SEARCH

SEARCH BY CITATION

Keywords:

  • Bacterially expressed protein;
  • red sea bream iridovirus;
  • vaccination

ABSTRACT

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGMENT
  7. REFERENCES

Megalocytivirus infections cause serious mass mortality in marine fish in East and Southeast Asian countries. In this study the immunogenicity of crude subunit vaccines against infection by the Megalocytivirus RSIV was investigated. Three capsid proteins, 18R, 351R and a major capsid protein, were selected for use as crude subunit vaccines. High homology among Megalocytivirus types was found in the initial sequence examined, the 351R region. Red sea bream (Pagrus major) juveniles were vaccinated by intraperitoneal injection of recombinant formalin-killed Escherichia coli cells expressing these three capsid proteins. After challenge infection with RSIV, fish vaccinated with the 351R-recombinant bacteria showed significantly greater survival than those vaccinated with control bacteria. The 351R protein was co-expressed with GAPDH from the bacterium Edwardsiella tarda in E. coli; this also protected against viral challenge. A remarkable accumulation of RSIV was observed in the blood of vaccinated fish, with less accumulation in the gills and spleen tissues. Thus, the 351R-GAPDH fusion protein is a potential vaccine against Megalocytivirus infection in red sea bream.

List of Abbreviations: 
ATPase

adenosine triphosphatase

BHI

brain heart infusion

CBB

Coomassie brilliant blue

CRF-1

cloned red sea bream fin cells

E. coli

Escherichia coli

E. tarda

Edwardsiella tarda

FKC

formalin-killed bacterial cells

GAPDH

glyceraldehyde 3-phosphate dehydrogenase

GST

glutathione-S-transferase

HBSS

Hanks’ balanced salt solution

IHV

channel catfish herpesvirus

IPTG

isopropyl β-D-thiogalactopyranoside

ISKNV

infectious spleen and kidney necrosis virus

LB

Lura broth

MCP

major capsid protein

OMP

outer membrane protein

ORF

open reading frame

OSGIV

orange-spotted grouper iridovirus

qPCR

quantitative real-time PCR

RBIV

rock bream iridovirus

RPS

relative percentage survival

RSIV

red sea bream iridovirus

TE

tris-ethylenediaminetetra-acetic acid

Iridoviruses are icosahedral cytoplasmic DNA viruses which infect both invertebrates and vertebrates. The family Iridoviridae includes five genera: Iridovirus, Chloriridovirus, Ranavirus, Lymphocystivirus, and Megalocytivirus (1). Piscine iridoviruses belong to the genera Ranavirus, Lymphocystivirus, and Megalocytivirus. The prevalence of RSIV infection has resulted in great loss of aquacultured red sea bream, Pagrus major, in Japan. RSIV is classified in the genus Megalocystivirus, members of which are currently the most serious viral pathogens of marine fish in East and South-East Asia (2–5). Studies of fish collected from mass deaths occurring in wild and cultured fish species have shown that infection with this virus produces characteristic basophilic inclusion bodies in enlarged cells in their internal organs (3, 6). The incidence of iridovirus infection has been increasing in cultured red sea bream, yellow tail (Seriola quinqueradiata) and amberjack (Seriola dumerili) in Japan (7, 8). In addition, detection of genetically and phenotypically variable iridovirus strains suggests that there are diverse variants in this group of viruses (9–11). There have been some trials to develop RSIV vaccines using formalin-inactivated viruses (12–14), a genetic vaccine (15), and a recombinant yeast cell oral vaccine (16). The formalin-inactivated virus vaccine, which has been commercialized for use with juvenile red sea bream, has shown poor induction of cell-mediated immunity and low immunogenicity (17). Such DNA vaccines also risk environmental damage by introducing viral products to sea water (18). Additionally, in a previous study formalin-inactivated single strain virus vaccines prepared with several strains showed different levels of protection against challenge by a virulent strain (11). It must also be noted that specific immune function in fish is poor compared with mammals. For this reason, many kinds of immune stimulator have been used in an attempt to prevent fish diseases.

Because the red sea bream culture industry is also harmed by bacterial infections such as edwardsiellosis and vibriosis (19), the immunogenic efficacy of bacterial expression of the 37 kDa OMP of E. tarda has also been studied for its antigenic and adjuvant effects (20, 21).

Here we report two methods for developing effective anti-RSIV vaccines. One is a crude subunit vaccine generated from the three structural capsid proteins of Megalocytivirus: the two capsid proteins ORF 11L and ORF 71L and the MCP based on information about the ISKNV gene (22). Proteins ORF 11L and ORF 71L correspond to the ORF 351R and ORF 18R proteins of RSIV, respectively (23). The second is a vaccine produced by fusion of the 37 kDa OMP of E. tarda to the above subunit of RSIV. The onset of immunity and protection by these vaccines was assessed by challenge infection experiments and by assessing the subsequent distribution of RSIV in tissues.

