A novel multiplex PCR method for Clostridium botulinum neurotoxin type A gene cluster typing

Authors

  • Kaoru Umeda,

    1. Department of Microbiology, Osaka City Institute of Public Health and Environmental Sciences, 8-34 Tojo-cho, Tennoji-ku, Osaka 543-0026
    2. Department of Veterinary Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-58 Rinku-Orai-Kita, Izumisano-shi, Osaka 598-8531, Japan
    Search for more papers by this author
  • Yoshiyuki Seto,

    1. Department of Veterinary Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-58 Rinku-Orai-Kita, Izumisano-shi, Osaka 598-8531, Japan
    Search for more papers by this author
  • Tomoko Kohda,

    1. Department of Veterinary Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-58 Rinku-Orai-Kita, Izumisano-shi, Osaka 598-8531, Japan
    Search for more papers by this author
  • Masafumi Mukamoto,

    1. Department of Veterinary Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-58 Rinku-Orai-Kita, Izumisano-shi, Osaka 598-8531, Japan
    Search for more papers by this author
  • Shunji Kozaki

    1. Department of Veterinary Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-58 Rinku-Orai-Kita, Izumisano-shi, Osaka 598-8531, Japan
    Search for more papers by this author

Correspondence
Shunji Kozaki, Department of Veterinary Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-58 Rinku-Orai-Kita, Izumisano-shi, Osaka 598-8531, Japan. Tel: +81 72 463 5683; fax: +81 72 463 5691; email: kozaki@center.osakafu-u.ac.jp

ABSTRACT

A rapid, simple and sensitive multiplex PCR method for boNT/A gene cluster typing was developed by combining the results of BoNT/A subtype (boNT/A1 or /A2) gene detection with ha33 and/or p47 gene detection. Ten isolates associated with infant botulism in Japan were examined and divided into boNT/A gene cluster types 2 and 3 by origin (honey feeding or not) and period (1986–1987 or 1999–2007). It is suggested that this multiplex PCR method will be be useful for epidemiological studies of botulism.

List of Abbreviations: 
boNT

botulinum neurotoxin

boNT/A

botulinum neurotoxin A

botR

botulinum neurotoxin regulatory

C.

Clostridium

ha

hemagglutinin

ntnh

nontoxic-nonhemagglutinin

orf

open reading frame

orfx

unknown function open reading frame gene

PCR-RFLP

PCR restriction fragment length polymorphism

PFGE

pulsed-field gel electrophoresis

Clostridium botulinum is an anaerobic spore-forming bacterium producing BoNT, which is the cause of botulism in humans and animals (1) and is divided into seven serotypes (A to G) (2). Some strains harbor two different serotypes of BoNT genes in their genome (3). BoNT is encoded by an approximately 3.8 kb gene, which is preceded by several nontoxic component genes (4). BoNT together with the nontoxic component genes are defined as the boNT gene cluster (5). Recently, BoNT was subclassified by BoNT gene sequence analysis, BoNT/A being divided into four subtypes (A1, A2, A3 and A4) (3). There are two types of nontoxic components of gene organization (the HA and Orfx clusters), and C. botulinum type A strains were classified according to their harboring of these clusters (4–6). The HA cluster consists of ha17, ha33, ha70, botR and ntnh genes, and the Orfx cluster consists of orfx3, orfx2, orfx1, botR, p47 (unknown function) and ntnh genes (6). Franciosa et al. have reported that type A strains possess boNT/A1 and HA cluster genes to boNT/A gene cluster type 1; boNT/A2 and Orfx cluster genes to boNT/A gene cluster type 2; and boNT/A1 with unexpressed or expressed boNT/B, HA cluster and Orfx cluster genes to boNT/A gene cluster type 3 (5). BoNT/A gene cluster typing has recently been applied for molecular characterization of type A strains (5).

In Japan, 24 cases of infant botulism have been reported: 16 of type A, 3 of type B, 1 of type C and 1 of C. butyricum producing BoNT/E. The types of toxin in the other three cases were not described (7–9). During 1986 to 1989, nine cases occurred; all were type A and gave a history of feeding with honey before the onset of symptoms. Since 1990, seven cases of type A have occurred, but none had a history of feeding with honey and the origin was not identified in five cases.

In this study, we developed the multiplex PCR method to easily detect boNT/A gene cluster types. In order to better understand the background of infant botulism cases in Japan, we then genotyped C. botulinum type A isolates by boNT/A gene cluster and PFGE types.

