SEARCH

SEARCH BY CITATION

Keywords:

  • Arc protein expression;
  • CA1;
  • CA3;
  • DG hippocampal subfields;
  • ICSS;
  • immunohistochemistry;
  • real-time PCR;
  • synaptic plasticity

Abstract

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. References
  7. Acknowledgments
  8. Supporting Information

Post-training lateral hypothalamus (LH) intracranial self stimulation (ICSS) has a reliable enhancing effect on explicit memory formation evaluated in hippocampus-dependent tasks such as the Morris water maze. In this study, the effects of ICSS on gene expression in the hippocampus are examined 4.5 h post treatment by using oligonucleotide microarray and real-time PCR, and by measuring Arc protein levels in the different layers of hippocampal subfields through immunofluorescence. The microarray data analysis resulted in 65 significantly regulated genes in rat ICSS hippocampi compared to sham, including cAMP-mediated signaling as one of the most significantly enriched Database for Annotation, Visualization and Integrated Discovery (DAVID) functional categories. In particular, expression of CREB-dependent synaptic plasticity related genes (c-Fos, Arc, Bdnf, Ptgs-2 and Crem and Icer) was regulated in a time-dependent manner following treatment administration. Immunofluorescence results showed that ICSS treatment induced a significant increase in Arc protein expression in CA1 and DG hippocampal subfields. This empirical evidence supports our hypothesis that the effect of ICSS on improved or restored memory functions might be mediated by increased hippocampal expression of activity-dependent synaptic plasticity related genes, including Arc protein expression, as neural mechanisms related to memory consolidation.

Intracranial self stimulation (ICSS), a form of deep-brain stimulation with electrodes implanted in specific rewarding areas such as the lateral hypothalamus (LH), has a strong enhancing effect on several kinds of learning and implicit memory in rats (Aldavert-Vera et al. 1997; Coulombe & White 1982; Huston & Mueller 1978; Ruiz Medina et al. 2008b). Over recent years, we have demonstrated that ICSS in the LH is also a very reliable way to improve explicit memory consolidation and behavioral flexibility evaluated in tasks such as delayed spatial alternation (Soriano Mas et al. 2005) and the Morris water maze (Ruiz Medina et al. 2008a). ICSS induces long-lasting structural changes such as increases in dendritic arborization, and spine and synaptic density in hippocampal neurons (Rao 1999). This kind of structural plasticity has been shown to be involved in the neural mechanisms related to memory consolidation (see Morgado Bernal 2011).

At a molecular level, activity-dependent immediate-early gene (IEG) expression is a critical component of the molecular cascades underlying synaptic plasticity and long-term memory formation. In a microarray study by our group (Huguet et al. 2009), performed in the hippocampus 90 min after ICSS treatment, we found numerous overexpressed gene encoding proteins related to signal-transduction machinery that have also been found to be expressed after hippocampal-dependent tasks. These include the c-Fos transcription factor (Fleischmann et al. 2003), prostagladin-endoperoxidase synthase-2 (Ptgs-2) (Teather et al. 2002) and particularly genes such as adenylate-cyclase activating polypeptide1 (Adcyap1) (Chen et al. 2006; Yaka 2003) related to cAMP-dependent signal-transduction machinery that might participate in the signaling of Arc or Bdnf neuroplasticity-associated proteins. However, ICSS induction of Bdnf and Arc expression was not detected after 90 min. An initial objective of this work was to investigate the effects of LH-ICSS on genomic mechanisms in the hippocampus after a greater delay post-treatment, by using oligonucleotide microarrays after 4.5 h post-ICSS. Moreover, since the cAMP/PKA/CREB pathway activation is a specific molecular mechanism involved in memory consolidation in the hippocampus (Bekinschtein et al. 2007), and given that this pathway represents one of the main targets for the development of cognitive enhancers for the treatment of patients with memory dysfunction (Arnsten et al. 2005), a second objective was to compare the c-Fos, Bdnf, Arc, Ptgs-2, Crem and Icer CREB-dependent synaptic plasticity-related IEG mRNA levels at 90 min and 4.5 h post-ICSS by real-time PCR. Finally, we attempted to examine the unexplored effects of ICSS on Arc protein expression, a marker of synaptic plasticity processes occurring during hippocampal memory consolidation (Tzingounis 2006), in CA1, CA3 and DG subfields.

Materials and methods

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. References
  7. Acknowledgments
  8. Supporting Information

Subjects

A total of 74 male Wistar rats from our laboratory breeding stock, with a mean age of 90.1 days (SD = 6.3) at the beginning of the experiments, and a mean weight of 398.7 g (SD = 36.8) at the time of surgery, were used. Rats were singly housed, kept under controlled temperature (21–23°C) and humidity (40–70%), and subjected to a light/darkness cycle of 12/12 h (lights on at 0800 h). All experiments were carried out in compliance with the European Community Council Directive for care and use of laboratory animals (CEE 86/609) and the Generalitat de Catalunya decree (Departament de Medi Ambient. Generalitat de Catalunya, 1995; protocol number 4465).

Experimental groups

The animals were divided in two groups: operated rats receiving ICSS treatment (ICSS group), and operated rats without electrical stimulation (sham group). For microarray analysis we used ICSS (n = 12) and sham (n = 12) rats, sacrificed 4.5 h post-treatment. For real-time PCR we used rats sacrificed 90 min (ICSS: n = 7; sham: n = 7) and 4.5 h (ICSS: n = 11; sham: n = 6) post-treatment. For Arc protein expression by immunofluorescence, we used rats sacrificed 4.5 h post-treatment (ICSS: n = 9; sham: n = 10).

Intracranial self stimulation

Stereotaxic surgery

Under general anesthesia induced by 110 mg/kg Ketolar® (Ketamine hydrochloride, Parke-Davis S.L. Pfizer, Madrid, Spain) and 0.08 ml/100 g Rompun® (Xylazine 23 mg/ml; i.p. Bayer, Barcelona, Spain), ICSS and sham rats were implanted with a monopolar stainless steel electrode (150 µm in diameter) aimed at the LH, with the incisor bar set at −2.7 mm below the interaural line and according to coordinates: AP = −2.56 mm ; L = 1.8 mm (right hemisphere) and P = −8.5 mm (Paxinos & Watson 2007). Electrodes were anchored to the skull with jeweler's screws and dental cement.

