Novel multiplexed genotyping of human papillomavirus using a VeraCode-allele-specific primer extension method

Authors


Iwao Kukimoto, Pathogen Genomics Center, National Institute of Infectious Diseases, 4-7-1 Gakuen, Musashi-murayama, Tokyo 208-0011, Japan.Tel: +81 42 561 0771; fax: +81 42 567 5632; email: ikuki@nih.go.jpReceived 8 September 2011; accepted 3 November 2011.

ABSTRACT

A VeraCode-allele-specific primer extension (ASPE) method was applied to the detection and genotyping of human papillomavirus (HPV)-DNA. Oligonucleotide primers containing HPV-type-specific L1 sequences were annealed to HPV-DNA amplified by PGMY-PCR, followed by ASPE to label the DNA with biotinylated nucleotides. The labeled DNA was captured by VeraCode beads through hybridization, stained with a streptavidin-conjugated fluorophore, and detected by an Illumina BeadXpress® reader. By using this system, 16 clinically important HPV types (HPV6, 11, 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66 and 68) were correctly genotyped in a multiplex format. The VeraCode-ASPE genotyping of clinical DNA samples yielded identical results with those obtained by validated PGMY-reverse blot hybridization assay, providing a new platform for high-throughput genotyping required for HPV epidemiological surveys.

List of Abbreviations: 
ASPE

allele-specific primer extension

HPV

human papillomavirus

MFI

median fluorescence intensity

RBH

reverse blot hybridization

RLB

reverse line blot

SNP

single nucleotide polymorphism

WHO

World Health Organization

Human papillomaviruses (HPV) are recognized as the causative agents of cervical cancer, its precursor lesions, and other anogenital cancers (1). Among more than 100 HPV types so far identified, nearly 40 types infecting the anogenital mucosa are classified as either low- or high-risk types on the basis of their oncogenic potentials (2). A previous large-scale case–control study revealed 15 high-risk types, HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68, 73, and 82, which are closely linked to the development of cervical cancer, with HPV16 the predominant high-risk type worldwide (3). In contrast, low-risk HPV types, including HPV6 and 11, are associated almost exclusively with benign lesions. Due to the lack of a cell culture system to isolate HPV from clinical samples, detection of HPV-DNA is the only reliable means for diagnosis of HPV infection. HPV genotyping is of particular importance for understanding the natural history of HPV infection and management of cervical cancers. In addition, with the worldwide introduction of HPV vaccines that target the two prominent high-risk types, HPV16 and 18, there is a growing demand for reliable and practical HPV genotyping to monitor HPV prevalence and vaccine efficacy at both individual and population levels.

Various molecular techniques have been developed for detection of HPV-DNA, most of which rely on amplification of HPV-DNA by PCR. The PCR of HPV-DNA generally utilizes degenerate/consensus primer systems, such as MY09/11 (4), PGMY09/11 (5), GP5+/6+ (6), or SPF (7), all of which are designed to amplify the L1 region of the HPV genome. For HPV genotyping, PCR is followed by sequence analysis, restriction fragment length polymorphism analysis, or hybridization with type-specific oligonucleotide probes by a membrane-based RLB assay. Of the various HPV genotyping assays, the RLB assay has the advantage of being able to detect multiple HPV-type infections with greater sensitivity. Several RLB assays combined with different PCR schemes have been established and used for HPV research and diagnostic purposes (8–10). However, the RLB assays are relatively laborious, are limited to a maximum of about 40 samples per assay, and depend on visual read-out of the hybridization signal. To overcome these drawbacks, HPV genotyping using Luminex® suspension array technology has been developed (11–14). The Luminex®-based genotyping coupled with GP5+/6+ PCR allowed sensitive and specific genotyping of 27 mucosal HPV types in a 96-well plate format with a digital read-out (13). Moreover, a modified version of GP5+/6+ PCR was successfully introduced into the Luminex®-based assay, and showed improved sensitivity (15).

A VeraCode-ASPE method was first developed for the detection of SNP in the human genome (16) and has been applied to multiplex SNP genotyping on the Illumina BeadXpress® platform (17, 18). The ASPE primer is composed of two distinct regions: the 5′ region that contains the capture sequence, which is used in a subsequent hybridization reaction, and the 3′ region that contains the genomic target region with a SNP nucleotide at the extreme 3′ end. For SNP genotyping, the ASPE primer that matches the SNP nucleotide to the genome is extended by the primer extension reaction and is thus labeled with biotinylated nucleotides. After the primer extension, the products are mixed with VeraCode beads, so that the capture sequence on the primer hybridizes to its complementary sequence attached to the VeraCode beads. Labeling is then carried out with a streptavidin-fluorophore conjugate, followed by scanning and detection of the fluorescent signal using an Illumina BeadXpress® reader (Illumina Inc., San Diego, CA, USA).