Twenty-seven C. botulinum type A strains, including 10 isolates associated with infant botulism in Japan, were cultured in 10 ml cooked meat medium (Difco, Becton Dickinson, Franklin Lakes, NJ, USA) supplemented with 0.3% glucose and 0.2% soluble starch under anaerobic conditions for 18 hr at 30°C (Table 1). Bacterial DNA was extracted according to our previous report (10). Multiplex PCR assay was performed using two sets of primers: “boNT/A1, A2” contained three primers to identify boNT/A1 or boNT/A2 genes; and “ha33, p47” contained four primers to detect the ha33 gene, which is specific for the HA cluster, and the p47 gene, which is specific for the Orfx cluster (Table 2). PCR was performed with a 25 μl reaction mixture containing 0.1–1 ng template DNA, 0.25 μM of each primer, 1.25 U Ex Taq (TaKaRa Shuzo, Kyoto, Japan), 2.5 μl Ex Taq buffer and 200 μM deoxynucleotide-triphosphate. Each PCR cycle consisted of denaturation at 94°C for 1 min, annealing at 55°C for 1 min, and extension at 72°C for 1 min, and was repeated 30 times. Unexpressed boNT/B gene was detected by another PCR assay for boNT/A to boNT/G genes (11). Sma I digested PFGE was carried out as described in our previous report (10). Dendrogram analysis of the band patterns was generated with FPQuest software ver.4.5 (Bio-Rad, Hercules, CA, USA). Another PFGE type was defined where there was more than one fragment difference in the PFGE band pattern.

Table 1.  Summary of molecular typing of C. botulinum type A strains
Source and strainDescription† (Reference)boNT gene‡Multiplex PCRboNT/A gene cluster type§PFGE type
boNT/A1, A2ha33, p47
  1. †, Location, year, cause of botulism or origin; ‡, detected by PCR assay for boNT/A to boNT/G genes (11); §, determined by multiplex PCR assay.

Infant botulism in Japan
 Chiba HChiba, 1986, honey feeding (7, 8)AA2p472S1
 Kyoto FKyoto, 1987, honey feeding (8)AA2p472S2
 KZ1828Ishikawa, 1987, honey feeding (8)AA2p472S1
 7I03 HOsaka, 1987, honey feeding (8)AA2p472S2
 7I05 FEhime, 1987, honey feeding (8)AA2p472S3
 7I05 HEhime, 1987, honey feeding (8)AA2p472S4
 Y8036Kanagawa, 1987, honey feeding (8)AA2p472S5
 Hiroshima1Hiroshima, 1999, unidentified (8, 16)A, BA1ha33, p473S6
 Miyagi2006Miyagi, 2006, well water (9)A, BA1ha33, p473S6
 Iwate2007Iwate, 2007, unidentified (9)A, BA1ha33, p473S7
Food-borne botulism in Japan
 RenkonKumamoto, 1984, karashi renkon (8)A, BA1ha33, p473S8
 CB111Tokyo, 1999, unidentifiedAA1ha331S9
 CB121Chiba, 1999, vacuum-packed hashed beef (17)A, BA1ha33, p473S6
 Osaka99Osaka, 1999, unidentifiedA, BA1ha33, p473S10
Infant botulism in the USA
 89E00033-1California, 1989AA1ha331S11
 89E00035-1California, 1989AA1ha331S12
 89E00064-3California, 1989A, BA1ha33, p473S13
 89E00086-1California, 1989A, BA1ha33, p473S14
 83E00080California, 1990AA1ha331S15
 2137-1-77California, 1990AA1ha331S16
Others
 802-1Germany, 1988, red pepperAA1ha331S17
 804-1HBrazil, 1988, honeyAA2p472S18
 DenkenStocked strainAA1ha331S19
 97AStocked strainAA1ha331S20
 62AStocked strainAA1ha331S21
 33AStocked strainAA1ha331S17
 36AStocked strainAA1ha331S22
Table 2.  Primers for multiplex PCR assays for classification of the boNT/A gene cluster type
Primer setPrimerSequence (5′-3′)Product size (bp)Location on gene (coding region)
boNT/A1, A2A1-forwardGACTTTACAGGATACTCAGGAAATA6652955–2979
A2-forwardTAGAGATCCACGTAGATACATCAT4403180–3203
A-reverseTTAGTATTTTTTCTACGCCTGC 3619–3598
ha33, p47ha33-forwardTGGTAACAATTCATTTATTATTGC534303–326
ha33-reverseTTAAATACTTGAATAGCAGTTCCGT 836–812
p47-forwardACTTATGGTTGGGATATTGTTTA3447–29
p47-reverseTCATCATTAGACTCAGATCCAA 350–329