ICSS behavior establishment

After a recovery period (7 days), rats in the ICSS group were taught to self-stimulate by pressing a lever in a Skinner box (25 × 20 × 20 cm). Electrical brain stimulation consisted of 0.3-second trains of 50 Hz sinusoidal waves at intensities ranging from 10 and 400 μA. On two consecutive days, the animals were trained in ICSS to establish the individual optimum current intensity (OI) of ICSS, (Segura Torres et al. 1991). The mean of the two current intensities that gave rise to the highest response rate (responses/min) was considered as the OI of ICSS for each rat. Rats in the sham group were allowed to explore the ICSS box for 20 min on two consecutive days, but without ICSS.

ICSS treatment

Twenty-four hours after the last ICSS establishment session, animals in the ICSS group were allowed to self-administer 2500 trains of electrical stimulation at 100% of their OI, parameters that have shown a facilitative effect on both explicit and implicit memory tasks (Segura Torres et al. 2010; Soriano Mas et al. 2005). Animals in the sham group were placed in the ICSS box for 40 min, but did not receive stimulation. After the ICSS or sham sessions, rats were returned to their home cages. Treatment duration and total number of lever pressings in the treatment session were recorded.

Gene expression studies

Brain dissection and RNA isolation

The animals were sacrificed by decapitation 90 min or 4.5 h after the end of the ICSS treatment or the sham session. Brains were immediately removed from the skull and sliced with a brain matrix (Stoelting, Wood Dale, IL, USA). Slices between −2.56 and −3.60 mm anteroposterior to bregma were used to dissect the ipsilateral hippocampi respect to the electrode. Dissected tissue were subsequently stored in RNA (Ambion, Austin, TX, USA) for 48 h at 4°C, and then stored at −20°C. Total RNA extraction and RNA quality assessment were performed as described in Kadar et al. (2011b), giving a RNA integrity number ranking between 9 and 9.50, indicative of high-quality RNA.

Microarray procedures

Four samples of ICSS hippocampi and four samples of sham hippocampi obtained from animals sacrificed 4.5 h after ICSS or sham sessions, were used for gene expression comparisons using oligonucleotide microarray analysis. Each cRNA sample consisted of pooled ipsilateral hippocampi from three rats, with a total of 24 rats being used. A common reference design was used. The tissue used as the reference consisted of contralateral hippocampal, thalamic and cortical brain tissues from ICSS (n = 3) and sham (n = 3) rats. A diagram of the comparisons is shown in Figure S1 of Supporting Information. Each cRNA sample was labeled with Cy5 and hybridized against the reference cRNA labeled with Cy3. Thus, a total of eight rat oligonucleotide microarrays from Agilent (G4130B), containing 44 000 probes were hybridized, scanned and quantified as described in Kadar et al. (2011b). Raw data were corrected for background noise using the normexp method (Ritchie et al. 2007). To correct for overall dye-bias and nonlinear relationships between red-green ratios and average intensities, a Global lowess normalization was applied (intra-chip normalization). A further scaling of the normalized log2 ratios (inter-chip normalization) was applied to assure comparability across samples (Yang et al. 2002). From our common reference design, where each sample was hybridized against a common reference, comparisons between ICSS and sham hippocampi were retrieved by subtracting the corresponding log2 ratio values. Hence, to analyze the differential expression, moderated t-test using limma was performed. Results from the analysis were corrected for multiple testing according to the false discovery rate (FDR) method. All statistical analyses were performed with the Bioconductor project (http://www.cran.r-project.org). Genes showing a fold-change starting from a 1.2 threshold-intensity ratio and with an adjusted P-value < 0.05 were selected as relevant genes. Total data have been deposited in NCBi's Gene Expression Omnibus and are accessible through GEO Series accession number GSE42793 (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE42793).

Gene functional classification

Gene Ontology (GO) analysis of the gene expression changes in rat ICSS hippocampi assayed by microarray was performed using the Database for Annotation, Visualization and Integrated Discovery (DAVID) (http://david.abcc.ncifcrf.gov/tools.jsp). Gene Ontology categories significantly enriched in the sets of ICSS regulated genes were identified by the Functional Annotation Clustering Tool using the Fisher Exact test (EASE Score in DAVID system) and a P-value < 0.05 was used to be considered enriched in the annotation categories.

Real-time PCR analysis

Quantitative real-time PCR were carried out comparing ICSS vs. sham conditions in two different assays. In the first assay, seven candidate regulated genes (Bdnf, Ptgs-2, Crem, Fn1, Coq10, Pld2 and Gdf10) were validated using independent samples from the microarray experiment. The number of samples varied depending on the variability of the expression for each specific gene in ICSS (n = 8 for all genes, except for Crem and Pld2, requiring n = 11 and n = 10, respectively) and sham groups (n = 6). In the second assay, mRNA levels of six well-known neural plasticity related genes (c-Fos, Arc, Bdnf, Ptgs-2, Crem and Icer) were tested comparing the ICSS vs. sham conditions 90 min and 4.5 h after the treatment. The number of samples was n = 7 for sham and ICSS groups at 90 min, and n = 6 for sham and n = 8 for ICSS groups at 4.5 h for all genes, except for Arc and Crem, requiring n = 11. Specific primers were designed with Primer Express 2.0 (Applied Biosystems, Foster City, CA, USA) (see Table 1). Hprt gene was used as a reference gene and this gene did not change its expression level in the study. Reverse transcription from total RNA and real-time PCR reactions were performed as described in Kadar et al. (2011b). The mRNA abundances for each candidate gene were calculated as Relative Transcript Abundance (Pfaffl 2001). Data were analyzed using a one side Mann–Whitney test of ICSS vs. sham log10 of mean fold changes (P < 0.05).

