SEARCH

SEARCH BY CITATION

Keywords:

  • Bifidobacterium;
  • green tea;
  • human intestinal microbiota;
  • prebiotics

ABSTRACT

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGMENTS
  7. DISCLOSURE
  8. REFERENCES

Green tea is one of the most popular beverages in the world. Its beneficial health effects and components have been extensively reviewed. However, little is known about the influence of green tea consumption on the human intestinal microbiota (HIM), which plays a crucial role in human health. Ten volunteers who did not usually consume green tea, drank it for 10 days and then stopped drinking it for 7 days. Their fecal samples were collected at three time points: before beginning the 10-day green-tea regime, at the conclusion of that 10 days, and 7 days after stopping the regime. Their fecal samples were analyzed by terminal restriction fragment length polymorphism with specific primer-restriction enzyme systems for HIM and by using a real-time PCR method for the Bifidobacterium species. Although the HIM of each subject was relatively stable, the proportion of Bifidobacterium species played an important role in the classification of their fecal microbiota. Although there were inter-individual differences in the Bifidobacterium species, an overall tendency for the proportion of bifidobacteria to increase because of green tea consumption was noted. However, little change was observed in the composition of Bifidobacterium species in each sample. This suggests that the change in proportion was induced, not by an inter-species transition, but by an intra-species increase and/or decrease. In conclusion, green tea consumption might act as a prebiotic and improve the colon environment by increasing the proportion of the Bifidobacterium species.

List of Abbreviations: 
B.

Bifidobacteria

C.

Clostridium

HIM

human intestinal microbiota

OTU

operational taxonomic unit

T-RFLP

terminal restriction fragment length polymorphism

T-RF

terminal restriction fragment

UPGMA

unweighted pair-group method with arithmetic means

The HIM, a community of microbial cells that outnumber the eukaryotic cell population of a host by a factor of 10, is closely related to our health status (1, 2). The HIM plays a crucial role in nutrient absorption, development of our immune systems, and resistance to exogenous pathogens (1, 3–7).

Despite intensive studies, it has been difficult to determine the characteristics and composition of the HIM because of inter-individual diversity and continuous alterations in the community, which is influenced by environmental exposure (8), diet (9, 10), drugs (e.g., antibiotics) (11), and health status (12, 13). In fact, these factors can control the composition of the HIM. In particular, dietary ingredients directly affect the composition of the HIM by supplying nutrients.

After water, tea is the most commonly consumed beverage in the world. Based on the process by which it is manufactured, there are four types of tea: green, black, oolong, and white tea. Green tea, they type most often consumed in Asia, is made by precluding oxidation of tea polyphenols (14, 15). The polyphenols are composed mainly of several kinds of catechins, including epigallocatechin gallate, epigallocatechin, epicatechin gallate, epicatechin, gallocatechin, gallocatechin gallate, and catechin. Interest in the health effects of green tea and its components has been increasing, and many beneficial effects, both direct and indirect, have been reported (16–19).

Modification of HIM can have an indirect effect on human health. Green tea may improve the balance of HIM, resulting in beneficial influences on the health of the host. Because of green tea's important effects on the host, several studies have examined its influence on the human intestinal bacteria, and the effects of its constituents (14, 20, 21). However, there have been only a few studies of green tea's in vitro effects, and little is known about how drinking green tea for a prescribed period modifies the HIM.

In the present study, we assessed changes in the HIM of 10 volunteers who drank green tea instead of water for 10 days. We selected Bifidobacterium species based on their contribution to the data classification and analyzed them quantitatively and qualitatively. We analyzed the fecal samples by T-RFLP with specific primer-restriction enzyme systems and used an adapted real-time PCR method.

MATERIALS AND METHODS

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGMENTS
  7. DISCLOSURE
  8. REFERENCES

Fecal specimens

Ten healthy adult volunteers (six women and four men) aged between 33 and 70 years (average, 47 years) participated in the study. Each subject drank about 1000 mL of green tea every day. The first fecal samples were collected before the subjects began exclusively drinking green tea. The second samples were collected after the subjects had drunk green tea instead of water for 10 days. Seven days after the volunteers had stopped drinking green tea exclusively, the last fecal samples were collected. All subjects were prohibited from taking antibiotics during the whole period of experiment.

