SEARCH

SEARCH BY CITATION

Keywords:

  • codetection;
  • human bocavirus;
  • real-time PCR;
  • young children

ABSTRACT

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. Discussion
  6. ACKNOWLEDGMENTS
  7. REFERENCES

HBoV was initially identified in patients with RTI in 2005. Since its discovery, there have been continual reports concerning HBoV detection and its prevalence. In this study of clinical specimens from young children, real-time PCR was undertaken to examine whether HBoV infection is associated with RTI and to support quantitative analysis of HBoV in these patients. In all, 376 specimens were collected from patients with RTI during April 2006–October 2008. Analyses revealed HBoV in 59 specimens (15.7%). Of HBoV-positive patients, children under the age of 3 years comprised 94.9%. Of the HBoV-positive samples, 47.5% were codetected with other respiratory viruses (dual infection, 27; triple infection, 1). During the study period, the numbers and rate of detection of HBoV were high mainly around May. Statistical analyses showed that the detection rate of HBoV during April–June was higher than during other months. Moreover, the viral load was greater in subjects with infection with HBoV alone than in subjects with mixed respiratory viral infections. Considering these results together, HBoV is probably associated with RTI in young children. However, the pathogenesis of this infection and the importance of the high rate of co-infection remain uncertain. Additional epidemiologic information and further analyses are necessary to clarify the virological characteristics and the linkage of HBoV to disease.

List of Abbreviations: 
ANOVA

analysis of variance

FLU

influenza

FLUAV

influenza A virus

FLUBV

influenza B virus

GLMM

generalized linear mixed model

HAdV

human adenovirus

HBoV

human bocavirus

HEV

Human enterovirus

HMPV

human metapneumovirus

HPIV

human parainfluenza virus

MDCK

Madin-Darby canine kidney

MEM

minimum essential medium

RSV

respiratory syncytial virus

RTI

respiratory tract infection

In 2005, HBoV was identified by a Swedish research group in patients with RTI (1). HBoV is classified as a member of the family Parvoviridae, subfamily Parvovirinae, and genus Bocavirus. Subsequent research has shown that HBoV is endemic throughout the world (2). Although isolation of the virus using cultured cells has been accomplished using human tracheal primary epithelial cells (3), animal models for this viral infection have not been developed (4). Consequently, the pathogenesis of this infection has remained unclear. Most children show seroconversion against HBoV before six years of age (5). In some young patients with RTI, no respiratory virus other than HBoV has been found (median age 9.0 months [range, 3–17 months] in Germany, and median age 1.6 years [range, 3 months–15 years] in Finland) (6, 7). Otherwise healthy people have not been shown to carry HBoV (8, 9). In contrast, some research groups have reported that HBoV is common among asymptomatic infants or asymptomatic hospitalized children (10, 11). Patients with HBoV show a high incidence of co-infection with other respiratory viruses (5–83%) (2). Furthermore, HBoV has been detected in serum samples and is reportedly a systemic infection (6, 12).

Although methods for isolation of this virus have been reported (3), gene amplification tests are a highly specific and sensitive method for detecting HBoV in clinical specimens. Therefore, PCR or real-time PCR has been used for HBoV detection. This study surveyed whether HBoV is associated with RTI, especially in young children, and examined whether the viral load is associated with co-infection with other respiratory viruses.

MATERIALS AND METHODS

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. Discussion
  6. ACKNOWLEDGMENTS
  7. REFERENCES

Clinical specimens

Three hundred and seventy-six clinical specimens derived from 370 patients (226 male; 138 female; 6 unknown) with RTI were collected during April 2006–October 2008 from pediatric sentinel clinics participating in a virus surveillance system established in Osaka City, Japan. The specimens comprised 200 of nasal mucus, 85 of sputum, 77 throat swabs, 9 tracheal aspirates, 3 of cerebrospinal fluid, and 2 of mouth wash. Specimens derived from outbreaks at infant nurseries or elementary schools were excluded. The age distribution of patients was as follows: <6 months, n= 49; 6–11 months, n= 83; 1–2 years, n= 124; 3–4 years, n= 39; 5–9 years, n= 45; 10–15 years, n= 14; >15 years, n= 8; and unknown, n= 14.

