SEARCH

SEARCH BY CITATION

Keywords:

  • Connexins;
  • Gap junctions;
  • 4-AP–induced seizure;
  • Carbenoxolone;
  • Trimethylamine

Abstract

  1. Top of page
  2. Abstract
  3. METHODS
  4. RESULTS
  5. DISCUSSION
  6. CONCLUSIONS
  7. Acknowledgments
  8. REFERENCES

Summary: Purpose: The possible role of gap junctions in the manifestation and control of the duration of seizures was tested on the 4-aminopyridine–induced epilepsy model in rats in vivo, by using electrophysiologic, pharmacologic, and molecular biologic techniques.

Methods: In electrophysiologic experiments, the functional states of the gap junctions were manipulated with a specific blocker (carbenoxolone) or opener (trimethylamine) at the already active focus of adult, anesthetized rats, 60 min after the induction of the first seizure, which was repeated spontaneously thereafter. Semiquantitative reverse transcriptase–polymerase chain reaction (RT-PCR) amplification was used to measure the levels of connexin (Cx) 32, 43, and 36 messenger RNAs (mRNAs) prepared from the areas of the already active primary and mirror foci.

Results: After repeated seizures, the expression levels of Cx32, Cx43, and Cx36 mRNAs at the epileptic foci were increased significantly. Blockade of the gap junctions with carbenoxolone shortened the duration of seizures and decreased the amplitude of the seizure discharges, whereas their opening with trimethylamine lengthened the duration and increased the amplitude. Secondary epileptogenesis was facilitated when the gap junctions were opened.

Conclusions: Our findings support the idea that, in epileptic foci, the gap junctions are involved in the expression of rhythmic ictal discharges and in the control of the duration and propagation of the individual seizures in vivo.

Gap junctions are dynamic structures that can be modulated by a number of intracellular and extracellular factors (1–6). The extent of coupling in the in vitro seizure models (7–10) is periodic: it is increased by alkalinization at the start of a seizure, and decreased as acidification occurs toward the end of an ictal period.

Our previous work (11) revealed noteworthy upregulations of connexin (Cx)32 and Cx43 mRNAs after repeated seizures both at the primary focus (Pf) and at the mirror focus (Mf, homotopic area contralateral to the Pf). Accordingly, we examined whether manipulation of the functional state of the gap junctions with a specific blocker (carbenoxolone) or opener (trimethylamine, TMA) influences the manifestation, duration, and propagation of seizures. We also were interested in whether repeated seizures influence the expression of the Cx36 gene, coding for a gap-junction protein existing predominantly in neuronal cells of the mature brain (13).

METHODS

  1. Top of page
  2. Abstract
  3. METHODS
  4. RESULTS
  5. DISCUSSION
  6. CONCLUSIONS
  7. Acknowledgments
  8. REFERENCES

Short-term electrophysiologic experiments were carried out on adult (30- to 40-day-old) Wistar rats (body weight, 200–250 g) of both genders. The animals were bred and housed under standard living conditions, with normal rat food and water available ad libitum. All experimental procedures were conducted in accordance with the United States Public Health Service's Guidelines for the Care and Use of Laboratory Animals and were approved by the Institutional Animal Care and Use Committee at the University of Szeged.

The experimental procedures have been previously described in detail (11). In brief, under general anesthesia (Nembutal sodium pentobarbital, 50 mg/kg, i.p.), the Pf was induced by the local application of crystalline 4-aminopyridine (4-AP) to the somatosensory cortical surface. Four silver-ball electrodes with an eight-channel electroencephalograph were applied to record electrocortical activity from the Pf and the Mf, and from two other points, to detect the propagation of epileptiform discharges (not shown). The electrophysiologic data were stored in a computer memory with the aid of Digidata 1200B, and analyzed with Mathcad, Origin processing software.

During the experiments, the general state of the rats was checked regularly. At the end of the experiments, the animals were given a lethal dose of anesthetic.

In one group of animals (n = 6), the already active Pf was treated locally with carbenoxolone (10 mM, dissolved in saline), whereas another group (n = 6) received TMA (100 mM dissolved in saline), in both cases, 60 min after the induction of the first seizure. Data collected from the same animals before the application of the drugs served as the control values. In the third group of animals (n = 5), TMA was applied 10 min after a previous application of carbenoxolone, and data were then collected for an additional 60 min in the presence of the two drugs. In all cases, the drugs were applied on top of a piece of filter paper covering the cortical surface, together with the 4-AP.