DNA isolation from fecal samples

Fecal samples (approximately 4 mg) were suspended in 4 M guanidium thiocyanate, 100 mM Tris-HCl (pH 9.0), and 40 mM EDTA, and then beaten in the presence of zirconia beads using a FastPrep FP100A instrument (MP Biomedicals, Irvine, CA, USA). Thereafter, DNA was extracted from the bead-treated suspension by using a Magtration System 12GC and GC series Magtration-MagaZorb DNA Common Kit 200N (Precision System Science, Chiba, Japan), and the final concentration of the DNA sample adjusted to 10 ng/μL.

Polymerase chain reaction amplification and terminal restriction fragment length polymorphism analysis

Amplification of fecal 16S rDNA, restriction enzyme digestion, size-fractionation of T-RFs, and T-RFLP analysis were performed as described previously (22, 23). PCR was performed using the total fecal DNA and the primers of 5′FAM-labeled 516f (5′-TGCCAGCAGCCGCGGTA-3′; Escherichia coli positions 516 to 532) and 1510r (5′-GGTTACCTTGTTACGACTT-3′; E. coli positions 1510 to 1492). The resulting 16S rDNA amplicons were treated with 2 U of BslI (New England Biolabs, Ipswich, MA, USA) for 1 hr, and the digestives fractionated in an automated sequence analyzer, ABI PRISM 3130xl DNA sequencer (Applied Biosystems, Carlsbad, CA, USA) and GeneMapper (Applied Biosystems).

Assignment of terminal restriction fragments detected

The major T-RFs were identified by computer simulation, which was performed using a T-RFLP analysis program (MiCA3, developed by Shyu et al. (24; http://mica.ibest.uidaho.edu/), a phylogenetic assignment database for T-RFLP analysis of human colonic microbiota (25), and Microbiota Profiler (InfoCom, Tokyo, Japan). Cluster analysis was performed using Microbiota Profiler (InfoCom) based on 29 OTUs distributed from the T-RFs by the method of Nagashima et al. (23). The distances were calculated to determine any similarity among the samples and represented graphically by constructing a dendrogram.

Real-time polymerase chain reaction assays

The relative proportions of Bifidobacterium to total fecal bacteria were analyzed using real-time PCR with SYBR Premix Ex Taq II (TaKaRa Bio, Tokyo, Japan) and the Thermal Cycler Dice Real Time System (TaKaRa Bio). The fold value in target bacteria, normalized to the 16S rRNA gene of total bacteria and relative to the amounts in samples collected before green tea consumption, was calculated for each sample using the 2−ΔΔCt method (26). The primer sets used are shown in Table 1. Amplifications were performed using the following temperature profiles: 1 cycle at 95°C for 30 s, 45 cycles of denaturation at 95°C for 5 s, annealing at 55°C for 30 s, and extension at 72°C for 60 s. Fecal DNA samples were diluted to 10 ng/μL, and the real-time PCR reaction mixture was composed of 20-fold diluted template DNA.

