SEARCH

SEARCH BY CITATION

Keywords:

  • biological properties;
  • homologous recombination;
  • hly gene;
  • Listeria monocytogenes;
  • mutant strain;
  • Th1 response

ABSTRACT

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGMENTS
  7. REFERENCES

Listeria monocytogenes is a food-borne pathogen able to cause serious disease in human and animals. Listeriolysin O (LLO), a major virulence factor secreted by this bacterium, is a vacuole-specific lysin that facilitates bacterial entrance into the host cytosol. Thus, LLO plays a key role in the translocation and intracellular spread of L. monocytogenes. To study the effect of LLO on virulence and immunopotency, a LLO-deficient L. monocytogenes mutant was constructed using a shuttle vector followed by homologous recombination. The mutant strain had lost hemolytic activity, which resulted in an extremely reduced virulence, 5 logs lower than that of the parent strain, yzuLM4, in BALB/c mice. The number of bacteria detected in the spleens and livers of mice infected with the mutant was greatly reduced, and the bacteria were rapidly eliminated by the host. Kinetics studies in this murine model of infection showed that the invasion ability of the mutant strain was much lower than that of the parent strain. Moreover, immunization with the mutant strain conferred protective immunity against listerial infection. In particular, stimulation with Ag85B240-259, strong specific Th1 type cellular immunity was elicited by vaccination C57BL/6 mice with hly deficient strain delivering Mycobacterium tuberculosis fusion antigen Ag85B-ESAT-6 via intravenous inoculation. These results clearly show that highly attenuated LLO-deficient L. monocytogenes is an attractive vaccine carrier for delivering heterologous antigens.

List of Abbreviations: 
LLO

Listeriolysin O L. monocytogenes Listeria monocytogenes

MHC

major histocompatibility complex

SRBC

sheep red blood cells

MOI

multiple of infection

SOEing PCR

splicing-overlap extension PCR

CFU

clony forming unit

BHI

brain heart infusion

LD50

Lethal dose 50

L. monocytogenes is an important food-borne intracellular pathogen that infects many types of animals and more than 17 avian species. Listeriosis can be life-threatening in neonates, pregnant women, elderly persons, and the immunosuppressed patients (1). About 2,500 cases of food-borne disease caused by L. monocytogenes are reported annually in the USA (2), and L. monocytogenes has become a major public health concern in developing countries as well. Consequently, research efforts have been aimed at developing an attenuated live vaccine to prevent listeriosis. Listeria has the unusual ability to escape from the phagosome of infected cells and to proceed with replication in the cytosol. Since both CD4+ and CD8+ T-cells are key elements in Listeria-specific immunity (3), there has been much interest in exploiting the bacteria as a highly attractive vaccine carrier for the presentation of passenger antigens to the class I and II pathways of the major histocompatibility complex (MHC) (4, 5).

As a food-borne pathogen transported through the gastrointestinal tract, L. monocytogenes crosses the intestinal barrier and, via the lymph and blood, is disseminated hematogenously throughout the body. Each of these activities is dependent upon the production of bacterial virulence factors. The major virulence genes (hly, plcA, plcB, mpl, actA, inlA, and inlB) cluster in two distinct loci on the bacterial chromosome (6, 7). Among these genes, hly encodes the major virulence factor listeriolysin O (LLO), a 529-amino-acid protein with hemolytic activity and a member of the cholesterol-dependent cytolysin family of pore-forming proteins. LLO plays a crucial role in the escape of L. monocytogenes from both primary and secondary phagosomes and in multiplication of the bacterium in the host cytosol (8).

In the present study, we used L. monocytogenes serotype1/2a strain yzuLM4, isolated from goat, to generate a mutant strain with a defined in-frame deletion in hly. The virulence of this mutant, designated yzuLMΔhly, was attenuated compared to the wild-type strain. Interestingly, however, the mutant retained the ability to induce immune responses in mice challenged with the homologous strain yzuLM4 or the heterologous strain yzuF36. The attenuated mutant strain could have very important applications in the prevention of listeriosis and provides a solid foundation for the construction of a vaccine vector to prevent human and animal diseases. Furthermore, it can be used to elucidate the mechanisms of pathogenesis of L. monocytogenes virulence factors and of the host's immune response to the bacterium.

MATERIALS AND METHODS

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGMENTS
  7. REFERENCES

Mice

Six-week-old female BALB/c mice and C57BL/6 mice were purchased from the Comparative Medical Center of Yangzhou University and used in all experiments. Animals were housed, handled and immunized following approval by the institutional animal experimental committee.