Extraction of viral nucleic acids

Viral nucleic acid was extracted from the specimens using a QIAamp Viral RNA Mini Kit (Qiagen, Valencia, CA, USA) according to the manufacturer's instructions. As described in a previous report, this kit is useful for the simultaneous extraction of RNA and DNA (13).

Gene amplification tests for respiratory viruses

Firstly, a real-time PCR method for the HBoV NP-1 gene (TaqMan Universal PCR Master Mix; Applied Biosystems, Foster City, CA, USA) was developed. The oligonucleotide primer pairs and TaqMan probe were designed (Sigma-Aldrich, Tokyo, Japan) as follows: HBoV 2693f, 5′-GTCAACACAGAGCTTCCAATCC-3′ (corresponding to 2 693–2 714 nt of ST2 strain [GenBank accession No. NC_007455] which is one prototype of HBoV), HBoV 2781r, 5′-TGAATTAGTACCATCTCTAGCAATGC-3′ (2 756–2 781 nt); and HBoV 2724-TP, 5′-(FAM) AGTGCCAGTAGAACCCACACCACCCT (BHQ-1)-3′ (2 724–2 749 nt). The final concentrations of each primer and probe were 900 nM and 250 nM, respectively. The real-time PCR conditions were 50°C for 2 min and then 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min using a sequence detection system (ABI Prism 7700; Applied Biosystems). The PCR-amplified complete NP-1 gene (GenBank accession No. AB481080) was purified and quantified to produce a standard curve. To examine other respiratory viruses such as RSV, HMPV, and HPIV types 1–3, gene amplification was performed for RSV and HMPV as described elsewhere (14). Hemagglutinin-neuraminidase genes of HPIV types 1–3 were targeted using the following oligonucleotide primer pairs: HPIV-1f, 5′-ATAGGCCAAAGATTGTTGTC-3′ (corresponding to 8 077–8 096 nt [GenBank accession No. NC_003461]) and HPIV-1r, 5′-GTGGTTGTAGCAACATTGAC-3′ (8 367–8 386 nt) for HPIV-1; HPIV-2f, 5′-GTAATCTAGTTATGTTTAAC-3′ (7 955–7 974 nt [GenBank accession No. NC_003443]) and HPIV-2r, 5′-CATTGCATGGCATGACTCCA-3′ (8 160–8 179 nt) for HPIV-2; and HPIV-3f, 5′-TACAGATGTATATCAACTGTGTTC-3′ (7 591–7 614 nt [GenBank accession No. NC_001796]) and HPIV-3r, 5′-GACCATCCTYCTRTCTGAAAACCA-3′ (7 916–7 939 nt) for HPIV-3. The PCR conditions were as follows: 94°C for 2 min, followed by 50 cycles at 94°C for 30 s, 55°C for 30 s, 72°C for 1 min, and final elongation at 72°C for 5 min.

Virus isolation tests

All samples, except for those from patients with suspected FLU virus infection, were examined using virus isolation tests with Vero and RD-18S cells, which were maintained in MEM supplemented with 1% FBS under a 5% CO2 humidified atmosphere at 35°C. For patients who were diagnosed as having FLU, isolation was performed using Vero and MDCK cells. The MDCK cells were cultured in MEM supplemented with 1% FBS and 1% trypsin under a 5% CO2 humidified atmosphere at 35°C. A week after inoculation of clinical specimens, the supernatant was inoculated into fresh cells, with subsequent incubation for one more week. When cytopathic effects were observed, virus identification tests were conducted using specific antibodies.