Table 1.  Primer sets for PCR detection of Bifidobacterium spp. and real-time PCR
TargetPrimerSequence (5′ to 3′)Reference
Bifidobacterium spp.g-Bifid-FCTCCTGGAAACGGGTGG(33)
 g-Bifid-RGGTGTTCTTCCCGATATCTACA 
Total bacteriaForwardTCCTACGGGAGGCAGCAGT(35)
 ReverseGGACTACCAGGGTATCTAATCCTGTT 
B. adolescentis groupBiADOg-1aCTCCAGTTGGATGCATGTC(33)
 BiADOg-1bTCCAGTTGACCGCATGGT 
 BiADO-2CGAAGGCTTGCTCCCAGT 
B. angulatum BiANG-1CAGTCCATCGCATGGTGGT(33)
 BiANG-2GAAGGCTTGCTCCCCAAC 
B. bifidum BiBIF-1CCACATGATCGCATGTGATTG(33)
 BiBIF-2CCGAAGGCTTGCTCCCAAA 
B.breve BiBRE-1CCGGATGCTCCATCACAC(33)
 BiBRE-2ACAAAGTGCCTTGCTCCCT 
B. catenulatum groupBiCATg-1CGGATGCTCCGACTCCT(33)
 BiCATg-2CGAAGGCTTGCTCCCGAT 
B. longum subsp. longumBiLON-1TTCCAGTTGATCGCATGGTC(33)
 BiLON-2GGGAAGCCGTATCTCTACGA 
B. longum subsp. infantisBiINF-1TTCCAGTTGATCGCATGGTC(33)
 BiINF-2GGAAACCCCATCTCTGGGAT 
B. dentium BiDEN-1ATCCCGGGGGTTCGCCT(33)
 BiDEN-2GAAGGGCTTGCTCCCGA 
B. animalis subsp. lactis Blact-FCCCTTTCCACGGGTCCC(34)
 Blact-RR: AAGGGAAACCGTGTCTCCAC 

Polymerase chain reaction conditions for specific detection of Bifidobacterium species

For detection of Bifidobacterium species in fecal specimens, previously reported primers were used (Table 1). A DNA solution (5 ng) was subjected to PCR in 20 μL of reaction mixture containing 0.5 U of TaKaRa Ex Taq (TaKaRa Shuzo, Kyoto, Japan), 2 μL of 10 × Ex Taq buffer, 1.6 μL of dNTP mixture (2.5 mM each), and 5 pmol of each primer. The reaction mixtures were amplified using the following program: 95°C for 10 min, followed by 30 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 1 min with a final extension period at 72°C for 10 min. After thermal cycling, 5 μL of the amplified product was run on 1.5% agarose gel, stained with ethidium bromide, and visualized with an ultraviolet transilluminator.

Statistical analysis

Dendrograms were established by the Euclidean distance between the correlation and coefficients and the UPGMA algorithm. The T-RFs were quantified as the percentage of individual T-RF peak areas per total T-RF peak area and this was expressed as the percentage of the area under the peak curve. The 29 OTUs were used in principal component analysis to compare and group T-RFLP patterns. Principle component analysis was performed using PASW Statistics 18 (IBM, Armonk, NY, USA). A paired Student's t-test was used to test for significant differences. Simca P+ (Umetrics, Umea, Sweden) was used for the contribution test.

RESULTS

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGMENTS
  7. DISCLOSURE
  8. REFERENCES

Terminal restriction fragment length polymorphism analysis and clustering of fecal microbiota caused by drinking green tea

As shown in Figures 1 and 2, T-RFs were distributed to the OTUs. Three of 29 OTUs were removed from the list because T-RFs belonging to these OTUs were not detected. The 10-day green-tea regimen generally changed the composition of the fecal microbiotas, although individual responses were varied. Small changes in the proportion of respective OTUs was observed in subjects B, C, and I. Cessation of green-tea consumption also stimulated changes in the fecal microbiota. In subject A, OTU124 and OTU469 showed different patterns of change. Green tea consumption reduced the proportion of OTU469 from 31.5% to 15.3%; however, the relative proportion of OTU124 changed only slightly. At the end of the 7-day no-tea period, the proportion of OTU124 decreased from 34.6% to 17.4%; there was no change in that of OTU469. According to the cluster analysis, each of the three samples from seven subjects (B, C, D, E, G, H, and I) was allocated to the same clusters when all the samples were divided into six clusters (Fig. 3). The three samples from each of the remaining three subjects (A, F, and J) were not allocated to the same clusters because their clustering patterns were different. In subject A, the second (collected after 10 days of green tea consumption) and third (collected 7 days after the subject had stopped drinking green tea) samples were allocated to the same cluster (cluster II). In subject J, the first (collected before the onset of tea drinking) and second samples were allocated to cluster VI. In subject F, only the first and third samples were allocated to cluster IV. Principle component analysis also showed grouping of each sample (Fig. 4).

image

Figure 1. T-RFLP profiles of fecal microbiota in female volunteers. (a–f) Subjects A–F, respectively. Values are expressed as percentages derived from the ratios of the peak area of a particular OTU to the total peak area of all OTUs. 0, before the onset of green tea consumption; 1, after 10 days of green tea ingestion; 2, 7 days after cessation of green tea consumption.