In this work, the VeraCode-ASPE method on the Illumina BeadXpress® platform was evaluated for its suitability as a method to detect and genotype HPV-DNA (Fig. 1). The HPV-DNA amplified by PGMY-PCR was selected as a target for the VeraCode-ASPE genotyping, as PGMY-PCR has been validated as a sensitive and specific means for HPV-DNA amplification (19, 20). HPV-type-specific ASPE primers were designed to target the PCR amplicons of 16 HPV types (HPV6, 11, 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66 and 68) in the 3′ region (Table 1), and with type-specific capture sequences in the 5′ region. The Tm values of the HPV-type-specific sequences, the lengths of which ranged from 19 to 28 bases, were adjusted to be between 54°C and 66°C using Primer3Plus software (http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi) thus allowing similar annealing profiles.

Figure 1.

Outline of VeraCode-ASPE HPV genotyping. HPV-type-specific ASPE primers are annealed to PGMY-PCR products, followed by primer extension by DNA polymerase to label DNA with biotin-14-dCTP. The biotin-labeled DNA is hybridized with VeraCode beads via a capture sequence at the 5′ end of the ASPE primer, and labeled with a streptavidin-fluorophore conjugate to allow detection of fluorescent signals by a BeadXpress® reader in a 96-well plate format. Each VeraCode bead contains digitally assigned barcodes so that the BeadXpress® reader can identify HPV-type-specific signals from each VeraCode-bead, enabling HPV genotyping with digital read-out. The BeadXpress® reader photograph is used with the permission of Illumina Inc. (San Diego, CA, USA).

Table 1.  HPV-type-specific sequences in ASPE primers for VeraCode-ASPE genotyping
TypeDNA sequence (5′–3′)Tm (°C)
HPV6CATCCGTAACTACATCTTCCA55.3
HPV11GCATCTGTGTCTAAATCTGCTAC55.9
HPV16AGTACCTACGACATGGGGAG56.6
HPV18CCAGGTACAGGAGACTGTGTA55.3
HPV31TGCAATTGCAAACAGTGATAC57.3
HPV33CTTTATGCACACAAGTAACTAGTGA55.7
HPV35TGTTCTGCTGTGTCTTCTAGTGA57.8
HPV39CCAACTTTACATTATCTACCTCTATAGA55.3
HPV45CACAAAATCCTGTGCCAAGT58.6
HPV51ACTGCTGCGGTTTCCCCAA65.6
HPV52GGAATACCTTCGTCATGGC57.9
HPV56TGATGCACGAAAAATTAATCAG57.9
HPV58TGACATTATGCACTGAAGTAACTAAG57.0
HPV59AAAGAATATGCCAGACATGTG55.3
HPV66AGTTAATGTGCTTTTAGCTGC54.3
HPV68GCTGTACCAAATATTTATGATCCTAA57.1

HPV-DNA, which was provided by the HPV laboratory network in the WHO as a quality-assured authentic panel for validation of HPV genotyping, was used to assess the sensitivity and specificity of the VeraCode-ASPE HPV genotyping. Fifty copies of HPV16- and 18-DNA and 500 copies of the other 14 HPV-type DNAs from the panel were subjected to PGMY-PCR with AmpliTaq Gold® polymerase (Applied Biosystems, Foster City, CA, USA) as described (21). One-third of the PCR products was treated with 2 U shrimp alkaline phosphatase and 5 U exonuclease I at 37°C for 45 min, followed by the ASPE reaction in a mixture containing 1× PCR buffer II (Roche, Indianapolis, IN, USA), 2.5 mM MgCl2, 5 μM of each dATP, dGTP and dTTP, 7.5 μM biotin-14-dCTP, 0.05 μM of each ASPE primer, 0.5 U AmpliTaq Gold® polymerase, with denaturation at 95°C for 10 min followed by 50 cycles of 94°C for 30 sec, 56°C for 30 sec, and 72°C for 45 sec. The reaction products were then incubated with the VeraCode bead mixture for 1 hr at 45°C in a VeraCode-bead plate, followed by staining with streptavidin-Alexa-647 in a buffer consisting of 3× standard saline citrate (SSC) and 0.1% Tween 20 for 15 min at room temperature. The VeraCode-bead plate was subjected to scanning by the BeadXpress® reader, and the read-out was expressed as the MFI obtained from each HPV type-assigned bead. As shown in Figure 2a, the 16 types of HPV-DNA were specifically detected with signals from their corresponding VeraCode beads. Signal values from non-target HPV-DNAs were as low as those from DNA-negative samples, and were classified as background noises. Furthermore, when the panel DNA containing a mixture of HPV-DNA was analyzed, corresponding signals from included HPV types were correctly detected (Fig. 2b), which indicates that VeraCode-ASPE typing is applicable to the simultaneous detection of multiple HPV-type DNAs.

Figure 2.