Table 1. Primer sequences used for quantitative real time-PCR assays
Gene name5′–3′ Primer sequenceGenbank ID
  1. Genbank identification available at http://www.ncbi.nlm.nih.gov/.

  2. f, forward primer; r, reverse primer.

Bdnff: TAAAAGGAGCCCCATCACAATCNM_012513
 r: TGCGGAGGGTCTCCTATGAA 
Arcf: GGCATCTGTTGACCGAAGTGTNM_019361
 r: CACATAGCCGTCCAAGTTGTTCT 
Cremf: TTCCTCTGATGTGCCTGGTATTCNM_01110860
 r: TGCCCCGTGCTAGTCTGATAT 
Icerf: CTCTGTATGCAAAAGCCCAACANM_017334
 r: TCTGGTAAGTTGGCATGTCACC 
Ptgs2f: ATCAAATTACCGCTGAAGCCCNM_017232
 r: ATGTTCCAGACTCCCTTGAAGTG 
Coq10bf: CACACCTGAGAGGAAAACGAGAGNM_001009671
 r: TCTCAATAGCTGGTGAAATGGCT 
Fn1f: GGTGACAGTTGGTTGCCCTGNM_019143
 r: GGCTACCTGTGTTTCCCTTTGAT 
Pld2f: GGAAGGCGGAAGAAGGTGTCNM_033299
 r: AGCCACTGTTGATGCCCAAG 
Gdf10f: AATGATCCTCACAGCCACCTTCNM_024375
 r: CAGAATACCTCACGAGCCCG 
Hprtf: AAAGGACCTCTCGAAGTGTTGGNM_012583
 r: AAGTGCTCATTATAGTCAAGGGCA 

Arc immunolocalization

Tissue collection

Animals (ICSS: n = 9; sham: n = 10) were anesthetized with pentobarbital (150 mg/kg body weight, i.p.) and perfused transcardially with a solution of 0.1 m phosphate buffer saline (PBS), pH 7.4, followed by 4% paraformaldehyde in PBS. Brains were post-fixed in 4% paraformaldehyde in PBS and then placed in 30% sucrose in PBS at 4°C until they sank. Serial coronal sections (20-µm-thick) were obtained in a cryostat at −20°C at the coordinates between −2.30 and −3.56 anteroposterior to Bregma, mounted onto SuperFrost/Plus slides (Menzek-Gläser, Braunschweig, Germany) and stored at −80°C.

Immunohistofluorescence staining

Frozen coronal sections were incubated in a solution of citric acid 15 mm pH 6, heated until 95–100°C for antigen retrieval. Sections were treated in glycine 100 mm in 0.1 m PBS for 25 min to decrease background, permeabilized in 0.1% Triton X-100 + 0.1% tri-sodium citrate in PBS, and incubated in normal donkey serum (Jackson Immunoresearch, Laboratories Inc) diluted 1:10 in PBS as a blocking solution. Sections were incubated in anti-Arc mouse monoclonal antibody (Santa Cruz Biotechnology, Santa Cruz, SA, USA; diluted 1:50) for 4 h at room temperature and then in Dy549-conjugated donkey anti-mouse secondary antibody (Jackson ImmunoResearch, Laboratories, Inc, diluted 1:100) for 4 h at room temperature. No staining was observed in control slides without the primary or secondary antibodies.

Quantitative analysis

Microphotographs were captured with a Leica TSC SP2 confocal microscope. Six z-stacks (1.0 µm optical thickness per plane) were collected from every rat with × 20 objective lens. Image J analysis system was employed to assess the fluorescence intensity levels. Levels of Arc-immunofluorescence were averaged from three histological sections for each animal in the different layers of CA1 and CA3, the granule cell layers of medial and lateral blade DG (mbDG and lbDG, respectively), the lbDG molecular layer and the hilus (see Fig. 1).

image

Figure 1. Diagram of the analyzed hippocampal layers with the defined ROIs for each hippocampal subfield studied, in the hemisphere ipsilateral to the ICSS electrode location. The standard placement is superimposed to a coronal section adapted from Paxinos and Watson's atlas (2007), corresponding to coordinate AP −2.8 mm to bregma. The hippocampal layers analyzed in the immunohistochemical study included stratum oriens (so), pyramidal cell layer (spd) and stratum radiatum (sr) of CA3 and CA1 subfields, stratum lucidum of CA3 (CA3-sl) and granular cell layers of lateral blade DG (lbDG-sg) and medial blade DG (mbDG-sg), lbDG molecular layer (lbDG-mo) and the hilus (DG-h).

Download figure to PowerPoint

Statistical analyses

The statistical computer package program PASW Statistics 17.0 (spss) was used to process the data. Multivariant analysis of variance (manova) was performed for statistical comparisons between ICSS and sham groups in each hippocampal subfield and layers. Statistical significance was set at P = 0.05.

Results

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. References
  7. Acknowledgments
  8. Supporting Information

ICSS behavior

As seen in Table 2, subjects treated with ICSS showed no difference in the main parameters of ICSS behavior. Moreover, correlation analyses showed no relationship between the ICSS variables and Arc labeling in any hippocampal subfield. These results imply that neither the motor activity during ICSS treatment (measured as the highest response rate and the total number of lever pressings in the treatment session), nor the intensity of stimulation (OI) seems to determine the expression level of protein examined.

Table 2. Mean values (and standard deviations) of ICSS variables
 ICSS variables
ExperimentOI (µA)Rate (R/min)Treatment duration (min)Total responses
  1. Data are presented as mean fold-change (+ SD).

  2. OI, mean optimum intensity (µA); Rate, mean ICSS rate (R/min) at OI in the ICSS behavior establishment sessions; Treatment duration, mean duration (min) of the ICSS treatment session; Total responses, mean number of lever pressings in the ICSS treatment session.