Bacterial strains and plasmids

The L. monocytogenes virulent strains yzuLM4, serotype 1/2a and yzuF36, serotype 4b, were isolated and preserved by Jiangsu Key Laboratory of Zoonosis. Recombinant L.monocytogenes LM(Ag85B-ESAT-6) delivering antigens of Mycobacterium tuberculosis was constructed by PhD student Dong H in our laboratory, in which the fbpB gene encoding Ag85B and east-6 gene encoding ESAT-6 were fused and inserted into the downstream of hly signal sequence to replace the deleted fragment of hly (9). All L. monocytogenes strains were grown in BactoTM brain heart infusion (BHI, Becton, Dickinson Co., USA). Escherichia coli DH5α was used as the host strain for shuttle vector pKSV7 (a gift from Dr. Zhu G).

PCR primers

PCR primers were designed based on the published nucleotide sequence of the hly gene from L. monocytogenes strain EGDe (Table 1). All primers used in this study were synthesized by TaKaRa Biotechnology Co. To achieve homologous recombination, flanking sequences of upstream and downstream of deleted region were amplified. Primers hlyP1 and hlyP2 amplified a 900-bp DNA fragment corresponding to upstream sequences of hly, including part sequence of plcA and sequence encoding signal peptide of hly. Primers hlyP3 and hlyP4 amplified an 1100-bp DNA fragment corresponding to downstream sequences of hly, including 345-bp hly sequence and part of mpl. Primers hlyP5 and hlyP6 amplified a 350-bp DNA fragment from chromosomal DNA of the mutant strain.

Table 1.  Primer pairs used to amplify related genes
PrimersSequence (5′[RIGHTWARDS ARROW]3′)
hlyP1GGAGAATTCGCTCGTGTCAGTTCTGGGAG
hlyP2GCAACGTATCCTCCAGAGTGTTTATTGAATGCAGATGC
hlyP3GCATCTGCATTCAATAAACACTCTGGAGGATACGTTGC
hlyP4GGGTCGACGGGTTTCCGACATAACTTTTC
hlyP5AAGCAAAGGATGCATCTGCA
hlyP6CGTGTGTGTTAAGCGGTTT

Construction of the recombinant shuttle vector pKSV7-hly-/hly+

Primer pairs hlyP1/hlyP2 and hlyP3/hlyP4 were used to amplify two corresponding fragments for subsequent splicing by splicing-overlap extension PCR (SOEing PCR), thereby generating a 2000-bp fragment of hly-/hly+ in which 1150 bp had been deleted (10). The fragment was digested with restriction enzymes SalI and EcoRI and cloned into the respective site of plasmid pKSV7 to generate pKSV7-hly-/hly+, which will be used to delete the hly gene through allelic exchange. By using this construct, allelic exchange will be formed to generate the hly deletion.

Generation of a L. monocytogenes mutant strain by allelic exchange with the shuttle vector pKSV7-hly-/hly+

The recombinant shuttle vector pKSV7-hly-/hly+ was used to transform L. monocytogenes strain yzuLM4 by electroporation (11). The transformants were incubated at 41°C in BHI broth medium containing 10 μg chloramphenicol ml−1 (Sigma, St. Louis, MO, USA) to direct chromosomal integration of the plasmid DNA by homologous recombination. A single colony with chromosomal integration was serially passaged in BHI and replica-plated to obtain a mutant, yzuLMΔhly, by allelic exchange. Chromosomal integration of the reporter gene was confirmed by PCR amplification from the genomic DNA of the chloramphenicol-sensitive clones, using the primer pair hlyP1 and hlyP4. The amplicons were further verified by sequencing.

RT-PCR amplification of hly from L. monocytogenes

Total RNA was extracted from the mutant strain using the UNIQ-10 column Trizol total RNA extraction kit and following the manufacturer's instruction (Sangon Biotech Co., Ltd., Shanghai, China). RNA samples were treated with DNase I and the target mRNA was reverse-transcribed using the specific primer pair, generating the hly cDNA fragment, which was subsequently used as the template for PCR amplification. PCR was done in 25-μl reaction volumes (14.5 μl ddH20, 0.5 μl each primer at 12.5 μM, 2.0 μl 10× PCR buffer, 2.0 μl 1 mM dNTP mix, 5 μl cDNA, 0.5 μl Taq polymerase containing 2.5 U). Thermocycling conditions consisted of an initial hold of 5 min at 94°C, followed by 25 cycles of 94°C for 50 sec, 52°C for 50 sec, and 72°C for 2 min. A final extension step of 72°C for 10 min was followed by a hold at 4°C.