VeraCode-ASPE genotyping of the WHO HPV-DNA proficiency panel. (a) PGMY-PCR products derived from the panel DNA containing each single-type HPV-DNA were subjected to the VeraCode-ASPE reaction and analyzed by the BeadXpress® reader. The signals from each VeraCode bead are shown as the MFI. The VeraCode bead number indicates the HPV type number that is assigned to each bead. (b) PGMY-PCR products derived from the panel DNA containing multiple-type HPV-DNA were subjected to the VeraCode-ASPE reaction and analyzed by the BeadXpress® reader.

To test the suitability of this assay for diagnostic purposes, DNA samples prepared from clinical specimens were analyzed by VeraCode-ASPE HPV genotyping. DNA was purified using the QIAamp® DNA blood kit (QIAGEN, Hilden, Germany) from cervical exfoliated cells that had been collected from outpatients with their informed consent for HPV genotyping. The study design was approved by the institutional review board of the NTT Medical Center, Tokyo. DNA samples were previously genotyped by PGMY-reverse blot hybridization (PGMY-RBH) assay, which had been validated as to be sensitive and specific for genotyping of the 16 HPV types in the studies of the WHO HPV-DNA proficiency panel (20). The same PGMY-PCR products derived from these DNA samples were subjected to VeraCode-ASPE HPV genotyping as carried out for the WHO HPV-DNA panel. A positive result was defined as a signal value more than three-fold the average background value for each HPV-type-specific VeraCode bead. Of 50 clinical samples analyzed by the VeraCode-ASPE assay, 20 samples gave HPV-positive results, whereas the remaining 30 samples were judged to be negative. Table 2 shows raw MFI data and typing results of the VeraCode-ASPE assay with 20 positive samples and one negative sample. Overall, the typing results were identical to those obtained by the PGMY-RBH assay, which strongly suggests that the VeraCode-ASPE assay can substitute for the reverse blot hybridization on the same platform of PGMY-PCR.

Table 2.  VeraCode-ASPE genotyping of DNA from clinical specimens
DNA no.HPV6 HPV45 Typing resultHPV11 HPV51HPV16 HPV52HPV18 HPV56HPV31 HPV58HPV33 HPV59HPV35 HPV66HPV39 HPV68
  1. Signal values above cut-off values are indicated in bold letters.

#164446504710253475378
 582853750514871424147
 HPV51       
#1646233185209298194207204224
 21332023714999243215672262
 HPV56       
#164720323714047281219215191240
 21729720022421719118647307
 HPV16, 59       
#1650221243214296246255221231
 25332312271260251229669333
 HPV52       
#165247545114057465697
 5914024978555655608173
 HPV52       
#1654201212186316206202216258
 82128921919114963197743312
 HPV45, 58       
#16573893833184343533633341570
 36344546218395364346825431
 HPV39, 52       
#16611201301282381661361494599
 156221151134123137622255
 HPV39       
#166224222145495244186223238270
 22927926066209230231518286
 HPV16, 52       
#16662042522654301236191225265
 223330226243169902255565996
 HPV16, 58, 68       
#1668818338858135928486121
 9514810338849483435178
 HPV16, 52       
#16691181561221897566129148151
 14320714013130234151449224
 HPV31, 58       
#1672209209214281220203170241
 21926621620122802218578290
 HPV58       
#1676919296169968792121
 1001281689999697491190
 HPV51       
#167927927424036487238268278270
 257325293232276265519354
 HPV18       
#168324127839325312276232246266
 249321251233258226552337
 HPV16       
#16849187104130888794103
 9614589101869126638160
 HPV66       
#16851511296983237150122137174
 150221146145145139559233
 HPV16       
#1686196198198289169204235203
 20827620218718620644574275
 HPV59       
#1691230205230346227234216222
 25027522513139226241552317
 HPV56       
#1645150138142252151136148183
 147219143148134131659229
 negative       
DNA(–)188205202289195198213211
 217264206220204222457259
Cut-off565615607868584595638634
 6507916186596116671372778

The principle of the allele-specific primer extension was previously used in tag-array-based HPV genotyping (22, 23); however, the array format of this assay hampers its application to high-throughput HPV genotyping. In contrast, the 96-well plate format of the VeraCode-ASPE method enables HPV genotyping for large amounts of clinical samples. Furthermore, there are a total of 144 different sets of VeraCode beads, and thus it is possible to include more HPV types in the VeraCode-ASPE genotyping format. In conclusion, the VeraCode-ASPE genotyping is a powerful new tool for the high-throughput HPV genotyping that will be required for large-scale surveillance of HPV-type distribution at the population level in the near future.

ACKNOWLEDGMENTS

This work received financial support from the Ministry of Health, Labor and Welfare in Japan, and the WHO HPV laboratory network. We thank Dr Roland Sahli at Centre Hospitalier Universitaire Vaudois in Lausanne for technical support for the introduction of the PGMY-RBH assay.

DISCLOSURE

The authors did not receive any financial support from the companies whose products were used in this work. The authors have no conflict of interest to declare.

Ancillary