To detect Cx32-, Cx43-, and Cx36-specific mRNAs, a reverse transcriptase–polymerase chain reaction (RT-PCR)-based strategy was used. Samples were taken from the areas of the Pf and Mf of six rats, 1 h after the onset of the first seizure, as described previously (11). For control values, the identical cortical areas of animals (n = 6) without induced epileptic activity were used.

The primer of Cx43 was slightly modified (12) in this experiment:

  • Cx43F: 5′ TACCACGCCACCACCGGCCCA 3′

  • Cx43R: 5′ GGCATTTTGGCTGTCGTCAGGGAA 3′

The primer of Cx36 (13) was:

  • Cx36F: 5′ GCAGAGAGAACGCCGGTACT 3′

  • Cx36R: 5′ CTTGGACCTTGCTGCTGTGC 3′

Results are given as mean ± SD. Student's t test was used to assess significant differences between the control and experimental groups of data. The level of statistical significance was set at p ≤ 0.05.

The drugs carbenoxolone, TMA, and 4-AP were purchased from Sigma.

RESULTS

  1. Top of page
  2. Abstract
  3. METHODS
  4. RESULTS
  5. DISCUSSION
  6. CONCLUSIONS
  7. Acknowledgments
  8. REFERENCES

In the 4-AP in vivo model, the epileptiform activity usually stabilized considerably during the first 60 min, when 30–40 spontaneous seizures generally followed the first one. As a consequence of the repeated seizures, the mRNA levels for Cx36, Cx32, and Cx43 increased significantly (Fig. 1A) both at the Pf and at the Mf.

image

Figure 1. A: Expressions of Cx36, Cx32, and Cx43 messenger RNAs in the primary focus (Pf) and in the homotopic area (Mf) contralateral to the primary focus, as percentages of control values. B: Effects of carbenoxolone and trimethylamine applied either separately or together on the duration of seizures and on the amplitude of seizure discharges, as percentages of control values. Measurements for (B) were taken for 60 min at the site of Pf. Significance criterion, p ≤ 0.05. *Significant changes.

Download figure to PowerPoint

After blockade with carbenoxolone, a significant reduction in the average duration of the ictal periods occurred (from 49.5 ± 9.0 s, 30 seizures/h, to 23.96 ± 4.38 s, 48 seizures/h) (Figs. 1B and 2A) and in the average amplitude of the seizure discharges (from 1,050 ± 197 to 769 ± 7 μV; Figs. 1B and 2A). The maximal effect of carbenoxolone was detected at 10 min after the application, followed by a slow recovery in both parameters (11). At 60 min of recording, the seizure duration and amplitude were still 30.65% and 16.48%, respectively, below the control values.

image

Figure 2. Comparison of the effects of gap-junction blockade with carbenoxolone and opening with trimethylamine (TMA) on the epileptiform activity. A: 4-Aminopyridine (4-AP)–induced seizure activity before (upper panel) and 10 min after the application of carbenoxolone (lower panel). B: (a) 4-AP–induced seizure activity before and (b, c, d) 30, 50, and 90 min, respectively, after the application of TMA. Arrowheads indicate the application of drugs.

Download figure to PowerPoint

Conversely, when the gap junctions were opened with TMA, giant potentials first appeared in the interictal periods, with gradually increasing frequency (Fig. 2Bb), and the average duration of the seizures increased significantly (from 50.3 ± 2.02 s, 32 seizures/h, to 110 ± 20 s, 14 seizures/h; Figs. 1B and 2Bc). The average amplitude of the epileptiform discharges in the presence of TMA (Fig. 1B) also increased significantly (from 1,029 ± 413 to 1,663 ± 340 μV). The peak effect of TMA was detected 40–50 min after the application, with a still noteworthy facilitation at the end of the recording period. In some cases, the previously alternating ictal and interictal periods were not separated further, the seizures lasting for 20–40 min (Fig. 2Bd). The propagation of the seizure discharges to the homolateral and contralateral areas was highly facilitated (Table 1) when the gap junctions were opened.

Table 1. Probability of mirror focus activation and generalization in controls and under the influence of TMA
 MfGeneralization
  1. Numerals are numbers of animals. Maximum n = 6.

  2. *Significant changes. Significance criterion, p ≤ 0.05.