Download figure to PowerPoint

image

Figure 2. T-RFLP profiles of fecal microbiota in male volunteers. (g–j) subjects G–J, respectively. Values are expressed as percentages derived from the ratios of the peak area of a particular OTU to the total peak area of all OTUs. 0, before the onset of green tea consumption; 1, after 10 days of green tea ingestion; 2, 7 days after cessation of green tea consumption.

Download figure to PowerPoint

image

Figure 3. Dendrogram of the fecal bacterial structure as influenced by drinking green tea. The T-RFs generated from fecal DNAs of 10 individuals were distributed to 29 OTUs according to the method of Nagashima (22, 23). The T-RFLP patterns were then analyzed on the basis of the Euclidean distance between the correlation and coefficients and the UPGMA algorithm. A–J, subjects; 0, before the onset of green tea consumption; 1, after 10 days of green tea ingestion; 2, 7 days after cessation of green tea consumption.

Download figure to PowerPoint

image

Figure 4. Principal component analysis showing changes in fecal microbiota composition caused by drinking green tea: A–J, subjects; 0, before the onset of green tea consumption; 1, after 10 days of green tea ingestion; 2, 7 days after the cessation of green tea consumption; filled symbols, samples collected after green tea consumption; unfilled symbols, samples collected before green tea consumption and after tea drinking had stopped.

Download figure to PowerPoint

To examine the OTUs responsible for the effect of green tea on fecal microbiotas, a contribution test was performed using Simca P+ (Umetrics). In two groups of samples collected before and after green tea consumption, OTU124, which was presumed to correspond to bifidobacteria, and OTU853, had the highest absolute contribution scores (Fig. 5). Moreover, of the two groups of samples collected after green tea consumption and after cessation of tea drinking for 7 days, OTU124 and OTU853 also had the highest absolute contribution scores. However, the average proportions of OTU853 and OTU124 in all 30 samples were 0.7% and 13.2%, respectively. Therefore, the bifidobacteria presumed to be included in OTU124 were additionally analyzed.

image

Figure 5. The contribution scores of each OTU in the distributed groups. (a) Between samples collected before the onset of green tea consumption and those obtained after 10 days of drinking green tea. (b) Between samples collected after green tea consumption and samples collected 7 days after tea drinking had stopped.

Download figure to PowerPoint

Quantitative analysis of Bifidobacterium species

Real-time PCR with specific primers was performed to analyze the relative changes in proportions of bifidobacteria in all samples (Fig. 6). Five subjects (B, E, F, G, and H) showed the same pattern: an increase in the proportion of bifidobacteria after drinking green tea and a decrease after stopping tea consumption. Thus, green tea consumption stimulated an increase in the proportion of bifidobacteria and cessation of green tea drinking reduced that proportion. In subject F, a sixfold increase in the proportion of bifidobacteria was observed after drinking green tea. Another three subjects (C, D, and I) showed continuous increases in the proportion of bifidobacteria. In summary, eight of the ten subjects showed increases in the proportion of bifidobacteria because of green tea consumption.

image

Figure 6. Changes in the relative proportions of Bifidobacterium spp. caused by drinking green tea. 0, before the onset of green tea consumption; 1, after 10 days of green tea ingestion; 2, 7 days after the cessation of green tea consumption. Each set of experiments was repeated at least three times. Values are expressed as mean ± standard deviation. *, statistically significant difference between samples collected before green tea consumption and after 10 days of drinking green tea (P <;0.05); **, statistically significant difference between samples collected after 10 days of drinking green tea and those collected 7 days after tea drinking had stopped (P <0.05); ***, statistically significant difference between samples collected after 10 days of drinking green tea and those collected 7 days after tea drinking had stopped (P <0.01).