MATERIALS AND METHODS

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGMENT
  7. REFERENCES

RSIV stock and cell line

The RSIV U-6 strain (11) was used for DNA extraction and challenge experiments. The strain was inoculated at a multiplicity of infection of 1.0 into confluent monolayers of CRF-1 in 25 cm2 tissue culture flasks containing 5 ml Eagle's minimum essential medium in HBSS supplemented with 10% FBS, 100 U penicillin/ml, 100 μg/ml streptomycin and 200 μg/ml neomycin and incubated at 24°C for five days, or until maximum cytopathic effect was observed (24).

Bacterial strain and growth conditions

The E. tarda strain EF-1 was used to prepare the 37 kDa OMP-coding DNA. This bacterial strain was precultured for 24 hr at 25°C in brain heart infusion broth (BHI, Difco, Franklin Lakes, NJ, USA). The precultured cells were inoculated into 200 ml BHI broth and cultured at 25°C for 18 hr with shaking. E. coli strain JM109 was used in sub-cloning and E. coli strain BL21 was used in the expression system. Strains of E. coli were cultured in Luria broth (LB, Nacalai Tesque, Tokyo, Japan) with or without agar at 37°C. The culture conditions are described below.

DNA sequencing

DNA was extracted from these iridovirus isolates using proteinase K lysis (8). The PCR products were purified with a commercial kit (EASYTRAP Version 2; TaKaRa Bio, Shiga, Japan) and cloned into a plasmid vector for subsequent transformation of E. coli using a commercial kit (pGEM-T Easy Vector System, Promega, Madison, WI, USA). Plasmid DNA was purified from E. coli cells with a commercial kit (QIAprep Miniprep system, Qiagen, Valencia, CA, USA) and sequences were analyzed by using an automated DNA sequencer ABI Prism 3100-Avant Genetic Analyzer (Applied Biosystems Foster, CA, USA).

Bacterial expression

Expression constructs were generated for RSIV ORF 18R, RSIV ORF 351R, RSIV MCP and E. tarda GAPDH, and the fusion protein 351R-GAPDH was generated with His6 and GST tags. Each gene was cloned as a double-digested pET-41 a(+) vector (Novagen, Madison, WI, USA) after PCR amplification using the primers shown in Table 1. Construction of the fusion protein 351R-GAPDH was performed by amplifying 351R ligated as a pET-41 a(+), and then amplifying GAPDH ligated as a pET-41a (+)-351R. Expression of the pET-41 a(+) gene construct and pET-41 a(+) vector (control) was performed in E. coli strain BL21 cells. Briefly, E. coli strain BL21 was pre-cultured in LB overnight at 37°C, inoculated into LB containing 0.1% kanamycin sulfate (Nakalai Tesque) and cultured at 37°C with shaking. When the optical density had reached about 0.5 (0.4–0.6), IPTG (Nacalai Tesque) was added at a final concentration of 0.1 mM. After 4 hr the bacteria were collected by centrifugation and subjected to SDS-PAGE separation.

Table 1.  Primers used for bacterial expression
Gene namePrimer sequence (5′ to 3′)
  1. Residues in italics in the primer sequences show the cutting site for double-digestion with restriction enzyme.

18R of RSIVggatccATGGACCGCGCCCTTCATAAC
aagcttCACGGAAGGCACGTCTTCTG
351R of RSIVggatccATGGACTATATTGCTGAGCTACCTG
gcggccgcTTGTGTTTTATAATACAGCTTG
380R of RSIVggatccATGTCTGCCATCTCAGGTGC
aagcttCAGGTAGGGAAGCCTGCAG
GAPDH of E. tardaggaattccatatgACTATCAAAGTAGG
ccgctcgagCTTAGAGATGTG
351R for fusion with GAPDHggatccATGGACTATATTGCTGAGCTACCTG
catatgTTGTGTTTTATAATACAGCTTG
SDS-PAGE

The collected E. coli cells were suspended in PBS and disrupted by sonication. The supernatant and pellet fractions of E. coli were separated by centrifugation and each subjected to SDS-PAGE. After electrophoresis, the gels were stained with CBB.

Preparation of vaccine

The overexpressing bacteria were inactivated with 0.3% formalin by incubating for 24 hr at 37°C. The bacterial concentration was determined by spectrometry in which an optical density of 1.0 at 600 nm wavelength was equated to 109 bacteria per ml. The FKC were harvested by centrifugation at 8000 g for 20 min.