Statistical analysis

The probability of HBoV detection was analyzed using a GLMM (15) to test whether the probability of virus detection was higher during April–June than in other months. First, data were separated into two levels according to the season: data obtained during April–June, and those obtained during other months. In the GLMM, detected or not-detected was incorporated as a dependent variable and the season was included as a fixed effect. Random variation was assumed to exist among years and months. For that reason, a dummy variable representing each month was incorporated as a random effect into the GLMM. Modeling with such a random effect estimates the fixed effect conservatively and engenders more rigid comparison than estimation without it (16). The link function was logit. The error structure was assumed to be binomial. In the GLMM, model fitting was performed using Laplace approximation. The effect of codetected viruses on the HBoV viral load was analyzed using two-way ANOVA. For these analyses, data derived from tracheal aspirate samples were not used because HBoV was detected in only one such sample. The viral load of HBoV was not normally distributed (one-sample Kolmogorov–Smirnov test, D= 0.434, P < 0.001). It was therefore log-transformed before analyses. After transformation, the distribution was found not to differ significantly from a normal distribution (D= 0.124, P= 0.3289). Dual and triple infections were pooled into the category of “multiple infections.” Independent variables (factors) included co-infection (two levels: single and multiple), specimen types (three levels: nasal mucus, sputum, and throat swabs), and their interactions. All analyses were conducted using software (R ver. 2.7.0) (17). The analysis with GLMM was done using the lme4 package.

RESULTS

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. Discussion
  6. ACKNOWLEDGMENTS
  7. REFERENCES

Detection of HBoV in RTI samples

Of the 376 clinical specimens from RTI patients, 59 (15.7%) were HBoV positive, comprising 38 of nasal mucus, 14 of sputum, 6 throat swabs, and 1 tracheal aspirate (Table 1). The detection rate was highest for nasal mucus (19.0%) and sputum samples (16.5%). Approximately 95% (56/59) of HBoV-positive specimens were from children younger than 3 years, including 61.0% (36/59) from 1–2-year-olds and 28.8% (17/59) from 6–11-month-olds. The detection rates in 6–11-month-olds and 1–2-year-olds were, respectively, 20.5% (17/83) and 29.0% (36/124) (Table 2). Half of the HBoV-positive specimens from 1–2-year-olds were codetected with other respiratory viruses. These results suggest that HBoV is associated with RTI in young children, especially those aged 2 years and younger.

Table 1.  Results of HBoV detection in specimens from patients with RTI
 Specimen typeNumber testedHBoVRate (%)
Respiratory tract infectionsNasal mucus2003819.0
Sputum 851416.5
Throat swab 77 6 7.8
Tracheal aspirate  9 111.1
Cerebrospinal fluid  3 0 0
Mouth wash  2 0 0
Total3765915.7
Table 2.  Age distribution of HBoV-positive patients
AgeNumber testedHBoVDetection rate (%)Co-infection
  1. m, months; y, years.

< 6 m 49 3 6.1 1
6–11 m 831720.5 6
1–2 y1243629.018
3–4 y 39 0 0 0
5–9 y 45 0 0 0
10–15 y 14 0 0 0
> 15 y  8 112.5 0
Unknown 14 214.3 2

Monthly detection of HBoV

Monthly detection of HBoV during April 2006–October 2008 is shown in Table 3. The maximum number was in May in each of the years assessed (10 in 2006, 5 in 2007, and 11 in 2008). No HBoV was detected from September 2006–March 2007, August–December 2007, or in August 2008. The detection rates were highest in May 2006 (43.5%), April 2007 (50.0%), and March 2008 (31.6%). The expected probability of HBoV detection as inferred from GLMM analysis results for April–June was estimated as 23.3%, while that during other months was 6.5%. This difference was statistically significant (GLMM, Z=−3.385, P < 0.001). The odds ratio for HBoV detection during April–June as compared with other months was 4.34. The 95% confidence interval was 1.85–10.14 (Fig. 1).