Measurement of hemolytic activity

Both the mutant and parent strains L. monocytogenes were grown for 16 h with shaking in BHI broth at 37°C. Hemolytic activity was measured by the lysis of sheep red blood cells (SRBC) using supernatants from cultures exponentially growing in BHI at 37°C (12, 13). All cultures were adjusted to an optical density at 600 nm (OD600) of 0.6 before the supernatants were collected. Hemolytic activity was expressed as the reciprocal of the dilution of culture supernatant to lysed SRBC (7.5 × 104 per well). PBS (50 μl) was added to seven wells, 50 μl of culture supernatant was then added to the first and second wells, serial fold dilutions were prepared in the second to seventh wells, and the eighth well contained the negative control. After the samples had been equilibrated to 37°C for 10 min, 50 μl SRBC at OD541= 0.2 was added to each well, followed by incubation for 1 hr at 37°C. Experiments were carried out in duplicate and repeated twice for each strain.

Tissue-culture invasion assay and intracellular growth assay

A gentamicin-based invasion assay was performed on RAW264.7 macrophage-like monolayers in 24-well plates according to a method described elsewhere (14). Briefly, RAW264.7 cell monolayers at about 80% confluency were inoculated with 100 μl of suspensions of the mutant strain yzuLM4Δhly and the parent strain yzuLM4 (1 × 107 CFU/ml) to obtain a multiplicity of infection (MOI) of 50:1, then incubated for 45 min at 37°C in 5% CO2. The monolayers were washed three times with PBS (pH 7.2) and treated with gentamicin (100 μg/ml in Dulbecco's modified Eagle medium) for 2 hr at 37°C in 5% CO2. The cell monolayers were washed four times with PBS and lysed with 1 ml ice-cold 0.1% Triton X-100 (Sigma). The cell lysates were ten-fold diluted and plated on BHI agar plates for bacterium counting. The invasion index was calculated by dividing the CFU that invaded the cells (with gentamicin) by the total bacterial CFU added to each well [(CFUinv/CFUtotal) × 100]. The experiment was repeated three times, each time in triplicate wells for each strain. To measure intracellular growth, extracellular bacteria were removed and the infected cells were incubated in growth medium (DMEM) supplemented with 5 μg gentamicin/ml for 19.5 hr. The number of intracellular bacteria was then enumerated at 21.5 hr post-infection as described above. Intracellular doubling times were determined to be between 3.5 and 21.5 hr post-infection.

Virulence in mice

The mutant strain yzuLMΔhly and the wild-type parent strain were grown in BHI broth to an OD600= 0.5 and harvested by centrifugation at 10,000 g for 10 min at 4°C. The cell pellets were gently resuspended in PBS (pH 7.2), serial 3-fold dilutions were prepared for inoculation, ten-fold dilutions were prepared for cell-counting on BHI agar plates. Mice in each group were intravenously inoculated with 0.1 ml of an appropriate dilution of the two strains and observed for 14 days. The LD50 of the two strains was estimated using the trimmed Spearman-Karber method.

Kinetics growth of L. monocytogenes in murine spleen and liver

The mice were divided into several groups and inoculated intravenously with sublethal doses of each of the L. monocytogenes strains (6 × 107 CFU per mouse for yzuLMΔhly, 1 × 103 CFU per mouse for yzuLM4). The number of bacteria in the spleen and in the liver of infected mice was determined on day 1, 3, 5, 7 post-infection. Bacterial growth in spleens and livers was determined by plating ten-fold serial dilutions of the organ homogenates on tryptic soy agar. Colonies were counted after 24 hr of incubation at 37°C.

Cytokine detection by enzyme-linked-immunospot (ELISPOT)

Mice were stochastically divided into four groups of six mice each, and three groups were immunized intravenously with yzuLM4 (1 × 103 CFU), yzuLM4Δhly (2 × 107 CFU) and LM(Ag85B-ESAT-6) (2 × 107 CFU) respectively. The last group of uninfected normal C57BL/6 mice was included as control. On day 8 post-booster immunization, spleen lymphocytes were harvested and incubated in RPMI-1640 (10% fetal bovine serum, 100 U/ml penicillin and streptomycin, Sigma) in 96-well filtration plate (Millipore, USA) for 48 hr (37°C, 5% CO2). The specific stimulation antigen polypeptides Ag85B240-259 (5 μg/ml, synthesized by Beijing Scilight Biotechnology Ltd. Co.) were added. The following monoclonal antibodies used for ELISPOT were R4-6A2 for IFN-γ, XMG1.2 for biotinylated IFN-γ, BVD4-1D11 for IL-4, BVD6-24G2 for biotinylated IL-4 (all are the products of BD pharmingen, USA). The protocol of ELISPOT was described as elsewhere (15), and the samples were performed in triplicate.