Vaccination experiments

Red sea bream juveniles of approximately 10 g body weight were injected intraperitoneally with 400 μg in wet weight of FKC in 100 μl PBS. Three experiments were conducted to evaluate RSIV protein- and GAPDH-expressed E. coli FKC vaccines expressing the RSIV protein and GAPDH, as indicated in Table 2. Experiment 1 was set up to evaluate the efficacy of the vaccines expressing viral proteins, and experiments 2 and 3 were set up for the vaccine produced from the 351R-GAPDH fusion protein. Immunized fish were challenged by intraperitoneal injection with RSIV at 60% lethal concentration after three weeks. The fish were observed for 14–19 days for clinical signs of disease, and any dead fish were collected each day. Statistical analysis was carried out using Fisher's exact test. The RPS (25) was determined by the formula:

Table 2.  Composition of fish groups for vaccine experiments
Experiment numberGroupExpressed antigenNumber of fish in group (fish weight, g)
1r18PpET-41a (+)-18R60(11.7)
r351PpET-41a (+)-351R60 
rMCPpET-41a (+)-MCP60 
Controlempty of pET-41a (+)60 
2r351PpET-41a (+)-351R50(18.9)
rGAPDHpET-41a (+)-GAPDH50 
Fusion PpET-41a (+)-351R-GAPDH50 
Controlempty of pET-41a (+)50 
3r351PpET-41a (+)-351R50(6.2)
rGAPDHpET-41a (+)-GAPDH50 
Fusion PpET-41a (+)-351R-GAPDH50 
ControlPBS50 
4Fusion PpET-41a (+)-351R-GAPDH50(23.0)
Controlempty of pET-41a (+)50 

RPS ={1 − (% mortality of immunized fish/% mortality of control fish)}× 100

Virus distribution

Tissue samples from the blood, gills, head kidneys, livers and spleens of the infected fish were homogenized in PBS and centrifuged at 2500 g for 10 min at 4°C. The supernatants and pellets were digested with protease K (0.2 mg/ml) at 55°C for 2 hr, followed by phenol/chloroform extraction and ethanol precipitation. Genomic DNA in the pellet was dissolved in a TE buffer and used as a template to determine the RSIV ATPase gene by qPCR. Determination by qPCR was performed in triplicate on each sample in 25 μl reaction solution containing 12.5 μl of 2 × TaqMan Universal PCR mix (Applied Biosystems), 2 μl of template DNA, 900 nmol of each primer, forward (GCGGCAAGTCGGTGCTAA) and reverse (CGCGGCGGGAATTATG), and 250 nmol fluorescent probe (FAM-CAAATCTATCATTGCAGCCAAGCGGC-TAMRA), in 96-well optical PCR plates set on an ABI Prism 7300 Sequence Detection System (Applied Biosystems, 11).

The qPCR was standardized using a plasmid described below with serial dilutions. An approximately full-length fragment of the RSIV ATPase gene, containing the full 61 bp target sequence, was used as a specific primer set for the ATPase of this virus. We used this to design the forward (ATGGAAATCCAAGAGTTGTCCCTG) and reverse (TTACACCACGCCAGC CTTG) PCR primers. This region was amplified with Ex Taq polymerase. The amplicon was cloned into a plasmid vector for the subsequent transformation of E. coli using a commercial kit (pGEM-T Easy Vector System, Promega) and purified from E. coli cells with a commercial kit (QIAprep Miniprep system, Qiagen). The purified plasmid DNA concentration was determined using a competitive PCR with a commercial kit (Competitive DNA Construction Kit; TaKaRa Bio). Serial dilution was used to prepare standards ranging in concentration from 101 to 108 copies per μl. qPCR was performed on these standards and linear regression was used to create a standard curve for interpolating the concentrations of unknown samples. Variability in the qPCR was measured as the square of Pearson's product-moment correlation coefficient (r2) describing the relationship between the known concentrations of standards and their concentrations inferred by qPCR. Statistical analysis was carried out using the Mann–Whitney U-test.

Nucleotide sequence accession number

The nucleotide sequences of the two RSIV capsid proteins ORF 18R and ORF 351R were deposited in GenBank database under accession numbers AB518696 and AB518697, respectively.