Table 3.  Monthly detection of HBoV from RTI patients between April 2006 and October 2008
YearMonthHBoV/Number testedRate (%)
2006 45/3215.6
 510/2343.5
 61/714.3
 71/812.5
 81/425.0
 90/40
100/30
110/20
120/20
2007 10/90
 20/120
 30/120
 43/650.0
 55/1435.7
 62/633.3
 71/425.0
 80/10
 90/10
100/30
110/40
120/110
2008 12/1513.3
 21/156.7
 36/1931.6
 46/3616.7
 511/4126.8
 61/234.3
 71/156.7
 80/70
 91/185.6
101/195.3
image

Figure 1. Comparison of expected probabilities of HBoV detection rates during April–June with other months estimated using GLMM. Expected probabilities of HBoV detection in April–June and other months are shown. Closed circles represent estimated values. Bars represent the standard error.

Download figure to PowerPoint

Codetection of HBoV with other respiratory viruses

Of the 59 HBoV-positive specimens, in 31 (52.5%) HBoV alone was detected (Table 4). Another 27 showed dual infections with other viruses, while the remaining one showed a triple infection. The dual infections were various combinations of eight respiratory viruses (HPIV-3, 11; HMPV, 6; HPIV-1, 2; RSV, 2; FLUBV, 2; HEV, 2; FLUAV, 1; HAdV, 1). The triple infection was a combination of HPIV-3 and HMPV. Both FLUAV and FLUBV were isolated using MDCK cells; HAdV and HEV were isolated using Vero cells.

Table 4.  Incidence of HBoV codetection with other respiratory viruses
 Co-infected virusesNumber of specimensRatio (%)
HBoV alone 3152.5
DualHPIV-311 
HMPV 6 
HPIV-1 2 
RSV 245.8
FLUBV 2 
HEV 2 
FLUAV 1 
HAdV 1 
TripleHPIV-3, HMPV 11.7
Total 59 

HBoV viral load larger in single infection as opposed to mixed infection

The viral loads for each HBoV-positive sample are presented in Figure 2. The HBoV DNA genome loads in single infections were 3.5 × 103–4.5 × 1010 copies/ml (average, 3.5 × 109; median, 9.2 × 106). The loads in multiple infections were 5.6 × 102–1.5 × 109 copies/ml (average, 1.0 × 108; median, 2.2 × 105). Two-way ANOVA results indicated that the viral load of HBoV was significantly affected by co-infection and specimen type (Table 5, co-infection: F1,52= 5.719, P= 0.0204, specimen type: F52,2= 3.601, P= 0.0343).

image

Figure 2. Viral load of HBoV in clinical specimens in single and multiple infections. Viral loads of the 59 HBoV-positive specimens were assayed using real-time PCR. Each sample is represented by a single dot. Bars represent median values for positive samples.

Download figure to PowerPoint

Table 5.  ANOVA table of the effect of co-infection and specimen type on viral load of HBoV
SourcedfSum of squareMean squareFP
Co-infection 1 123.27123.275.7190.0204
Specimen type 2 155.24 77.623.6010.0343
Interaction 2  27.73 13.860.6430.5297
Residuals521120.71 21.55  

For co-infection, the HBoV viral load was larger in single infections (log-transformed mean ± standard error estimated using two-way ANOVA: 15.757 ± 1.126) than in multiple infections (11.575 ± 1.515).

Discussion

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. Discussion
  6. ACKNOWLEDGMENTS
  7. REFERENCES

