression in primary human gliomas, glioblastoma xenografts, and glioblastoma cell lines. Brain Tumor Pathol 18, 1321.
  • 9
    Waldner MJ, Foersch S & Neurath MF (2012) Interleukin-6 – a key regulator of colorectal cancer development. Int J Biol Sci 8, 12481253.
  • 10
    Wei LH, Kuo ML, Chen CA, Chou CH, Lai KB, Lee CN & Hsieh CY (2003) Interleukin-6 promotes cervical tumor growth by VEGF-dependent angiogenesis via a STAT3 pathway. Oncogene 22, 15171527.
  • 11
    Li R, Li G, Deng L, Liu Q, Dai J, Shen J & Zhang J (2010) IL-6 augments the invasiveness of U87MG human glioblastoma multiforme cells via up-regulation of MMP-2 and fascin-1. Oncol Rep 23, 15531559.
  • 12
    Liu Q, Li G, Li R, Shen J, He Q, Deng L, Zhang C & Zhang J (2010) IL-6 promotion of glioblastoma cell invasion and angiogenesis in U251 and T98G cell lines. J Neurooncol 100, 165176.
  • 13
    Chang CY, Li MC, Liao SL, Huang YL, Shen CC & Pan HC (2005) Prognostic and clinical implication of IL-6 expression in glioblastoma multiforme. J Clin Neurosci 12, 930933.
  • 14
    Prajapati SC & Chauhan SS (2011) Dipeptidyl peptidase III: a multifaceted oligopeptide N-end cutter. FEBS J 278, 32563276.
  • 15
    Simaga S, Babic D, Osmak M, Sprem M & Abramic M (2003) Tumor cytosol dipeptidyl peptidase III activity is increased with histological aggressiveness of ovarian primary carcinomas. Gynecol Oncol 91, 194200.
  • 16
    Shukla AA, Jain M & Chauhan SS (2010) Ets-1/Elk-1 is a critical mediator of dipeptidyl-peptidase III transcription in human glioblastoma cells. FEBS J 277, 18611875.
  • 17
    Van Meir E, Sawamura Y, Diserens AC, Hamou MF & de Tribolet N (1990) Human glioblastoma cells release interleukin 6 in vivo and in vitro. Cancer Res 50, 66836688.
  • 18
    Wang H, Lathia JD, Wu Q, Wang J, Li Z, Heddleston JM, Eyler CE, Elderbroom J, Gallagher J, Schuschu J et al. (2009) Targeting interleukin 6 signaling suppresses glioma stem cell survival and tumor growth. Stem Cells 27, 23932404.
  • 19
    Loeffler S, Fayard B, Weis J & Weissenberger J (2005) Interleukin-6 induces transcriptional activation of vascular endothelial growth factor (VEGF) in astrocytes in vivo and regulates VEGF promoter activity in glioblastoma cells via direct interaction between STAT3 and Sp1. Int J Cancer 115, 202213.
  • 20
    Saidi A, Hagedorn M, Allain N, Verpelli C, Sala C, Bello L, Bikfalvi A & Javerzat S (2009) Combined targeting of interleukin-6 and vascular endothelial growth factor potently inhibits glioma growth and invasiveness. Int J Cancer 125, 10541064.
  • 21
    Yamaguchi T, Naruishi K, Arai H, Nishimura F & Takashiba S (2008) IL-6/sIL-6R enhances cathepsin B and L production via caveolin-1-mediated JNK-AP-1 pathway in human gingival fibroblasts. J Cell Physiol 217, 423432.
  • 22
    Tsui KH, Wang SW, Chung LC, Feng TH, Lee TY, Chang PL & Juang HH (2013) Mechanisms by which interleukin-6 attenuates cell invasion and tumorigenesis in human bladder carcinoma cells. Biomed Res Int 2013, 791212, doi: 10.1155/2013/791212
  • 23
    Mohamed MM, Cavallo-Medved D, Rudy D, Anbalagan A, Moin K & Sloane BF (2010) Interleukin-6 increases expression and secretion of cathepsin B by breast tumor-associated monocytes. Cell Physiol Biochem 25, 315324.