Protection studies

Mice were stochastically divided into four groups of six mice each. Two groups were immunized with mutant strain yzuLM4Δhly three times at the intervals of 2 weeks (1.5 × 108 CFU per mouse) via intravenous inoculation, after immunized for 45 days then challenged with a dose of 1 × 105 CFU per mouse. Two groups of uninfected normal BALB/c mice were included as controls. The mice were observed for 14 days. Survival of mice was expressed as the percentage of animals alive following challenge.

RESULTS

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGMENTS
  7. REFERENCES

Identification of mutant strain yzuLMΔhly

The fragments of hly- and hly+ were amplified from the chromosomal DNA of L. monocytogenes strain yzuLM4 and spliced by SOEing PCR, then digested and cloned into the same restriction enzyme sites of plasmid pKSV7. The recombinant shuttle vector pKSV7-hly-/hly+was verified by PCR and confirmed by restriction digestion with SalI and EcoRI as well as DNA sequencing (TaKaRa Biotechnology Co) of hly-/hly+ obtained from the plasmid.

After electroporation of pKSV7-hly-/hly+ into competent cells of strain yzuLM4, positive transformants were selectively cultured in chloramphenicol and subjected to a temperature shift, resulting in integration of the plasmid DNA by homologous recombination. A single colony with chromosomal integration was serially passaged in BHI and replica-plated to obtain a mutant L. monocytogenesΔhly by allelic exchange. Chromosomal integration of the reporter gene was confirmed by PCR amplification from the genomic DNA of the chloramphenicol-sensitive clones using the primer pairs of hly1/hly4. The amplicons were verified by sequencing.

A 3,200-bp fragment was obtained from the wild-type strain yzuLM4, while a fragment of only 2,000 bp was amplified from the mutant strain, indicating that the hly gene had been deleted from the L. monocytogenes genome (Fig. 1).

image

Figure 1. PCR results with the recombinant L. monocytogenes using primers hlyP1 and hlyP4. M. λ-EcoT14 digestion marker. Lanes 1-4 The amplified hly gene fragment of L. monocytogenes (Lanes 1,2. the 2000-bp fragment, LLO-deficient L. monocytogenes, Lanes 3,4. the 3200-bp fragment, wild type L. monocytogenes)

Download figure to PowerPoint

RT-PCR amplification of hly from the mutant L. monocytogenes strain

The hly gene of the wild-type strain was transcribed, as revealed by RT-PCR amplification of a 1,500 bp fragment (Fig. 2). From the mutant strain, only a 350-bp fragment could be amplified by RT-PCR. The failure to detect the 1150-bp fragment supported the conclusion that hly had been deleted from the L. monocytogenes genome. No amplified fragments were obtained from the negative control E. coli DH5α (Fig. 2).

image

Figure 2. RT-PCR amplification of the L. monocytogenes hly gene fragment using primers hlyP5 and hlyP6. M. λ-EcoT14 digest marker; Lane 1. L. monocytogenes strain yzuLM4Δhly. Lane 2. L. monocytogenes strain yzuLM4. Lane 3. Negative control (E.coli DH5α)

Download figure to PowerPoint

Loss of hemolytic activity

The result of the experiment (Fig. 3) verified that the culture supernatants of the mutant strain lost hemolytic activity due to deletion of the 1,150-bp containing the L. monocytogenes hemolysin gene (hly), while the wild-type strain retained its hemolytic activity, with a titer of 1:8.

image

Figure 3. The hemolytic activity of LLO in L. monocytogenes supernatant. Lane 1. L. monocytogenes strain yzuLM4. Lane 2. L. monocytogenes strain yzuLM4Δhly. Lane 3. Negative control (E.coli DH5α)

Download figure to PowerPoint

Reduced virulence of mutant strain yzuLM4Δhly in mice

The LD50 of the wild-type and mutant strains and thus the virulence in BALB/c mice was 1.47 × 104 and 2.15 × 109 CFU, respectively (Table 2). Thus, deletion of the hly gene resulted in a strongly attenuated (5 logs lower) virulence, suggesting that hly encodes a crucial virulence factor.

Table 2.  LD50 of L. monocytogenes strains in BALB/c mice
StrainLg LD50LD50
  1. Six BALB/c mice were used in each group for infection. The highest inoculation dose for yzuLMΔhly and yzuLM4 is 3.07 × 109 CFU and 3.96 × 104 CFU per mouse respectively. Serial 3-fold dilutions were prepared for inoculation. The LD50 of the two strains was estimated using the trimmed Spearman-Karber method.

yzuLM4△hly9.332.15 × 109
yzuLM44.171.47 × 104

Reduced invasiveness and multiplication of mutant strain yzuLM4Δhly

We then compared the growth activity of the mutant strain yzuLM4Δhly to that of wild-type strain by using a RAW264.7 macrophage-like monolayer infection assay. As expected, wild-type L.monocytogenes exhibited higher ability of invasiveness and intracellular growth (7- and 15-fold, respectively) than the mutant strain (P < 0.01) (Figs. 4 and 5). Because escape from the phagosome is indispensable for the intracellular growth of L.monocytogenes (16, 17), this result suggested that the mutant strain without hemolytic activity was unable to escape into the cytosol niche and establish a successful replication.

image

Figure 4. Invasion assay. The mutant strain yzuLM4Δhly was less invasive than the parent L. monocytogenes strain (yzuLM4) as tested by a gentamicin-killing invasion assay in cultured RAW264.7 macrophage-like cells (P < 0.01). Each data point from three wells represents the average invasion index (+SD) determined in three experiments.