To date, Koch's postulates have not been fulfilled for HBoV. The pathogenesis of this infection has not been elucidated because no animal model has been established (4). The results of the present study show that infection with HBoV alone accounted for approximately half of the HBoV-positive specimens. This finding supports the linkage of HBoV to RTI. Another research group has also reported that HBoV was the only detected virus, and that it might be partially responsible for the development of acute RTI in some patients (18). The detection rate of HBoV in RTI specimens was 15.7%, which is consistent with previous reports (1.5–19%) (2). The age distribution of HBoV-positive patients is also consistent with those reported for other countries (19–21). The number of RTI patients tended to increase from winter to spring; both the peak incidence of infection and the detection rate of HBoV showed similar tendencies. Results of statistical analysis show that HBoV were mainly detected during April–June among young children, suggesting that HBoV is prevalent mainly during April–June in Japan. In contrast, the maximum prevalence was observed in autumn–winter in Hong Kong and South Africa (21, 22). Considering that 57% of all HBoV-positive-specimens were detected during May–July in South Korea (23), which is adjacent to Japan, the seasonality of HBoV might be spring in the vicinity of Japan.

The results also suggest that HPIV-3 and HMPV are the primary viruses codetected with HBoV. Both HPIV-3 and HMPV are prevalent in spring in Japan. Therefore, the high incidence of codetection of these viruses might not represent a specific association, but rather a close timeframe in terms of the prevalence of these viruses.

The meaning and significance of a high incidence of co-infection with HBoV and other respiratory viruses have remained uncertain (2). In one earlier study it was suggested that HBoV might function as a helper virus or might require the aid of another ongoing viral infection for activation of replication (2). The fact that HBoV was the only detected virus in some samples indicates that it does not serve as a helper virus. Rather, co-infection of HBoV with other viruses might affect replication and pathogenesis or vice versa. Consequently, it is reasonable to infer that the smaller viral load of HBoV with multiple infections may be the result of interference by interferon or some other function of the immune system that comes into play in the presence of other virus infections. Parvovirus B19—a genetically similar virus to HBoV and the pathogen of fifth disease in humans—can be detected for a long period after clinical symptoms have disappeared (24). HBoV might have similar properties and remain in the body for long periods, thereby contributing to its high codetection with other respiratory viruses.

It is particularly interesting that the HBoV viral load was greater in single infections, but smaller in mixed infections with other respiratory viruses. This result supports findings described in another earlier report (25). However, the effects of viral load and co-infection on clinical symptoms were not evaluated in this study.

HBoV has been suspected as a causative agent of gastroenteritis as a result of HBoV detection in human fecal specimens by some researchers (22, 26), although other studies have not found this association (27, 28). The present study also looked for HBoV in human feces of patients with gastroenteritis where no pathogen had been identified: no positive result was detected among the 66 samples tested (data not shown). It is possible that the HBoV detected in fecal specimens in other studies might have been derived from swallowed virus, which had caused an RTI (29, 30).

Some respiratory viruses such as FLU virus, RSV, and HAdV can reportedly induce encephalopathy or encephalitis (31–33). For that reason, 65 clinical specimens derived from patients with encephalopathy or encephalitis were also surveyed for HBoV genes, but no positive sample was detected (data not shown). Therefore, we consider HBoV to be associated with RTI, and to possibly have no link to other diseases. However the sample size and epidemiological information from this study may be insufficient to draw definitive conclusions. Therefore, further research and accumulation of epidemiological data are necessary to demonstrate whether a relation exists between HBoV, clinical symptoms, and disease.

ACKNOWLEDGMENTS

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. Discussion
  6. ACKNOWLEDGMENTS
  7. REFERENCES

The authors are grateful to Dr. K. Gotoh and Dr. A. Hase for supporting this study, and to all pediatricians for collecting clinical specimens. This work was supported in part by a Grant-in-Aid for Young Scientists (B) from The Ministry of Education, Culture, Sports, Science, and Technology of Japan.