  • 24
    Margulies L & Sehgal PB (1993) Modulation of the human interleukin-6 promoter (IL-6) and transcription factor C/EBP beta (NF-IL6) activity by p53 species. J Biol Chem 268, 1509615100.
  • 25
    Huang Y, Shinzawa H, Togashi H, Takahashi T, Kuzumaki T, Otsu K & Ishikawa K (1995) Interleukin-6 down-regulates expressions of the aldolase B and albumin genes through a pathway involving the activation of tyrosine kinase. Arch Biochem Biophys 320, 203209.
  • 26
    Poree B, Kypriotou M, Chadjichristos C, Beauchef G, Renard E, Legendre F, Melin M, Gueret S, Hartmann DJ, Mallein-Gerin F et al. (2008) Interleukin-6 (IL-6) and/or soluble IL-6 receptor down-regulation of human type II collagen gene expression in articular chondrocytes requires a decrease of Sp1.Sp3 ratio and of the binding activity of both factors to the COL2A1 promoter. J Biol Chem 283, 48504865.
  • 27
    Pascussi JM, Gerbal-Chaloin S, Pichard-Garcia L, Daujat M, Fabre JM, Maurel P & Vilarem MJ (2000) Interleukin-6 negatively regulates the expression of pregnane X receptor and constitutively activated receptor in primary human hepatocytes. Biochem Biophys Res Commun 274, 707713.
  • 28
    Castell JV, Gomez-Lechon MJ, David M, Hirano T, Kishimoto T & Heinrich PC (1988) Recombinant human interleukin-6 (IL-6/BSF-2/HSF) regulates the synthesis of acute phase proteins in human hepatocytes. FEBS Lett 232, 347350.
  • 29
    Andus T, Geiger T, Hirano T, Kishimoto T, Tran-Thi TA, Decker K & Heinrich PC (1988) Regulation of synthesis and secretion of major rat acute-phase proteins by recombinant human interleukin-6 (BSF-2/IL-6) in hepatocyte primary cultures. Eur J Biochem 173, 287293.
  • 30
    Aigueperse C, Val P, Pacot C, Darne C, Lalli E, Sassone-Corsi P, Veyssiere G, Jean C & Martinez A (2001) SF-1 (steroidogenic factor-1), C/EBPbeta (CCAAT/enhancer binding protein), and ubiquitous transcription factors NF1 (nuclear factor 1) and Sp1 (selective promoter factor 1) are required for regulation of the mouse aldose reductase-like gene (AKR1B7) expression in adrenocortical cells. Mol Endocrinol 15, 93111.
  • 31
    Buck M, Zhang L, Halasz NA, Hunter T & Chojkier M (2001) Nuclear export of phosphorylated C/EBPbeta mediates the inhibition of albumin expression by TNF-alpha. EMBO J 20, 67126723.
  • 32
    Carro MS, Lim WK, Alvarez MJ, Bollo RJ, Zhao X, Snyder EY, Sulman EP, Anne SL, Doetsch F, Colman H et al. (2010) The transcriptional network for mesenchymal transformation of brain tumours. Nature 463, 318325.
  • 33
    Dentesano G, Straccia M, Ejarque-Ortiz A, Tusell JM, Serratosa J, Saura J & Sola C (2012) Inhibition of CD200R1 expression by C/EBP β in reactive microglial cells. J Neuroinflammation 9, 165.
  • 34
    Fields J & Ghorpade A (2012) C/EBP beta regulates multiple IL-1beta-induced human astrocyte inflammatory genes. J Neuroinflammation 9, 177.
  • 35
    Luedde T, Duderstadt M, Streetz KL, Tacke F, Kubicka S, Manns MP & Trautwein C (2004) C/EBP beta isoforms LIP and LAP modulate progression of the cell cycle in the regenerating mouse liver. Hepatology 40, 356365.