RESULTS

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGMENT
  7. REFERENCES

Homology of viral proteins

We determined the sequences of the three RSIV capsid proteins (ORF 18R, ORF 351R and MCP) used as subunit vaccines by assessing on partial or complete sequences of 630 bp (on 1654 bp), 258 bp and 1362 bp (ORF 380R), respectively. They were compared with other megalocytiviruses, RBIV (GenBank accession no. AY532606) (26), OSGIV (GenBank accession no. AY894343) (27) and ISKNV (GenBank accession no. NC_003494) (22) (Table 3). The region MCP (ORF 380R) of RSIV U-6 was highly homologous with these three megalocytiviruses. The region 351R showed 100% homology of amino acids with OSGIV and ISKNV; however, there was no corresponding ORF in RBIV. Region 18R showed lower homology values with these megalocytiviruses than did the 351R and 380R regions.

Table 3.  Homology of the expressed region from RSIV U-6 with the corresponding ORF of rock bream iridovirus, orange spotted grouper iridovirus, and infectious spleen and kidney necrosis virus
Expressed regionRBIVOSGIVISKNV
ORFNucleotide) (%)Amino acid (%)ORFNucleotide (%)Amino acid (%)ORFNucleotide (%)Amino acid (%)
18R68L67.869.571L91.191.871L92.295.4
351R   13L10010011L96.1100
380R7L99.999.67L99.91006L95.098.7

Bacterial expression

The RSIV ORF encoding 18R, 351R and MCP were overexpressed as His6 and GST-tagged fusion proteins in E. coli. Bands corresponding to the fusion protein were observed at the expected sizes in a SDS-PAGE gel (Fig. 1). These expressing clones were cultured and inactivated with formalin, and the FKC preparations were used as intraperitoneal injection vaccines in experiment 1 (Table 2).

image

Figure 1. Coomassie stained SDS-PAGE gel of E.coli-overexpressed RSIV 18R in pET-41 a, RSIV 351R in pET-41 a, RSIV MCP in pET-41 a, E. tarda GAPDH in pET-41 a, 351R + GAPDH in pET-41 a and empty pET-41 a. Numbers on the left side indicate the positions of markers, and black right-sided arrows indicates the overexpression products. Lane M, size markers (kilodaltons); lane 1, RSIV 18R; lane 2, RSIV 351R; lane 3, RSIV MCP; lane 4, E. tarda GAPDH; lane 5, 351R + GAPDH; lane 6, pET-41a.

Download figure to PowerPoint

Vaccine efficacy of viral protein coding genes

The fish survival profile is shown in Figure 2, which shows the vaccination potential of the recombinant RSIV capsid proteins r18P, r351P, and rMCP. The negative controls (vaccinated with vector pET-41 a[+]), had a survival rate of 32%. Vaccination with rMCP also resulted in a low survival rate of 27%, indicating that no significant protection was induced by this protein. However, vaccination with r18P and r351P resulted in greater survival rates of 45% and 52% compared with vaccination using an empty vector. The survival rate of the r351P-vaccinated group was significantly greater than that of the control group. Randomly collected fish from those which had survived after this experiment had finished were examined for the presence of RSIV in the spleen, and all tested fish proved negative.

image

Figure 2. Time-mortality relationship of vaccination experiment 1. Cumulative mortality rates of red sea bream juvenile from the experimental groups vaccinated with r18P, r351P, MCP, and control as indicated in Table 1 are plotted against the time after challenge. *, significantly different from the control group (Fisher's exact test P < 0.05); ▴, vaccinated with r18P; ▪, vaccinated with r351P; ◆, vaccinated with MCP; ○, control.

Download figure to PowerPoint

Vaccine efficacy of the fusion protein 351R-GAPDH

As the initial vaccination with r351P showed protective effects against RSIV challenge, the effect of this protein fused with E. tarda GAPDH was investigated further. Single bands of the fusion proteins 351R-GAPDH and GAPDH were observed at the expected positions by SDS-PAGE (Fig. 1). Bacteria overexpressing the fusion protein cells were inactivated and used as a vaccine in experiments 2 and 3 (Table 2). The survival profile of the tested fish is shown in Figure 3. In experiment 2, the negative control group (vaccinated with the empty pET-41a [+] vector) had a survival rate of 64%. Fish vaccinated with r351R-GAPDH, rGAPDH, and r351P had greater survival rates (92%, 94%, and 86%, respectively) compared with the controls. Corresponding RPS values obtained for the r351R-GAPDH, rGAPDH, and r351P vaccines were 76%, 82%, and 58%, respectively. In experiment 3, the negative control group (vaccinated with PBS) had a survival rate of 38%. Fish vaccinated with r351R-GAPDH, rGAPDH, and r351P had greater survival rates (70%, 62%, and 54%, respectively) compared with the controls. Corresponding RPS values obtained for the r351R-GAPDH, rGAPDH, and r351P vaccines were 52%, 39%, and 26%, respectively. Significant differences were observed in the fish groups of both experiments vaccinated with 351R-GAPDH and rGAPDH compared with the controls. All of the randomly selected surviving fish proved negative for the presence of RSIV.