REFERENCES

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. Discussion
  6. ACKNOWLEDGMENTS
  7. REFERENCES
  • 1
    Allander T., Tammi M.T., Eriksson M., Bjerkner A., Tiveljung-Lindell A., Andersson B. (2005) Cloning of a human parvovirus by molecular screening of respiratory tract samples. Proc Natl Acad Sci U S A 102: 128916.
  • 2
    Schildgen O., Muller A., Allander T., Mackay I.M., Volz S., Kupfer B., Simon A. (2008) Human bocavirus: passenger or pathogen in acute respiratory tract infections? Clin Microbiol Rev 21: 291304.
  • 3
    Dijkman R., Koekkoek S.M., Molenkamp R., Schildgen O., Van Der Hoek L. (2009) Human bocavirus can be cultured in differentiated human airway epithelial cells. J Virol 83: 773948.
  • 4
    Allander T. (2008) Human bocavirus. J Clin Virol 41: 2933.
  • 5
    Endo R., Ishiguro N., Kikuta H., Teramoto S., Shirkoohi R., Ma X., Ebihara T., Ishiko H., Ariga T. (2007) Seroepidemiology of human bocavirus in Hokkaido prefecture, Japan. J Clin Microbiol 45: 321823.
  • 6
    Allander T., Jartti T., Gupta S., Niesters H.G., Lehtinen P., Osterback R., Vuorinen T., Waris M., Bjerkner A., Tiveljung-Lindell A., Van Den Hoogen B.G., Hyypia T., Ruuskanen O. (2007) Human bocavirus and acute wheezing in children. Clin Infect Dis 44: 90410.
  • 7
    Volz S., Schildgen O., Klinkenberg D., Ditt V., Muller A., Tillmann R.L., Kupfer B., Bode U., Lentze M.J., Simon A. (2007) Prospective study of human bocavirus (HBoV) infection in a pediatric university hospital in Germany 2005/2006. J Clin Virol 40: 22935.
  • 8
    Kesebir D., Vazquez M., Weibel C., Shapiro E.D., Ferguson D., Landry M.L., Kahn J.S. (2006) Human bocavirus infection in young children in the United States: molecular epidemiological profile and clinical characteristics of a newly emerging respiratory virus. J Infect Dis 194: 127682.
  • 9
    Maggi F., Andreoli E., Pifferi M., Meschi S., Rocchi J., Bendinelli M. (2007) Human bocavirus in Italian patients with respiratory diseases. J Clin Virol 38: 3215.
  • 10
    Longtin J., Bastien M., Gilca R., Leblanc E., De Serres G., Bergeron M.G., Boivin G. (2008) Human bocavirus infections in hospitalized children and adults. Emerg Infect Dis 14: 21721.
  • 11
    Von Linstow M.L., Hogh M., Hogh B. (2008) Clinical and epidemiologic characteristics of human bocavirus in Danish infants: results from a prospective birth cohort study. Pediatr Infect Dis J 27: 897902.
  • 12
    Kantola K., Hedman L., Allander T., Jartti T., Lehtinen P., Ruuskanen O., Hedman K., Soderlund-Venermo M. (2008) Serodiagnosis of human bocavirus infection. Clin Infect Dis 46: 5406.
  • 13
    Neske F., Blessing K., Tollmann F., Schubert J., Rethwilm A., Kreth H.W., Weissbrich B. (2007) Real-time PCR for diagnosis of human bocavirus infections and phylogenetic analysis. J Clin Microbiol 45: 211622.
  • 14
    Kaida A., Kubo H., Shiomi M., Kohdera U., Iritani N. (2008) Evaluation of real-time RT-PCR compared with conventional RT-PCR for detecting human metapneumovirus RNA from clinical specimens. Jpn J Infect Dis 61: 4614.
  • 15
    Bolker B.M., Brooks M.E., Clark C.J., Geange S.W., Poulsen J.R., Stevens M.H., White J.S. (2009) Generalized linear mixed models: a practical guide for ecology and evolution. Trends Ecol Evol 24: 12735.
  • 16