  • 36
    Smink JJ, Begay V, Schoenmaker T, Sterneck E, de Vries TJ & Leutz A (2009) Transcription factor C/EBPbeta isoform ratio regulates osteoclastogenesis through MafB. EMBO J 28, 17691781.
  • 37
    Trautwein C, Rakemann T, Pietrangelo A, Plumpe J, Montosi G & Manns MP (1996) C/EBP-beta/LAP controls down-regulation of albumin gene transcription during liver regeneration. J Biol Chem 271, 2226222270.
  • 38
    Akira S, Isshiki H, Sugita T, Tanabe O, Kinoshita S, Nishio Y, Nakajima T, Hirano T & Kishimoto T (1990) A nuclear factor for IL-6 expression (NF-IL6) is a member of a C/EBP family. EMBO J 9, 18971906.
  • 39
    Homma J, Yamanaka R, Yajima N, Tsuchiya N, Genkai N, Sano M & Tanaka R (2006) Increased expression of CCAAT/enhancer binding protein beta correlates with prognosis in glioma patients. Oncol Rep 15, 595601.
  • 40
    Ramji DP, Vitelli A, Tronche F, Cortese R & Ciliberto G (1993) The two C/EBP isoforms, IL-6DBP/NF-IL6 and C/EBP delta/NF-IL6 beta, are induced by IL-6 to promote acute phase gene transcription via different mechanisms. Nucleic Acids Res 21, 289294.
  • 41
    Niehof M, Streetz K, Rakemann T, Bischoff SC, Manns MP, Horn F & Trautwein C (2001) Interleukin-6-induced tethering of STAT3 to the LAP/C/EBPbeta promoter suggests a new mechanism of transcriptional regulation by STAT3. J Biol Chem 276, 90169027.
  • 42
    Chen GK, Sale S, Tan T, Ermoian RP & Sikic BI (2004) CCAAT/enhancer-binding protein beta (nuclear factor for interleukin 6) transactivates the human MDR1 gene by interaction with an inverted CCAAT box in human cancer cells. Mol Pharmacol 65, 906916.
  • 43
    Oya M, Horiguchi A, Mizuno R, Marumo K & Murai M (2003) Increased activation of CCAAT/enhancer binding protein-beta correlates with the invasiveness of renal cell carcinoma. Clin Cancer Res 9, 10211027.
  • 44
    Mir RA & Chauhan SS (2011) Down regulation of a matrix degrading cysteine protease cathepsin L, by acetaldehyde: role of C/EBPalpha. PLoS ONE 6, e20768.
  • 45
    Bezerra GA, Dobrovetsky E, Viertlmayr R, Dong A, Binter A, Abramic M, Macheroux P, Dhe-Paganon S & Gruber K (2012) Entropy-driven binding of opioid peptides induces a large domain motion in human dipeptidyl peptidase III. Proc Natl Acad Sci U S A 109, 65256530.
  • 46
    Barsun M, Jajcanin N, Vukelic B, Spoljaric J & Abramic M (2007) Human dipeptidyl peptidase III acts as a post-proline-cleaving enzyme on endomorphins. Biol Chem 388, 343348.
  • 47
    Sato H, Kimura K, Yamamoto Y & Hazato T (2003) Activity of DPP III in human cerebrospinal fluid derived from patients with pain. Masui 52, 257263.
  • 48
    Tchirkov A, Khalil T, Chautard E, Mokhtari K, Veronese L, Irthum B, Vago P, Kemeny JL & Verrelle P (2007) Interleukin-6 gene amplification and shortened survival in glioblastoma patients. Br J Cancer 96, 474476.
  • 49
    Rodriguez-Antona C, Bort R, Jover R, Tindberg N, Ingelman-Sundberg M, Gomez-Lechon MJ & Castell JV (2003) Transcriptional regulation of human CYP3A4 basal expression by CCAAT enhancer-binding protein alpha and hepatocyte nuclear factor-3 gamma. Mol Pharmacol 63, 11801189.