Gene profiling93.46 (±47.04)69.56 (±20.57)67.14 (±32.27)2909.33 (±215.64)
Real-time PCR (90 min)86.25 (±53.91)76.12 (±19.39)58.50 (±13.01)3174.44 (±330.09)
Real-time PCR (4.5 h)94.39 (±42.01)70.14 (±21.08)61.03 (±12.71)2998.42 (±190.40)
Arc immunolocalization102.34 (±32.56)66.17 (±24.69)69.22 (±36.28)2857.09 (±236.87)

Gene profiling in hippocampus after ICSS

The microarrays revealed a total of 65 different genes differentially expressed in the ICSS vs. sham group. Forty-seven genes were upregulated and 18 were downregulated in the ICSS rat hippocampus compared to sham.

In an updated analysis using the Functional Annotation Clustering Tool DAVID, we identified six significantly enriched annotation clusters in our ICSS differentially expressed gene list. Database for Annotation, Visualization and Integrated Discovery analysis reduced the gene list from 65 to 49 different genes, representing defined or predicted genes that encoded proteins for which a function is known or inferred. The significantly GO terms functional categories and clusters are listed in Table S2, and relevant categories are detailed in Fig. 2.

image

Figure 2. Gene Ontology categories found enriched (P < 0.05) after DAVID analysis in the sets of regulated genes in rat ICSS hippocampi, compared to rat sham hippocampi, after 4.5 h post-treatment. For each category, the gray area represents the genes identified in that category and the black area reflects genes not belonging to that category in the regulated gene set. Details of all enriched GO categories are provided in Table S2.

Download figure to PowerPoint

The most highly enriched annotation cluster associated with ICSS-induced changes (enrichment score: 1.56) included the functional category ‘cAMP-mediated signaling’ (P = 0.018) related to intracellular signaling and transcription regulation, containing genes such as cAMP responsive element modulator (Crem). Interestingly, ‘regulation of synaptic plasticity’ (P = 0.01) and ‘learning or memory’ (P = 0.04) were other specifically enriched functional categories, including upregulated Bdnf, Ptgs-2, adenosine A2a receptor (Adora2a) and interleukin 1 beta (IL-1B). ‘Cell morphogenesis’ (P = 0.008), ‘neuron development’ (P = 0.009) and ‘neuron differentiation’ (P = 0.02) terms were also significantly enriched categories in the sets of regulated genes in rat ICSS hippocampi and included upregulated genes, such as fibronectin-1 (Fn1) and downregulated genes such as phospholipase D2 (Pld2). Other well-represented functional categories included ‘regulation of cell proliferation’ (P = 0.004) and ‘negative regulating functions of cell death’ (P = 0.007).

The results of the quantitative real-time PCR validation study corroborated the observed differential expression caused by ICSS for the seven representative genes arising from our microarray experiment, which included Bdnf (U = 0.000, P = 0.001), Ptgs-2 (U = 2, P = 0.003), Crem (U = 16, P = 0.049), Fn1 (U = 2, P = 0.003), and Coq10 (U = 7, P = 0.029), and Pld2 (U = 12, P = 0.028)] and Gdf10 as five upregulated and two downregulated genes, respectively (Fig. 3).

image

Figure 3. Validation of microarray data by real-time PCR in hippocampus. For the seven genes that had been identified as being differentially expressed in the hippocampus after 4.5 h post-ICSS by microarray analysis, the changes in transcript levels were verified by real-time PCR. The bar-graph depicts the relative hippocampal mRNA expression levels between the ICSS vs. sham conditions for the genes in the microarray study (black areas) and the same genes determined by real time-PCR (gray areas). Data are presented as log10 of mean fold change and standard deviations are indicated with the error bars. For all tested genes, significantly different expression (P < 0.05) in the ICSS vs. sham group was obtained using a one sided Mann–Whitney test (n = 6 or 11, depending on the variability of the expression for each specific gene in ICSS and sham groups).

Download figure to PowerPoint

Hippocampal mRNA levels of synaptic plasticity related genes 90 min vs. 4.5 h after ICSS

mRNA levels of six relevant synaptic plasticity related genes were analyzed by real-time PCR after 90 min and 4.5 h post-ICSS to determine whether their induction was associated with ICSS in a time-dependent manner. Statistical analysis showed significant changes in the expression of the c-Fos, Arc, Bdnf, Ptgs2, Crem and Icer genes 90 min and 4.5 h following ICSS (see Fig. 4). We observed rapid and transient induction of c-Fos (U = 0.000, P = 0.001) and Arc (U = 8, P = 0.035) mRNA in ICSS rat hippocampus with a significant increase only after 90 min post-ICSS. By contrast, Icer and Ptgs-2 induction was maintained at 90 min (U = 1, P = 0.001) and (U = 0.000, P = 0.008), respectively, and 4.5 h (U = 0.000, P = 0.001) and (U = 1, P = 0.001, respectively) after ICSS, and Bdnf (U = 0.000, P = 0.001) and Crem (U = 16, P = 0.049) induction was only obtained at 4.5 h after ICSS.

image

Figure 4. Effects of ICSS on synaptic plasticity related gene expression in the hippocampus. Relative hippocampal mRNA levels for synaptic plasticity in ICSS vs. Control-sham rats at 90 min and 4.5 h after treatment, as determined by RT-PCR assay. Data are presented as mean fold-change (+SD). Number of samples used were n = 6 for sham group and n = 8 for ICSS group for all genes except for Pld2, requiring n = 10, and Arc and Crem n = 11) (*P < 0.05).