    Takakura K.-I. Reconsiderations on evaluating methodology of repellent effects: validation of indices and statistical analyses. J Econ Entomol, in press .
  • 17
    Ihaka R., Gentleman R. (1996) A language for data analysis and graphics. J Comp Graph Stat 5: 299314.
  • 18
    Hishinuma-Igarashi I., Mizuta K., Saito Y., Ohuchi Y., Noda M., Akiyama M., Sato H., Tsukagoshi H., Okabe N., Tashiro M., Kimura H. (2009) Phylogenetic analysis of human bocavirus (HBoV) detected from children with acute respiratory infection in Japan. J Infect 58: 3113.
  • 19
    Arnold J.C., Singh K.K., Spector S.A., Sawyer M.H. (2006) Human bocavirus: prevalence and clinical spectrum at a children's hospital. Clin Infect Dis 43: 2838.
  • 20
    Chung J.Y., Han T.H., Kim C.K., Kim S.W. (2006) Bocavirus infection in hospitalized children, South Korea. Emerg Infect Dis 12: 12546.
  • 21
    Smuts H., Hardie D. (2006) Human bocavirus in hospitalized children, South Africa. Emerg Infect Dis 12: 14578.
  • 22
    Lau S.K., Yip C.C., Que T.L., Lee R.A., Au-Yeung R.K., Zhou B., So L.Y., Lau Y.L., Chan K.H., Woo P.C., Yuen K.Y. (2007) Clinical and molecular epidemiology of human bocavirus in respiratory and fecal samples from children in Hong Kong. J Infect Dis 196: 98693.
  • 23
    Choi E.H., Lee H.J., Kim S.J., Eun B.W., Kim N.H., Lee J.A., Lee J.H., Song E.K., Kim S.H., Park J.Y., Sung J.Y. (2006) The association of newly identified respiratory viruses with lower respiratory tract infections in Korean children, 2000–2005. Clin Infect Dis 43: 58592.
  • 24
    Lindblom A., Isa A., Norbeck O., Wolf S., Johansson B., Broliden K., Tolfvenstam T. (2005) Slow clearance of human parvovirus B19 viremia following acute infection. Clin Infect Dis 41: 12013.
  • 25
    Jacques J., Moret H., Renois F., Leveque N., Motte J., Andreoletti L. (2008) Human bocavirus quantitative DNA detection in French children hospitalized for acute bronchiolitis. J Clin Virol 43: 1427.
  • 26
    Vicente D., Cilla G., Montes M., Perez-Yarza E.G., Perez-Trallero E. (2007) Human bocavirus, a respiratory and enteric virus. Emerg Infect Dis 13: 6367.
  • 27
    Campe H., Hartberger C., Sing A. (2008) Role of human bocavirus infections in outbreaks of gastroenteritis. J Clin Virol 43: 3402.
  • 28
    Yu J.M., Li D.D., Xu Z.Q., Cheng W.X., Zhang Q., Li H.Y., Cui S.X., Miao J., Yang S.H., Fang Z.Y., Duan Z.J. (2008) Human bocavirus infection in children hospitalized with acute gastroenteritis in China. J Clin Virol 42: 2805.
  • 29
    Schildgen O., Muller A., Simon A. (2007) Human bocavirus and gastroenteritis. Emerg Infect Dis 13: 16201.
  • 30
    Chieochansin T., Thongmee C., Vimolket L., Theamboonlers A., Poovorawan Y. (2008) Human bocavirus infection in children with acute gastroenteritis and healthy controls. Jpn J Infect Dis 61: 47981.
  • 31
    Amin R., Ford-Jones E., Richardson S.E., MacGregor D., Tellier R., Heurter H., Fearon M., Bitnun A. (2008) Acute childhood encephalitis and encephalopathy associated with influenza: a prospective 11-year review. Pediatr Infect Dis J 27: 3905.
  • 32
    Ng Y.T., Cox C., Atkins J., Butler I.J. (2001) Encephalopathy associated with respiratory syncytial virus bronchiolitis. J Child Neurol 16: 1058.
  • 33
    Straussberg R., Harel L., Levy Y., Amir J. (2001) A syndrome of transient encephalopathy associated with adenovirus infection. Pediatrics 107: E69.