image

Figure 3. Time-mortality relationship of (a) vaccination experiment 2 and (b) vaccination experiment 3. Cumulative mortality rates of red sea bream juvenile from the experimental groups vaccinated with r351P, rGAPDH, fusion P, and control as indicated in Table 1 are plotted against the time after challenge. *, significantly different from the control group (Fisher's exact test P < 0.05); ▪, vaccinated with r351P; ◆, vaccinated with rGAPDH; ▴, vaccinated with fusion P; ○, control.

Download figure to PowerPoint

Viral accumulation and proliferation in organs (the blood, gills, head kidneys, livers, and spleens) at an early phase of RSIV infection is shown in Figure 4. Fish vaccinated with the fusion protein showed significantly smaller viral genome values in the gills compared with the control fish vaccinated with empty vector pET-41a (+) at 168 hr after challenge (U-test P < 0.05). However, the vaccinated fish showed significantly greater viral genome values in the blood than the controls. No significant differences were observed in the head kidneys, livers or spleens.

image

Figure 4. Rate of viral production for infected RSIV in the tissue of red sea bream vaccinated with fusion P or control. Virus genome values were measured by real-time qPCR with total blood, gill, head kidney, liver, and spleen. Points represent average values across three replicate fish from each group. *, significantly different between control group and vaccinated with 351R-GAPDH group (U-test P < 0.05).

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGMENT
  7. REFERENCES

In this study, we investigated whether viral proteins could induce on immune response in red sea bream leading to protection against RSIV infection. Viral protein-expressing inactivated bacteria were chosen as vaccines because practical fish vaccines need to be cheap to produce (27). Moreover, bacterial proteins are expected to act as an adjuvant in the immune response to a viral vaccine. We selected the 18R, 351R and MCP regions of RSIV for use in the component vaccines because these are located in a conserved transmembrane domain, composing the viral capsid. Such RSIV capsid regions are immunogenic and protect against viral challenge when used as DNA (15) and recombinant protein vaccines (28). For other fish DNA viruses, a protective immune response has been reported for channel catfish herpesvirus (IHV-1) when the DNA vaccine of this virus has expressed an envelope protein and a presumptive membrane protein (29).

In this study, we found that the RSIV 351R protein component showed protective antigenicity against viral infection when used as a bacterially expressed vaccine (30). As the 351R-negative vector did not show protection, this effect was regarded as being specific to 351R. The region 351R of RSIV was shown to be 100% homologous in amino acid sequence with OSGIV and ISKNV, which have been classified in a different genogroup by a phylogenetic analysis of ATPase and MCP (24, 31). The corresponding gene arrangement is highly preserved in RBIV. However, 351R did not show any such correspondence. Although the function of 351R is not clear, it may have some important roles because it is highly conserved in some megalocytiviruses. In this study, the bacterially expressed MCP component vaccine did not show protective effects. However, this result differs from other studies where the MCP was protective against viral challenge when used as a DNA vaccine (15) or as a recombinant protein vaccine (29). From the present study, the MCP of RSIV might not be a suitable candidate vaccine antigen.

The variety of recognized IgM antigens is around 90 in fish, which is remarkably low (32,33). Therefore, we used GAPDH of E. tarda as an immuno-stimulator. Previous reports have shown that the GAPDH of E. tarda has protective efficacy against edwardsiellosis (20, 34) and vibriosis (21). The present finding that GAPDH protects against RSIV infection may indicate that it has an immune modulating effect. Moreover, the fusion protein 351R-GAPDH showed a greater protective effect against RSIV challenge than did the protein 351R. This result demonstrates that the fusion protein 351R-GAPDH will possibly be an effective vaccine against fish Megalocytivirus infection.

Viruses showed remarkable accumulation in the blood of vaccinated fish in this study. On the other hand, vaccinated fish showed less accumulation in the gills and spleen compared with controls. Following Megalocytivirus infection, diseased fish show numerous viral accumulations in the spleen, kidney (35, 36) and gills (37). The smaller viral accumulation in organs with high susceptibility might have led to increased survival. The results suggest that RSIV is trapped and neutralized by blood-borne antibodies, blocking further spread of the virus to other organs.

ACKNOWLEDGMENT

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGMENT
  7. REFERENCES

This research was supported by a Research for Promoting Technological Seeds grant from the Japan Science and Technology Agency.

REFERENCES

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGMENT
  7. REFERENCES