Download figure to PowerPoint

Effects of ICSS in the Arc protein expression in hippocampus

We compared the expression of Arc protein in the CA1, CA3 and DG subfields and layers of ICSS and sham rat hippocampus by immunofluorescence staining. Figure 5 shows the mean values of immunofluorescence intensities in each layer from each ipsilateral hippocampal subfield. Multivariant analysis of variance analysis revealed a general statistically significant increase in Arc protein expression in the DG (F1,16 = 4.42; P = 0.05) and CA1 (F1,15 = 10.95; P = 0.005), but not in CA3 in ICSS compared to sham rats. In DG the increase was independent on the layer measured but since the simple effects analyses showed significant differences only in the molecular layer (F1,16 = 5.59; P = 0.031), one could say that although ICSS increases Arc protein expression in the DG globally, the effects are stronger in the molecular layer. In contrast, in CA1 the ICSS treatment lead to a significant increase in Arc protein levels in the three CA1 analyzed layers, pyramidal (F1,15 = 6.68; P = 0.021), oriens (F1,15 = 9.06; P = 0.009) and radiatum (F1,15 = 9.79; P = 0.007). As it can be observed in Fig. 5b, the significant increased expression of Arc protein in CA1 seems to be mainly localized to cytoplasmic prolongations included in CA1 radiatum layer from ICSS rats in contrast to cell bodies (CA1 pyramidal layer) in sham rats. In this sense, the radiatum layer/pyramidal layer fluorescence ratio showed a significantly higher value in ICSS treated rats compared to sham rats (F1,15 = 1.206; P = 0.049) (Fig. 5c).

image

Figure 5. Immunohistochemical analysis of Arc protein levels in the sham and ICSS rat hippocampus. (a) Mean immunofluorescence intensities in each analyzed hippocampal layer (n = 9 in the ICSS and n = 10 in the sham groups). (b) Highly magnified representative immunohistochemistry image of Arc protein expression in the CA1 subfield from one subject from the ICSS group (A) and one from the sham group (B) (× 400, scale bar 50 µm; stereotaxic coordinates AP −2.56 bregma). White arrows indicate some Arc immunoreactive cell bodies, and the black arrow indicates some Arc immunoreactive cytoplasmic prolongations. (c) Mean Arc CA1-sr/CA1-spd fluorescence ratio in ICSS and sham rats. *P < 0.05 vs. sham. Standard deviations are indicated with the error bars.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. References
  7. Acknowledgments
  8. Supporting Information

This report outlines three major observations regarding the molecular effects of ICSS memory-facilitative treatment in rat hippocampus. A single LH-ICSS session causes: (a) increases in the expression of IEGs related to synaptic plasticity and to learning and memory processes after 4.5 h; (b) the regulation of a subset of CREB family-dependent genes (including c-Fos, Arc, Bdnf, Ptgs-2, Crem and Icer) in a time-dependent manner following treatment administration; and (c) a significant induction, 4.5 h after administration, of Arc protein expression in CA1 and DG hippocampal subfields, revealing that ICSS specifically upregulates an effector protein related to morphological changes that underlie the synaptic modification involved in memory consolidation processes.

Although the nature of ICSS behavior makes it difficult to distinguish which components of ICSS are chiefly responsible for the observed results, differences between groups are attributable mainly to brain stimulation more than to the motor activity inherent to ICSS treatment, since no correlation was observed between ICSS-motor variables and Arc-immunofluorescence intensity or any of the genes analyzed by quantitative real-time PCR. In accordance with the idea that operant responding does not seem to be a critical variable, similar patterns of Fos immunoreactivity in self-stimulation and yoked-stimulation groups were observed (Hunt & McGregor 2002). Fos expression did not correlate with bar-pressing rate (Panagis et al. 1997), and both LH self-stimulation and LH experimenter-administration procedures have been shown to facilitate memory (White and Major 1978). All these considerations therefore lead us to believe that, in all probability, the observed effects are mainly due to the electrical brain stimulation of LH.

cAMP-dependent signal-transduction machinery, which included activation of CRE-dependent gene expression, has been seen to be widely involved in the neuronal plasticity underlying learning and memory across species (Wang et al. 2006). Interestingly, the ‘cAMP-mediated signaling’ was most highly enriched annotation cluster associated with ICSS obtained after Functional DAVID analysis of our microarray gene list. ICSS-upregulated genes in this functional category included Crem, a CREB family protein exhibiting transcriptional activator functions, and Adora2a, an adenosine receptor that exerts critical roles in neuronal plasticity (Rebola et al. 2008). In addition, DAVID analysis identified the ICSS-dependent expression of two ‘synaptic plasticity’- and ‘learning and memory’-related IEGs effectors (Bdnf and Ptgs-2) that are also downstream cAMP-inducible genes (Lonze & Ginty 2002). Specifically, further investigation into six synaptic plasticity CRE-related genes revealed that these were ICSS-induced in a time-dependent manner: In accordance with our results showing c-Fos and Arc mRNA induction only at 90 min, a transient early activation (since 30 min to 2 h) of c-Fos and Arc transcription in the hippocampus has also been described after different stimuli such as spatial water maze training (Guzowski 2002; Vazdarjanova et al. 2006). In contrast, Bdnf and Crem showed a slightly delayed mRNA expression that has also been observed following the acquisition of spatial tasks (Lu et al. 2008) or after visual conditioning (Konopka et al. 1998). Ptgs-2, a gene that have been involved in the consolidation of hippocampal-dependent memory (Teather et al. 2002), was induced at the at two-time point analyzed, as well as Icer. Icer is as a potent endogenous repressor of CRE-mediated gene transcription, and it might serve as a gene-controlling mechanism that allows only strong/persistent information to gain access to long-term storage (Borlikova & Endo 2009). Coordinated expression of the target genes in the CREB family-transcription factors may provide synaptic strengthening (Lonze & Ginty 2002). Thus, these genes may well play important roles as IEGs mediating the ICSS facilitation of memory effects in the hippocampus with specific temporal activation.

The ICSS enrichment of other DAVID functional categories such as ‘neuron development’ and ‘neuron differentiation’ also contribute to the idea that ICSS regulates neural plasticity that could either influence memory facilitation or else collaborate in the learning- and memory-restoring capacities of ICSS observed in aging and brain-damaged rats (Aldavert-Vera et al. 1997; Redolar Ripoll et al. 2003).