Download figure to PowerPoint

image

Figure 5. Intracelluar growth assay. The mutant strain yzuLM4Δhly showed less multiplication ability than the parent L. monocytogenes strain (yzuLM4), as tested by a gentamicin-killing intracellular growth assay in cultured RAW264.7 macrophage-like cells (P < 0.01). Each data point from three wells represents the average invasion index (+SD) determined in three experiments.

Download figure to PowerPoint

Kinetics of mutant strain yzuLM4Δhly in murine infection

As seen in Figure 6, after intravenous inoculation of the mice with strain yzuLM4Δhly, bacteria could be recovered from liver and spleen. Bacterial counts of the mutant Listeria strains in spleen and liver dropped rapidly beginning 24 h after infection and were cleared on day 5 and 7 respectively. By contrast, the number of wild-type (strain yzuLM4) bacteria in the spleen and liver reached a peak on days 3, then dropped slowly. On day 7, there were still about 104 CFU bacteria in spleen or liver. These results demonstrated that the invasiveness and infectivity of the mutant strain were significantly reduced compared to wild-type strain.

image

Figure 6. Kinetics of primary infection in mice infected with wild-type L. monocytogenes and isogenic L. monocytogenes mutant strain. Mice were infected i.v. with either 103 CFU wild type L. monocytogenes or 6×107 isogenic strain yzuLMΔhly. Different time intervals after the infection, mice were sacrificed and the number of viable bacteria in the organs enumerated as described. Data presented are representative of three independent experiments.

Download figure to PowerPoint

Recombinant strains induced antigen-specific IFN-γ following immunization

After 48 hr incubation, there were specific IFN-γ-secreting cells and IL-4-secreting cells detected in the recombinant LM(Ag85B-ESAT-6) immunized group, and the number of the former is significantly higher than the latter (Fig. 7). Virtually no specific IFN-γ-secreting cells and IL-4-secreting cells were detected in yzuLM4 and yzuLM4Δhly immunized groups. This experiment showed that a predominant Th1 response against target antigen was induced when the mutant strain was used as a foreign antigen carrier.

image

Figure 7. Number of spleen cells secreting INN-γ and IL-4 was detected at the 8th day after the last immunization in C57BL/6 mice immunized with LM (Ag85B-ESAT-6), yzuLM4 and yzuLM4Δhly. All groups received inoculations two times at the 1st and 14th day. Cells from spleen were stimulated with peptide Ag85B240-259. Results were calculated from four individual samples. *P < 0.01, compared to the two negative control groups.

Download figure to PowerPoint

Protection studies

As shown in Table 3 mice immunized with the mutant strain were 100% protected from a challenge with wild-type strain yzuLM4 (serotype 1/2a), or strain yzuF36 (serotype 4b). All control mice that had not been pre-immunized died between days 3 and 6 post-challenge. Thus, immunization with isogenic yzuLM4Δhly mutant strain protected mice against lethal infection from either a homologous or a heterologous strain challenge.

Table 3.  Protective efficacy of recombinant L. monocytogenes for mice
GroupNumber of survivorsNumber of deadProtective rate (%)
yzuLM4yzuF36yzuLM4yzuF36yzuLM4yzuF36
  1. Two groups of BALB/c mice were infected i.v. three times at the intervals of 2 weeks (1.5 × 108 CFU per mouse). 45 days later all mice were challenged with a dose of 1 × 105 CFU of the wild-type strain yzuLM4 (serotype 1/2a), or strain yzuF36 (serotype 4b). As control, two groups of uninfected normal mice were included. Survival of mice was expressed as the percentage of mice alive following challenges.