Control32
After opening of gap junctions6*6*

When TMA was applied after carbenoxolone, the average duration of the seizures and the average amplitude of the seizure discharges were 26.61 ± 3.2 s and 733 ± 240 μV, respectively (Fig. 1B), in contrast to the case when TMA was applied alone (average duration, 110 ± 20 s; average amplitude, 1,663 ± 340 μV; Fig. 1B).

DISCUSSION

  1. Top of page
  2. Abstract
  3. METHODS
  4. RESULTS
  5. DISCUSSION
  6. CONCLUSIONS
  7. Acknowledgments
  8. REFERENCES

The upregulation of Cx32, Cx43, and Cx36 after repeated seizures both at the Pf and at the Mf could be an indication of the increased gap-junctional coupling between different cells (glia/glia, glia/neurons, and neurons/neurons) in the epileptic foci. These data appear to provide support for the idea that long-lasting plastic functional and structural changes can occur locally in the homotopic area contralateral to the Pf, contributing to the development of an independent secondary epileptic focus (14). The involvement of gap junctions could be crucial in sustaining neuronal synchronization in the already active epileptic foci, because their opening or blocking significantly increased or decreased, respectively, the duration of the seizures. Notably decreased amplitudes when the gap junctions were in the closed state and significantly increased amplitudes when they were in the opened state could testify to decreased or increased numbers of cells, respectively, firing synchronously during seizure discharges. The facilitated secondary epileptogenesis occurring when the gap junctions were in the opened state could indicate increased afferent inputs to the Mf, and the more frequent antidromic spike generation of pyramidal cells located in the Mf (14), as well as elevated horizontal propagation ipsilaterally through electrical communication between the neurons.

The fact that the blocking effect of carbenoxolone prevented the full manifestation of the facilitatory effect of TMA favors the possibility that these two drugs converge to the same target (i.e., conformational changes in the gap junctions). Nevertheless, carbenoxolone did not completely prevent the effects of TMA. This can be explained by the different mechanisms of action of these two drugs. As a more traditional gap-junction blocker, carbenoxolone was selected because previous studies showed that it can be used to reduce electrotonic coupling without affecting the intrinsic neuron properties (15–18). Although carbenoxolone also is a mineralocorticoid agonist, Ross et al. (19) suggested that such receptors are not involved in the induction or maintenance of 0-Mg2+/4-AP–induced spontaneous activity. We did not detect obvious changes in basic electrocorticographic activity or in the evoked potentials in response to carbenoxolone. Most of the other gap-junction blockers have neuronal effects other than blockade of the gap junctions. These adverse effects themselves could modify the epileptiform activity considerably and make it difficult to draw direct conclusions on specific effects on gap junctions. Carbenoxolone is thought to be related to glycyrrhetinic acid, which binds directly to the Cx molecule, causing a conformational change and leading to closure of the gap junctions (20). TMA causes intracellular alkalinization, which not only leads to opening of the gap junctions, but also induces intracellular Ca2+ mobilization from the endoplasmic reticulum Ca2+ stores (21).

In vitro studies have demonstrated that the gap-junctional conductance can be dynamically modulated by alteration of the intracellular pH and Ca2+ level (1–6). During individual seizures, a gradual intracellular acidification (7–10) and a decrease in the intracellular Ca2+ level (2,3) have been reported under in vitro circumstances. The present study provided direct evidence that experimental manipulations of the functional state of gap junctions under in vivo conditions significantly modify the expression, the duration, and the propagation of seizures.

CONCLUSIONS

  1. Top of page
  2. Abstract
  3. METHODS
  4. RESULTS
  5. DISCUSSION
  6. CONCLUSIONS
  7. Acknowledgments
  8. REFERENCES

The significantly elevated levels of Cx36 mRNA together with Cx32 and Cx43 mRNAs after repeated seizures suggest a major role of the neuronal gap junctions in exacerbating seizures. The opened state of the gap junctions can contribute to interictal activity, increase the duration of seizures and the amplitude of seizure discharges, and promote secondary epileptogenesis. In contrast, the closed state of the gap junctions can reduce the epileptiform activity and enhance the termination of seizures.

Acknowledgments

  1. Top of page
  2. Abstract
  3. METHODS
  4. RESULTS
  5. DISCUSSION
  6. CONCLUSIONS
  7. Acknowledgments
  8. REFERENCES

Acknowledgment:  This study was supported by OTKA grant T037505. We thank Dr. David Durham for critical reading of the manuscript.