The critical role of Arc in the maintenance of changes in synaptic efficacy and in the consolidation of long-term memory after the spatial water task (Korb & Finkbeiner 2011) points to Arc as an excellent marker for analyzing the effects of ICSS in synaptic plasticity. Here, an overexpression of Arc protein in CA1 and DG, but not in the CA3 subfields, was observed after 4.5 h following ICSS treatment, indicating an anatomical distribution throughout the different hippocampal subfields after our experimental conditions. We observed ICSS induction of Arc protein later than the Arc mRNA early and transient induction. Other researchers have also found disparities between levels of Arc mRNA and protein (Kelly & Deadwyler 2003; Zalfa et al. 2003), and hippocampal expression of Arc protein has been observed at different time courses (between 30 min and up to 6 h) after different paradigms such as LTP (Messaoudi 2007); contextual fear conditioning (Lee 2004); and spatial exploration (Ramirez Amaya 2005). The region-specific effects of ICSS on Arc protein expression are especially interesting, since CA1, CA3 and DG hippocampal subfields have previously been described to differ in terms of synaptic plasticity mechanisms (Hussain & Carpenter 2005; McBain 2008). Indeed, the CA1 region has been shown to be the most sensitive hippocampal region in Alzheimer's disease (AD) resulting in dendritic spine loss and synaptic alterations (Knobloch 2008) and increasing CREB function in CA1 rescues spatial-memory deficits in a mouse model of AD (Yiu et al. 2011). Interestingly, ICSS specifically induced an increase of the CA1 radiatum/pyramidal Arc expression ratio, suggesting a mobilization of Arc from the soma to the neuronal projections in this hippocampal region. Different behavioral studies show different rules governing synaptic plasticity between layers of CA1, and highlight the importance of the immune-histochemical analysis of the hippocampus subregions (Kitanishi et al. 2009). Our immune-histochemical results are consistent with subregional ICSS-induced differences related to synaptic plasticity, and agree with our recent data (Chamorro López et al. 2012) showing that post-training ICSS facilitates the Morris water maze task and induces long-lasting structural changes, including an increase in dendritic arborization and synaptic density in CA1 measured three and 20 days post-ICSS. An increase in Arc activity may facilitate the dendritic remodeling underlying long-term memory and there is evidence that this specifically targets stimulated dendrite regions (McIntyre et al. 2012).

LH-ICSS induces a widespread increased expression of c-Fos, including LH and other brain areas such as the amygdala (Arvanitogiannis et al. 1997, 2000; Kadar et al. 2011a). ICSS could have activated the hippocampus through its LH direct projections, as the orexin projections, known to affect the reward-related behavior and plasticity underlying learning and memory (Akbari 2011; Peyron 1998). But we cannot rule out the involvement of other indirect projections in the regulation of hippocampal plasticity, such as that from the amygdala, as it has been suggested by McIntyre et al. (2012). Interestingly, different learning paradigms also increase c-Fos, Arc and/or Bdnf expression in the hippocampus and amygdala (Datta et al. 2008). Comparing the present results with our previous findings in the amygdala (Kadar et al. 2011a), ICSS induces a different temporal activation of c-Fos, Arc and Bdnf in these two memory-related regions. Thus, the possibility exists that ICSS could modulate memory through a time-dependent cooperative activation of different memory systems.

In summary, ICSS regulates CRE-dependent genes hippocampal expression and induces Arc protein expression changes between hippocampal layers. The hippocampal ICSS modulation of related learning IEGs may promote plasticity mechanisms that underlie memory consolidation. This hypothesis is also supported by previous structural and behavioral findings showing that ICSS induces CA1 dendritic branching and improves retention at 1, 3 and 10 days post-acquisition of spatial learning in the Morris water maze (Chamorro et al. 2012; Ruiz Medina et al. 2008a). This results also shed new light onto the initial aspects of Huston's Central Theory of Reinforcement (Huston et al. 1977), according to which the ICSS—by means of activating the brain's reward system—would ‘strengthen’ short-term memory trace and, thus, enhance memory consolidation.