Control group0066  0  0
yzuLM4△hly6600100100

DISCUSSION

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGMENTS
  7. REFERENCES

Listeriosis is primarily an infectious disease of pregnant women, neonates and infants, elderly individuals, and the immunocompromised patients. Thus, it is paramount that Listeria vaccine strains to be used in these susceptible population should be sufficiently attenuated so as not to pose a risk of infection (18). A number of highly attenuated mutant strains of L. monocytogenes have been developed for potential use as vaccines. Virulence genes, including prfA, actA, hly, plcB, plcA, plcA/plcB, inlA, inlB, and inlAB, have been deleted from the chromosome to generate the corresponding mutant strains (6). While the LD50 values of these mutants are lower than those of the wild-type strain, the virulence of the mutants differs. Hohmann deleted two genes (actA and plcB) from L. monocytogenes strain10403S, and the lgLD50 of this mutant was 7.60 (19). Jiang deleted actA and hly and the lgLD50 of the resulting mutant strains were 7.44 and 4.19, respectively (20). The whole hly gene deleted strain named DP-L2161 was reported by D.A. Portnoy in 1994 (LD50 to BALB/c mice is 2 × 109) (21), and by using this strain Harty JT's research work verified that the LLO-deficient strain can produce long-term protective immunity(22). Another whole gene deleted strain named Δhly L.monocytogenes was reported by Mitsuyama M, however, the result of their study revealed only transient protection (23). In the current study, a different construction strategy from other reports is in that the mutant strain yzuLM4Δhly was part-gene deleted, but the virulence is highly reduced (LD50 to BALB/c mice is 2.15 × 109), which is in accordance with the results of Portnoy (21, 24). The significant decrease in bacterial toxicity means increased safety to human and animals (25).

In the present study, a 1,150-bp DNA fragment encoding the first three domains of hly had been deleted by using homologous recombination method, so the remaining sequence of hly was unable to express a truncated LLO-d123, but the preserved signal peptide of LLO can still lead to the expression of the last domain LLO-d4. Dubail I's research work verified that this domain is able to bind to cell membrane (26), but whether this truncted protein is helpful to protective immunity is unknown. Our study showed that the hemolytic activity of LLO in supernatant obtained from mutant L. monocytogenes was lost, with subsequent effects on pathogenicity. This was verified by assaying invasion and multiplication in vitro and in vivo. The LD50 for △hly strain infection in mice reflected the significant decrease in the mutant's toxicity, while the kinetics of infection confirmed the reduction in invasiveness. LLO-d123 has been suggested to participate in lysis of the phagosomal membrane (26), therefore, this domain of the protein plays a crucial role in invasion, multiplication, and translocation of L. monocytogenes.

Food-borne listeriosis has become a great concern to public health and to the food industry due to a number of outbreaks and sporadic cases of L. monocytogenes infections arising from foods contaminated with the bacterium. Serotypes 4b, 1/2a, 1/2b and 3b have been found to be responsible for more than 90% of the listeriosis outbreaks that have occurred in the past 2 decades, with serotype 4b strains accounting for approximately 40% of the listeriosis (27, 28). In our study, mice immunized with the mutant strain had 100% protective immunity after challenge with a lethal dose of the homologous strain (yzuLM4) or of the heterologous strain yzuF36. This result suggests the LLO-deficient strain can be used as a vaccine to induce potent protective immunity. The result is in accordance with Koenig's study (29), which showed protective immunity between different L. monocytogenes serotypes. Specifically, mice experimentally infected with L. monocytogenes serotypes 1/2b, 3a, 4b, and 4d were protected against a lethal challenge with the most virulent serotype 4b. The mechanism that the LLO-deficient strain can confer protective immunity is worth studying in the future.

Ag85B contians a large number of B and T cell epitopes of Mycobacterium tuberculosis, which can elicit protective immunity, so it is an attractive antigen target for the development of new TB vaccine (30). In this study the peptide Ag85B240-259, an immune dominant H-2b antigen from Mycobacterium tuberculosis (31), was used to evaluate the triggered protective antigen-specific T cell response. Because antigen specific T-cells can occur at a low frequency in vivo, increased sensitivity of ELISPOT is particularly advantageous when studying T-cell-mediated responses in pathogen infection. Our result showed that following the peptide Ag85B240-259 stimulation, higher level of IFN-γ-secreting cells than IL-4-secreting cells was induced (P < 0.01) in the spleen of mice immunized with recombinant strain LM(Ag85B-ESAT-6). This indicated that a predominantly Th1 response was elicited. Th1 cells produce IFN-γ, TNF-β and IL-2, and are responsible for directing cell-mediated immune responses leading to the eradication of intracellular pathogens. We found that LLO deficient L.monocytogenes still keeps the ability to trigger secondary expansion of antigen specific T cells and confer long-term protection to challenge by wild type L. monocytogens. Our results are also consistent with those from Harty JT et al. (22) and Way S.S et al. (32), which suggest that highly attenuated LLO-deficient L. monocytogenes is an attractive vaccine carrier for delivering heterologous antigens and can be used in susceptible populations to prevent listeriosis and potentially, tumors or diseases caused by other infectious pathogens.