The results of multiplex PCRs of 27 type A strains are summarized in Table 1 and representative results are depicted in Figure 1. The boNT/A1 (665 bp) and ha33 amplicons (534 bp) were detected in 11 strains (CB111, 89E00033-1, 89E00035-1, 83E00080, 2137-1-77, 802-1, Denken, 97A, 62A, 33A and 36A), which were accordingly classified as boNT/A gene cluster type 1. The boNT/A2 (440 bp) and p47 amplicons (344 bp) were detected in eight strains (Chiba H, Kyoto F, KZ1828, 7I03 H, 7I05 F, 7I05 H, Y 8036 and 804-1H), which were accordingly classified as boNT/A gene cluster type 2. The boNT/A1, ha33 and p47 amplicons were detected in eight strains (Hiroshima1, Miyagi2006, Iwate2007, Renkon, CB121, Osaka99, 89E00064-3 and 89E00086-1). These also harbored the unexpressed boNT/B gene (Table 1), and were therefore classified into boNT/A gene cluster type 3. No amplicon was detected in the 12 control strains, which were as follows: three type B (Okra, 111 and Osaka05), one type C (CB-19), one type D (1873), one type E (Iwanai), one type F (Langeland), one BoNT/E producing C. butyricum (5262), one C. sporogenes (ATCC19404), one C. bifementas (ATCC638), one C. perfringens (ATCC13124) and one C. difficile (ATCC43593) by “boNT/A1, A2” PCR. The ha33 amplicon was detected in the three type B strains and the p47 amplicon in the type F strain by “ha33, p47” PCR (data not shown).

Figure 1.

Multiplex PCR assay for boNT/A gene cluster typing. The results of PCR with primer sets “boNT/A1, A2” (lanes 1 to 3) and “ha33, p47” (lanes 4 to 6) using strain 62A (lanes 1 and 4), Kyoto F (lanes 2 and 5) and Renkon (lane 3 and 6) were visualized on 3% agarose gels stained with ethidium bromide. Lane M: 100-bp ladder.

The PFGE patterns of Sma I digested DNA from 27 type A strains and a dendrogram based on the similarities between normalized PFGE patterns are presented in Figure 2, and PFGE types are listed in Table 1. The 27 strains were divided into 22 PFGE types (S1-S22) and their similarity ranged from 29.6% to 100%. The seven isolates associated with infant botulism in Japan during 1986–1987 were divided into five PFGE types with 78.6–100% similarity, and 81.5% to 89.7% similarity to strain 804-1H, isolated from Brazil honey. The three isolates associated with infant botulism in Japan during 1999–2007 were divided into two PFGE types with 62.1% similarity. Strains Hiroshima1 and Miyagi2006 showed identical PFGE types to strain CB121, which was associated with food-borne botulism in Japan in 1999.

Figure 2.

PFGE genotyping. The dendrogram and PFGE patterns of Sma I digested DNA from 27 C. botulinum type A strains are shown. Similarity analysis was performed using the Dice coefficient, and clustering was examined by the unweighted pair group method with arithmetic averages.

The new multiplex PCR method for boNT/A gene cluster typing established in this study is able to classify reference strains (62A and Kyoto-F) into their previously described cluster types (1 and 2, respectively) (5). The detection limit of “boNT/A1, A2” PCR was from 5.5 × 10 to 2.8 × 102 cells/ml, and of “ha33, p47” PCR from 2.1 × 102 to 2.1 × 103 cells/ml of culture dilutions (data not shown). The PCR-based boNT/A gene cluster typing method reported is a combination of BoNT/A subtyping by PCR-RFLP and ha33 and p47gene detection by separate PCR (5); however, our PCR method has the advantages of simplicity, rapidity, specificity and sensitivity, so it would be applicable not only for molecular typing, but also the diagnosis of botulism.

A correlation between boNT/A gene cluster types and geographical distribution has been reported (5). Cluster type 1 and 3 strains are predominant in the USA, while cluster type 2 strains are predominant in Europe. Isolates associated with infant botulism in Japan were clearly divided into cluster type 2 and 3 by their time periods, and shown to be related to isolates from honey of South American origin and food-borne botulism, respectively. This is the first report of the genetic relationship between isolates associated with infant botulism and food-borne botulism in Japan. C. botulinum type A is rarely found in Japanese soil, while type C and E are widely distributed (12). There is a possibility that imported goods are related to botulism cases. In other countries, in addition to honey, powdered infant formula (13), baby food (14) and house dust (15) have been reported as causes of infant botulism. Further risk assessment of several food and environmental samples to prevent infant botulism are warranted.

While boNT/A gene cluster typing is less discriminating than PFGE genotyping, it is excellent for genetic comparison among different laboratories or countries. The application of multiplex PCR assays will contribute to understanding the local and geographic epidemiology of C. botulinum.

ACKNOWLEDGMENTS

We thank Y. Takeda (Hiroshima Prefectural Institute of Public Health and Environment), Division of Bacteriology at Chiba Prefectural Institute of Public Health, and C. Monma (Tokyo Metropolitan Institute of Public Health) for gifts of C. botulinum strains. This work was partially supported by a grant for research on food safety from the Ministry of Health, Labor and Welfare, Japan.

Ancillary