References

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. References
  7. Acknowledgments
  8. Supporting Information
  • Akbari, E. (2011) Orexin-1 receptor mediates long-term potentiation in the dentate gyrus area of freely moving rats. Behav Brain Res 216, 375380.
  • Aldavert-Vera, L., Costa-Miserachs, D., Massanes-Rotger, E., Soriano-Mas, C., Segura-Torres, P. & Morgado-Bernal, I. (1997) Facilitation of a distributed shuttle-box conditioning with posttraining intracranial self-stimulation in old rats. Neurobiol Learn Mem 67, 254258.
  • Arnsten, A.F., Ramos, B.P., Birnbaum, S.G. & Taylor, J.R. (2005) Protein kinase A as a therapeutic target for memory disorders: rationale and challenges. Trends Mol Med 11, 121128.
  • Arvanitogiannis, A., Flores, C. & Shizgal, P. (1997) Fos-like immunoreactivity in the caudal diencephalon and brainstem following lateral hypothalamic self-stimulation. Behav Brain Res 88, 275.
  • Arvanitogiannis, A., Tzschentke, T.M., Riscaldino, L., Wise, R.A. & Shizgal, P. (2000) Fos expression following self-stimulation of the medial prefrontal cortex. Behav Brain Res 107, 123.
  • Bekinschtein, P., Cammarota, M., Igaz, L.M., Bevilaqua, L.R., Izquierdo, I. & Medina, J.H. (2007) Persistence of long-term memory storage requires a late protein synthesis- and BDNF- dependent phase in the hippocampus. Neuron 53, 261277.
  • Borlikova, G. & Endo, S. (2009) Inducible cAMP early repressor (ICER) and brain functions. Mol Neurobiol 40, 7386.
  • Chamorro López, J., Miguens, M., Kastanauskaite, A., Morgado-Bernal, I., DeFelipe, J., Aldavert-Vera, L. & Segura-Torres, P. (2012) Post-training intracranial self-stimulation facilitates spatial learning and memory and induces microanatomical changes in hippocampal neurons. FENS Abstract, Volume 6, p113.09.
  • Chen, Y., Samal, B., Hamelink, C.R., Xiang, C.C., Chen, Y., Chen, M., Vaudry, D., Brownstein, M.J., Hallenbeck, J.M. & Eiden, L.E. (2006) Neuroprotection by endogenous and exogenous PACAP following stroke. Regul Pept 137, 419.
  • Coulombe, D. & White, N. (1982) The effect of post-training hypothalamic self-stimulation on sensory preconditioning in rats. Can J Psychol 36, 5766.
  • Datta, S., Li, G. & Auerbach, S. (2008) Activation of phasic pontine-wave generator in the rat: a mechanism for expression of plasticity-related genes and proteins in the dorsal hippocampus and amygdala. Eur J Neurosci 27, 18761892.
  • Fleischmann, A., Hvalby, O., Jensen, V., Strekalova, T., Zacher, C., Layer, L., Kvello, A., Reschke, M., Spanagel, R., Sprengel, R., Wagner, E. & Gass, P. (2003) Impaired long-term memory and NR2A-type NMDA receptor-dependent synaptic plasticity in mice lacking c-Fos in the CNS. J Neurosci 23, 9116.
  • Guzowski, J. (2002) Insights into immediate-early gene function in hippocampal memory consolidation using antisense oligonucleotide and fluorescent imaging approaches. Hippocampus 12, 86.
  • Huguet, G., Aldavert-Vera, L., Kαdαr, E., de Ortiz, S.P., Morgado-Bernal, I. & Segura-Torres, P. (2009) Intracranial self-stimulation to the lateral hypothalamus, a memory improving treatment, results in hippocampal changes in gene expression. Neuroscience 162, 359.
  • Hunt, G.E. & McGregor, I.S. (2002) Contrasting effects of dopamine antagonists and frequency reduction on Fos expression induced by lateral hypothalamic stimulation. Behav Brain Res 132, 187201.
  • Hussain, R. & Carpenter, D. (2005) A comparison of the roles of protein kinase C in long-term potentiation in rat hippocampal areas CA1 and CA3. Cell Mol Neurobiol 25, 649.
  • Huston, J.P., Mueller, C.C. & Mondadori, C. (1977) Memory facilitation by posttrial hypothalamic stimulation and other reinforcers: a central theory of reinforcement. Biobehav Rev 1, 143150.
  • Huston, J.P. & Mueller, C.C. (1978) Enhanced passive avoidance learning and appetitive T-maze learning with post-trial rewarding hypothalamic stimulation. Brain Res Bull 3, 265.
  • Kadar, E., Aldavert Vera, L., Huguet, G., Costa Miserachs, D., Morgado Bernal, I. & Segura Torres, P. (2011a) Intracranial self-stimulation induces expression of learning and memory-related genes in rat amygdala. Genes Brain Behav 10, 69.
  • Kadar, E., Lim, L.W., Carreras, G., Genνs, D., Temel, Y. & Huguet, G. (2011b) High-frequency stimulation of the ventrolateral thalamus regulates gene expression in hippocampus, motor cortex and caudate-putamen. Brain Res 1391, 113.
  • Kelly, M. & Deadwyler, S. (2003) Experience-dependent regulation of the immediate-early gene arc differs across brain regions. J Neurosci 23, 6443.
  • Kitanishi, T., Ikegaya, Y. & Matsuki, N. (2009) Behaviorally evoked transient reorganization of hippocampal spines. Eur J Neurosci 30, 560.
  • Knobloch, M. (2008) Dendritic spine loss and synaptic alterations in Alzheimer's disease. Mol Neurobiol 37, 7382.
  • Konopka, D., Szklarczyk, A.W., Filipkowski, R.K., Trauzold, A., Nowicka, D., Hetman, M. & Kaczmarek, L. (1998) Plasticity- and neurodegeneration-linked cyclic-AMP responsive element modulator/inducible cyclic-AMP early repressor messenger RNA expression in the rat brain. Neuroscience 86, 499.
  • Korb, E. & Finkbeiner, S. (2011) Arc in synaptic plasticity: from gene to behavior. Trends Neurosci 34, 591.
  • Lee, J.L. (2004) Independent cellular processes for hippocampal memory consolidation and reconsolidation. Science 304, 839843.
  • Lonze, B. & Ginty, D. (2002) Function and regulation of CREB family transcription factors in the nervous system. Neuron 35, 605.
  • Lu, Y., Christian, K. & Lu, B. (2008) BDNF: a key regulator for protein synthesis-dependent LTP and long-term memory? Neurobiol Learn Mem 89, 312.
  • McBain, C. (2008) New directions in synaptic and network plasticity—a move away from NMDA receptor mediated plasticity. J Physiol 586, 1473.
  • McIntyre, C., McGaugh, J. & Williams, C. (2012) Interacting brain systems modulate memory consolidation. Neurosci Biobehav Rev 36, 17501762.
  • Messaoudi, E. (2007) Sustained Arc/Arg3.1 synthesis controls long-term potentiation consolidation through regulation of local actin polymerization in the dentate gyrus in vivo. J Neurosci 27, 1044510455.