In conclusion, we have successfully constructed a mutant strain yzuLMΔhly with much lower virulence and thus greater safety than the wild-type strain. The mutant retains immunopotency with respect to inducing protective immunity against homologous and heterologous L. monocytogenes infections and is thus of potential interest as a candidate vaccine to prevent listeriosis, and as a vaccine vector in the delivery of heterologous antigens. Furthermore, it provides several possibilities to elucidate the mechanisms of pathogenesis by L. monocytogenes virulence factors and of the immune response to them.

ACKNOWLEDGMENTS

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGMENTS
  7. REFERENCES

This work was supported by grants from the 973 program (2006CB504404), National Natural Science Foundation of China (30425031), National Key Technology RKD program (2007BAD40B01) and the Government of Jiangsu Province (BK2008011).

REFERENCES

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGMENTS
  7. REFERENCES
  • 1
    Ramaswamy, V., Cresence, V.M., Rejitha, J.S., Lekshmi, M.U., Dharsana, K.S., Prasad, S.P., Vijila, H.M. (2007) Listeria–review of epidemiology and pathogenesis. J Microbiol Immunol Infect 40: 413.
  • 2
    Roberts, A., Chan, Y., Wiedmann, M. (2005) Definition of genetically distinct attenuation mechanisms in naturally virulence-attenuated Listeria monocytogenes by comparative cell culture and molecular characterization. Appl Environ Microbiol 71: 390010.
  • 3
    Li, Z., Zhang, M., Zhou, C., Zhao, X., Iijima, N., Frankel, F.R. (2008) Novel vaccination protocol with two live mucosal vectors elicits strong cell-mediated immunity in the vagina and protects against vaginal virus challenge. J Immunol 180: 250413.
  • 4
    Paterson, Y., Maciag, P.C. (2005) Listeria-based vaccines for cancer treatment. Curr Opin Mol Ther 7: 45460.
  • 5
    Dietrich, G., Viret, J.F., Gentschev, I. (2003) Haemolysin A and listeriolysin-two vaccine delivery tools for the induction of cell-mediated immunity. Int J Parasitol 33: 495505.
  • 6
    Liu, D. (2006) Identification, subtyping and virulence determination of Listeria monocytogenes, an important foodborne pathogen. J Med Microbiol 55: 64559.
  • 7
    Ermolaeva, S.A. (2001) Genetic mechanisma of Listeria monocytogenes virulence. Genetic 37: 28693.
  • 8
    Birminqham, C.L., Canadien, V., Kaniuk, N.A., Steinberg, B.E, Higgins, D.E., Brumell, J.H. (2008) Listeriolysin O allows Listeria monocytogenes replication in macrophages. Nature 451: 3504.
  • 9
    Dong, H., Jiao X., Yin Y., Tian D., Pan, Z., Liu, S., Fang L. (2009) Construction of recombinant Listeria monocytogenes expressing Mycobacterium tuberculosis antigen Ag85B and Esat-6. Zhongguo Shouyi Kexue 8: 70711.
  • 10
    Horton, R.M., Cai, Z.L., Ho, S.N., Pease, L.R. (1990) Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction. Biotechniques 8: 52835.
  • 11
    Park, S.F., Stewart, G.S. (1990) High-efficiency transformation of Listeria monocytogenes by electroporation of penicillin-treated cells. Gene 94: 12932.
  • 12
    Geoffroy, C., Gaillard, J.L., Alouf, J.E., Berche, P. (1987) Purification, characterization and toxicity of the sulfhydryl-activated hemolysin listeriolysin O from Listeria monocytogenes. Infect Immune 55: 164146.
  • 13
    Yin, Y.L., Jiao, X.A., Pan, Z.M., Zhang, X.M., Gu, Z.Q. (2004) Prokaryotic Expression and Bioactivity of the Listeria monocytogenes listeriolysin O. Wei Sheng Wu Xue Bao(Chinese) 44: 7525.
  • 14
    Zhou, X., Jiao, X., Wiedmann, M. (2005) Listeria monocytogenes in the Chinese food system: strain characterization through partial actA sequencing and tissue-culture pathogenicity assays. J Med Microbiol 54: 21724.
  • 15
    Jiao X., Richard L.M., Edith D., et al . (2001) Kinetics of rBCG-initiated T cell immune responses monitored by ELISPOT assay. Chinese Journal of Preventive Veterinary Medicine 23: 469.
  • 16