REFERENCES

  1. Top of page
  2. Abstract
  3. METHODS
  4. RESULTS
  5. DISCUSSION
  6. CONCLUSIONS
  7. Acknowledgments
  8. REFERENCES
  • 1
    Chesler M, Kaila K. Modulation of pH by neuronal activity. Trends Neurosci 1992;15: 396402.
  • 2
    Perez-Velazquez JL, Valiante TA, Carlen PL. Modulation of gap junctional mechanisms during calcium-free induced field burst activity: a possible role for electrotonic coupling in epilepsy. J Neurosci 1994;14: 430817.
  • 3
    Jefferys JGR. Nonsynaptic modulation of neuronal activity in the brain: electric currents and extracellular ions. Physiol Rev 1995;75: 68994.
  • 4
    Curtis MD, Manfridi A, Biella G. Activity-dependent pH shifts and periodic recurrence of spontaneous interictal spikes in a model of focal epileptogenesis. J Neurosci 1998;18: 754351.
  • 5
    Rouach N, Glowinski J, Giaume C. Activity-dependent neuronal control of gap-junctional communication in astrocytes. J Cell Biol 2000;149: 151326.
  • 6
    Schmitz D, Schuchmann S, Fisahn A, et al. Axo-axonal coupling, a novel mechanism for ultrafast neuronal communication. Neuron 2001;31: 83140.
  • 7
    Perez Velazquez JL, Carlen PL. Gap junctions, synchrony and seizures. Trends Neurosci 2000;23: 6874.
  • 8
    Xiong ZQ, Saggau P, Stringer JL. Activity-dependent intracellular acidification correlates with the duration of seizure activity. J Neurosci 2000;20: 12906.
  • 9
    Jahromi SS, Wentlandt K, Piran S, et al. Anticonvulsant action of gap junctional blockers in an in vitro seizure model. J Neurophysiol 2001;88: 1893902.
  • 10
    Köhling R, Gladwell SJ, Bracci E, et al. Prolonged epileptiform bursting induced by 0-Mg2+ in rat hippocampal slices depends on gap junctional coupling. Neuroscience 2001;105: 3: 57987.
  • 11
    Szente M, Gajda Z, Said Ali K, et al. Involvement of electrical coupling in the in vivo ictal epileptiform activity induced by 4-aminopyridine in the neocortex. Neuroscience 2002;115: 106778.
  • 12
    Mambetisaeva ET, Gire V, Evans WH. Multiple connexin expression in peripheral nerve, Schwann cells, and Schwannova cells. J Neurosci Res 1999;57: 16675
  • 13
    Condorelli DF, Parenti R, Spinella F, et al. Cloning of a new gap junction gene (Cx36) highly expressed in mammalian brain neurons. Eur J Neurosci 1998;10: 12028.
  • 14
    Szente M, Boda B. Cellular mechanisms of neocortical secondary epileptogenesis. Brain Res 1994;648: 20314.
  • 15
    Draguhn A, Traub RD, Schmitz D, et al. Electrical coupling underlies high-frequency oscillations in the hippocampus in vitro. Nature 1998;394: 18992.
  • 16
    Moortgat KT, Bullock TH, Sejnowski TJ. Gap junction effects on precision and frequency of a model pacemaker network. J Neurophysiol 2000;83: 98497.
  • 17
    Osborne PB, Williams JT. Forskolin enhancement of opioid currents in rat locus coeruleus neurons. J Neurophysiol 1996;76: 155965.
  • 18
    Travagli RA, Dunwiddie TV, Williams JT. Opioid inhibition in locus coeruleus. J Neurophysiol 1995;74: 51828.
  • 19
    Ross FM, Gwyn P, Spanswick D, et al. Carbenoxolone depresses spontaneous epileptiform activity in the CA1 region of rat hippocampal slices. Neuroscience 2000;100: 78996.
  • 20
    Gladwell SJ, Jefferys JGR. Second messenger modulation of electrotonic coupling between region CA3 pyramidal cell axons in the rat hippocampus. Neurosci Lett 2001;300: 14.
  • 21
    Willoughby D, Thomas RC, Schwiening CJ. The effects of intracellular pH changes on resting cytosolic calcium in voltage-clamped snail neurones. J Physiol 2001;503: 40516.