  • Morgado Bernal, I. (2011) Learning and memory consolidation: linking molecular and behavioral data. Neuroscience 176, 12.
  • Oliveira, T., Chan, R., Tian, H., Laredo, M., Shui, G., Staniszewski, A., Zhang, H., Wang, L., Kim, T., Duff, K., Wenk, M., Arancio, O. & Di Paolo, G. (2010) Phospholipase d2 ablation ameliorates Alzheimer's disease-linked synaptic dysfunction and cognitive deficits. J Neurosci 30, 16419.
  • Panagis, G., Nomikos, G.G., Miliaressis, E., Chergui, K., Kastellakis, A., Svensson, T.H. & Spyraki, C. (1997) Ventral pallidum self-stimulation induces stimulus dependent increase in c-fos expression in reward-related brain regions. Neuroscience 77, 175186.
  • Paxinos, G. & Watson, C. (2007) The Rat Brain in Stereotaxic Coordinates, 6yh edn. Academic Press, New York.
  • Peyron, C. (1998) Neurons containing hypocretin (orexin) project to multiple neuronal systems. J Neurosci 18, 999610015.
  • Ramirez Amaya, V. (2005) Spatial exploration-induced Arc mRNA and protein expression: evidence for selective, network-specific reactivation. J Neurosci 25, 17611768.
  • Rao, B.S. (1999) Increased numerical density of synapses in CA3 region of hippocampus and molecular layer of motor cortex after self-stimulation rewarding experience. Neuroscience 91, 799.
  • Rebola, N., Lujan, R., Cunha, R. & Mulle, C. (2008) Adenosine A2A receptors are essential for long-term potentiation of NMDA-EPSCs at hippocampal mossy fiber synapses. Neuron 57, 121.
  • Redolar Ripoll, D., Soriano Mas, C., Guillazo Blanch, G., Aldavert Vera, L., Segura Torres, P. & Morgado Bernal, I. (2003) Posttraining intracranial self-stimulation ameliorates the detrimental effects of parafascicular thalamic lesions on active avoidance in young and aged rats. Behav Neurosci 117, 246.
  • Ritchie, M., Silver, J., Oshlack, A., Holmes, M., Diyagama, D., Holloway, A. & Smyth, G. (2007) A comparison of background correction methods for two-colour microarrays. Bioinformatics 23, 2700.
  • Ruiz Medina, J., Morgado Bernal, I., Redolar Ripoll, D., Aldavert Vera, L. & Segura Torres, P. (2008a) Intracranial self-stimulation facilitates a spatial learning and memory task in the Morris water maze. Neuroscience 154, 424.
  • Ruiz Medina, J., Redolar Ripoll, D., Morgado Bernal, I., Aldavert Vera, L. & Segura Torres, P. (2008b) Intracranial self-stimulation improves memory consolidation in rats with little training. Neurobiol Learn Mem 89, 574.
  • Segura Torres, P., Portell Cortιs, I. & Morgado Bernal, I. (1991) Improvement of shuttle-box avoidance with post-training intracranial self-stimulation, in rats: a parametric study. Behav Brain Res 42, 161.
  • Segura Torres, P., Aldavert Vera, L., Gatell Segura, A., Redolar Ripoll, D. & Morgado Bernal, I. (2010) Intracranial self-stimulation recovers learning and memory capacity in basolateral amygdala-damaged rats. Neurobiol Learn Mem 93, 117.
  • Soriano Mas, C., Redolar Ripoll, D., Aldavert Vera, L., Morgado Bernal, I. & Segura Torres, P. (2005) Post-training intracranial self-stimulation facilitates a hippocampus-dependent task. Behav Brain Res 160, 141.
  • Teather, L., Packard, M. & Bazan, N. (2002) Post-training cyclooxygenase-2 (COX-2) inhibition impairs memory consolidation. Learn Mem 9, 41.
  • Tzingounis, A.V. (2006) Arc/Arg3.1: linking gene expression to synaptic plasticity and memory. Neuron 52, 403407.
  • Vazdarjanova, A., Ramirez Amaya, V., Insel, N., Plummer, T., Rosi, S., Chowdhury, S., Mikhael, D., Worley, P., Guzowski, J. & Barnes, C. (2006) Spatial exploration induces ARC, a plasticity-related immediate-early gene, only in calcium/calmodulin-dependent protein kinase II-positive principal excitatory and inhibitory neurons of the rat forebrain. J Comp Neurol 498, 317.
  • Wang, H., Hu, Y. & Tsien, J. (2006) Molecular and systems mechanisms of memory consolidation and storage. Prog Neurobio 79, 123.
  • White, N. & Major, R. (1978) Facilitation of retention by self-stimulation and by experimenter-administered stimulation. Can J Psychol 32, 116123.
  • Yaka, R. (2003) Pituitary adenylate cyclase-activating polypeptide (PACAP(1–38)) enhances N-methyl-D-aspartate receptor function and brain-derived neurotrophic factor expression via RACK1. J Biol Chem 278, 96309638.
  • Yang, Y., Dudoit, S., Luu, P., Lin, D., Peng, V., Ngai, J. & Speed, T. (2002) Normalization for cDNA microarray data: a robust composite method addressing single and multiple slide systematic variation. Nucleic Acids Res 30, e15.
  • Yiu, A., Rashid, A. & Josselyn, S. (2011) Increasing CREB function in the CA1 region of dorsal hippocampus rescues the spatial memory deficits in a mouse model of Alzheimer's disease. Neuropsychopharmacology 36, 2169.
  • Zalfa, F., Giorgi, M., Primerano, B., Moro, A., Di Penta, A., Reis, S., Oostra, B. & Bagni, C. (2003) The fragile X syndrome protein FMRP associates with BC1 RNA and regulates the translation of specific mRNAs at synapses. Cell 112, 317.

Acknowledgments

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. References
  7. Acknowledgments
  8. Supporting Information

This research was supported by a MICINN (Ministerio de Ciencia e Innovación, Spain) grant (ref. PSI2009-07491).

Supporting Information

  1. Top of page
  2. Abstract
  3. Materials and methods
  4. Results
  5. Discussion
  6. References
  7. Acknowledgments
  8. Supporting Information
FilenameFormatSizeDescription
gbb12065-sup-0001-TableS1.xlsExcel spreadsheet1204KTable S1. Genes regulated differentially across ICSS and sham groups relative to the reference tissue obtained from microarray data filtered by an adjusted P-value < 0.05 in the moderated t-test analysis corrected according to the FDR method and a fold-change >1.2 or <−1.2.
gbb12065-sup-0002-TableS2.docWord document52KTable S2. Gene Ontology categories found enriched (P < 0.05) after DAVID analysis in rat ICSS hippocampi, compared to rat sham hippocampi, after 4.5 h post-treatment.
gbb12065-sup-0003-FigureS1.tifTIFF image109KFigure S1. Diagram of the comparisons performed in the microarray experiment, where each cRNA sample was hybridized against the reference cRNA.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.