    Hara H., Kawamura I., Nomura T., Tominaga T., Tsuchiya K., Mitsuyama M. (2007) Cytolysin-dependent esacpe of the bacterium from the phagosome is required but not sufficient for induction of the Th1 immune response against Listeria monocytogenes infection: distinct role of listeriolysin O determined by cytolysin gene replacement. Infect Immune 3791801.
  • 17
    Birmingham CL., Canadien V., Kaniuk NA., Steinberg BE., Higgins DE., Brumell JH. (2008) Listeriolysin O allows Listeria monocytogenes replication in macrophage vacuoles. Nature 3504.
  • 18
    Schoen, C., Loeffer, D.I., Frentzen, A., Pilgrim, S., Goebel, W., Stritzker, J. (2008) Listeria monocytogenes as novel carrier system for the development of live vaccines. Int J Med Microbiol 298: 4558.
  • 19
    Angelakopoulos, H., Loock, K., Sisul, D.M., Jensen, E.R., Miller, J.F., Hohmann, E.L. (2002) Safety and shedding of an attenuated strain of Listeria monocytogenes with a deletion of actA/plcB in adult volunteers: a dose escalation study of oral inoculation. Infect Immun 70: 3592601.
  • 20
    Jiang, L.L., Song, H.H., Chen, X.Y., Ke, C.L., Xu, J.J., Chen, N., Fang, W.H. (2005) Characterization of a mutant Listeria monocytogenes strain expressing green fluorescent protein. Acta Biochim Biophys Sin (Shanghai) 37: 1924.
  • 21
    Portnoy D.A., Jones S. (1994) Characterization of Listeria monocytogenes pathogenesis in a strain expressing Perfringolysin O in place of Listeriolysin. O Infect Immun 1994: 560813.
  • 22
    Hamilton, S.E., Badovinac, V.P., Khanolkar, A., Harty, J.T. (2006) Listeriolysin O-Deficient Listeria monocytogenes as a vaccine delivery vehicle: antigen-specific CD8 T cell priming and protective immunity. J Immunol 177: 401220.
  • 23
    Hara H., Lawamura I., Nomura T., Tominaga T., Tsuchiya K., Mitsuyama M. (2007) Cytolysin-dependent escape of the bacterium from the phagosome is required but not sufficient for induction of the Th1 immune response against Listeria monocytogenes infection: distinct role of Listeriolysin O determined by cytolysin gene replacement. Infect Immun 75: 3791801.
  • 24
    Glomski, I.J., Decatur, A.L., Portnoy, D.A. (2003) Listeria monocytogenes mutants that fail to compartmentalize listerolysin O activity are cytotoxic, avirulent, and unable to evade host extracellular defenses. Infect Immun 71: 675465.
  • 25
    Liu, D. (2006) Listeria-based anti-infective vaccine strategies. Recent Patents Anti-infect Drug Disc 1: 28190.
  • 26
    Dubail, I., Autret, N., Beretti, J.L., Kayal, S., Berche, P., Charbit, A. (2001) Functional assembly of two membrane-binding domains in listeriolysin O, the cytolysin of Listeria monocytogenes. Microbiology 147: 2679-2688.
  • 27
    Lin, M., Todoric, D., Mallory, M., Luo, B.S., Trottier, E., Dan, H. (2006) Monoclonal antibodies binding to the cell surface of Listeria monocytogenes serotype 4b. J Med Microbiol 55: 29199.
  • 28
    Chen, Y., Zhang, W., Knabel, S.J. (2007) Multi-virulence-locus sequence typing identifies single nucleotide polymorphisms which differentiate epidemic clones and outbreak strains of Listeria monocytogenes. J Clin Microbiol 45: 83546.
  • 29
    Koeing C H, Heymer B, Hof H, Finger H. (1983) Course of infection and development of immunity in experimental infection of mice with Listeria serotypes. Infect Immun 40: 11707.
  • 30
    Radosevic K., Wieland C., Rodriguez A., Weverling G.J., Mintardjo R, Gillissen G, Vogels R., Skeiky W., Hone D., Sadoff J., Poll T., Havenga M., Goudsmit J. (2007) Protective immune responses to a recombinant Adenovirus type 35 tuberculosis vaccine in two mouse strains: CD4 and CD8 T-cell epitope mapping and role of gamma Interferon. Infect Immun. 75: 410515.
  • 31
    D'Souza S., Rosseels V., Romano M., Tanghe A., Denis O., Jurion F., Castiglione N., Vanonckelen A., Palfliet K., Huygen K. (2003) Mapping of murine Th1 helperT-cell epitopes of Mycolyl transferases Ag85A, Ag85B, and Ag85C from Mycobacterium tuberculosis. Infect Immun 71: 48393.
  • 32
    Orgun, N.N., Way S.S. (2008) A cirtical role for phospholipase C in protective immunity conferred by Listeriolysin O-deficient Listeria monocytogenes. Microb Pathog 44: 15963.