Download figure to PowerPoint

Species composition of bifidobacteria

The presence of Bifidobacterium species was investigated using species-specific primers. Table 2 shows the species composition of bifidobacteria in individual fecal microbiotas. We found inter-individual differences in species composition. Subject A was inhabited by the B. adolescentis group, B. breve, the B. catenulatum group, B. longum subsp. longum, and B. longum subsp. infantis. However, only B. breve was detected in subject C. Drinking green tea altered the HIM composition in some subjects. In subject A, B. breve and B. longum subsp. infantis were not detected after green tea consumption. When this subject stopped drinking green tea, B. longum subsp. infantis reappeared. B. animalis subsp. lactis and B. longum subsp. infantis were not detected after green tea consumption in subjects E and J, respectively. These two species did not appear even after tea drinking had stopped. In subject G, B. longum subsp. longum was newly detected after tea consumption and persisted even after consumption had ceased. The frequencies of occurrence of each Bifidobacterium species are summarized in Table 3. B. angulatum, B. dentium, and B. bifidum were not detected in any samples.

Table 2.  Species compositions of fecal bifidobacteria in subjects during green tea drinking
Subject ID Bifidobacterium species detected
Pre-administrationGreen tea administrationPost-administration
A B. adolescentis group B. adolescentis group B. adolescentis group
  B. breve   
  B. catenulatum group B. catenulatum group B. catenulatum group
  B. longum subsp. longum B. longum subsp. longum B. longum subsp. longum
  B. longum subsp. infantis  B. longum subsp. infantis
B B. adolescentis group B. adolescentis group B. adolescentis group
  B. catenulatum group B. catenulatum group B. catenulatum group
  B. longum subsp. longum B. longum subsp. longum B. longum subsp. longum
  B. longum subsp. infantis B. longum subsp. infantis B. longum subsp. infantis
C B. breve B. breve B. breve
D B. adolescentis group B. adolescentis group B. adolescentis group
E B. catenulatum group B. catenulatum group B. catenulatum group
  B. animalis subsp. lactis   
F B. adolescentis group B. adolescentis group B. adolescentis group
  B. catenulatum group B. catenulatum group B. catenulatum group
  B. longum subsp. longum B. longum subsp. longum B. longum subsp. longum
G B. breve B. breve B. breve
  B. catenulatum group B. catenulatum group B. catenulatum group
   B. longum subsp. longum B. longum subsp. longum
H B. catenulatum group B. catenulatum group B. catenulatum group
  B. longum subsp. longum B. longum subsp. longum B. longum subsp. longum
I B. adolescentis group B. adolescentis group B. adolescentis group
  B. catenulatum group B. catenulatum group B. catenulatum group
  B. longum subsp. longum B. longum subsp. longum B. longum subsp. longum
J B. catenulatum group B. catenulatum group B. catenulatum group
  B. longum subsp. longum B. longum subsp. longum B. longum subsp. longum
  B. longum subsp. infantis  
Table 3.  Frequencies of occurrence of Bifidobacterium species in subjects during green tea drinking
SpeciesFrequencies of occurrence
Pre-administrationGreen tea administrationPost-administration
B. catenulatum group8/108/108/10
B. longum subsp. longum6/107/107/10
B. adolescentis group5/105/105/10
B. breve 3/102/102/10
B. longum subsp. infantis3/101/102/10
B. animalis subsp. lactis 1/100/100/10

DISCUSSION

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGMENTS
  7. DISCLOSURE
  8. REFERENCES

Researchers have studied the effects of green tea and tea phenols on health extensively. However, very few studies have investigated the relationship between drinking green tea and HIM under in vivo conditions and by molecular analyses. In this study, we used T-RFLP and real-time PCR to demonstrate how 10 days of green tea ingestion modifies the HIM. To minimize the effects of green tea consumed before the experiment, we selected 10 volunteers who did not usually drink tea.

Bacterial composition analyzed by T-RFLP showed inter-individual variation among subjects and intra-individual variation between the three time points. These variations might be due partly to differences in dietary intake, which we did not control during this experiment. However, we noted little change in the fecal microbiota of some subjects across all three time points despite their variable dietary intake, suggesting that dietary differences have little effect.

Data mining was used to calculate contribution scores, which were classified into two groups based on the average proportion of each OTU in each subject. This analysis suggested that changes in the fecal microbiota population resulting from green tea consumption is mainly attributable to OTU124, which we presumed corresponded to bifidobacteria; these organisms have been studied extensively for a long time because of their probiotic health benefits (27, 28). Additional real-time PCR analysis showed that drinking green tea increased the proportion of bifidobacteria in eight of ten subjects; the proportion of bifidobacteria in five of these eight subjects decreased after green tea ingestion had stopped. This is in agreement with other reports describing bifidobacterial growth in humans consuming green tea (29–31).

Operational taxonomic unit 853 had the highest contribution score. Though the average proportion of OTU853 was low, several subjects, such as C, D, H and I, had decreased proportions of OTU853 after green tea consumption and increased proportions after tea drinking had stopped. Moreover, OTU853 was not detected in samples collected after green tea consumption in these four subjects. These patterns might have affected the statistical analysis and calculation of high contribution scores. In two subjects, F and G, we did not detect OTU853 throughout this experiment. Non-detection of OTU853 in many fecal samples lowered the average proportion. On the other hand, we did not observe a correlation between OTU469 and green tea consumption in spite of the high proportion of OTU469 in all subjects.

Two processes may explain the effect of green tea on the proportion of bifidobacteria in the fecal microbiota. First, green tea can directly affect the composition of the microbiota. Its constituents may act as prebiotics, which cause proliferation of bifidobacteria in the colon. Goto et al. reported the influence of tea catechins on the fecal flora of the elderly (30). Administration of four tea catechins caused significant increases in the amounts of bifidobacteria and lactobacilli, whereas the amounts of Bacteroidaceae, eubacteria, clostridia, and Enterobacteriaceae decreased. In addition, Tzounis et al. reported that (+)-catechin exposure in vitro results in growth of bifidobacteria (20). Moreover, green tea has moderate growth-promoting activity for Bifidobacterium spp., including B. adolescentis, B. longum, B. breve, and B. infantis (31). Based on these effects of green tea and its constituents, green tea may be a promising prebiotic beverage.

Furthermore, selective anti-bacterial properties of green tea and its constituents may act as indirect prebiotics. Researchers have reported both in vitro and in vivo studies of such selective anti-bacterial activity. In one study, growth of Bifidobacterium spp. and Lactobacillus spp. was less affected by several tea polyphenol components, including epicatechin, catechin, and caffeic acid, than was that of other bacterial species such as Clostridium difficile, C. perfringens, and Streptococcus pyogenes (21). In addition, the percentage of Bifidobacterium spp. relative to total bacterial counts increased significantly after intake of tea phenols and volatile fatty acids, including acetic acid and propionic acid, which could reduce the fecal pH and inhibit potential pathogenic species (14, 32). In a study on calves, Ishihara et al. found that although the total bacterial count of Bifidobacterium spp. decreased with the growth time, their relative proportion increased after exposure to green tea extracts because the growth of other bacterial species decreased at a higher rate (29). In summary, although green tea and its components do not directly affect the absolute counts of bifidobacteria, green tea is a prebiotic because it inhibits other bacterial species. It is difficult to judge, through an in vivo study, whether drinking green tea affects the growth of bifidobacteria directly or indirectly. However, as noted in prior reports, it is certain that green tea and its components have a positive effect on the growth of bifidobacteria.

Researchers have used PCR analysis using specific primers to evaluate the effect of green tea consumption on the species composition of bifidobacteria (33–35). Although a previous report had shown that PCR-inhibiting substances prevented amplification with any primers of DNA extracted from some fecal specimens (36), we detected bifidobacteria at least once in every sample in this study. Despite changes in proportions of bifidobacteria to total bacteria caused by drinking green tea, the species compositions were relatively stable. This means that the changes in proportions were not induced by inter-species transition, but rather by intra-species increase and/or decrease. Moreover, we did not observe differences in the relationships among specific Bifidobacterium species and fluctuations in this proportion. For example, although subject A had five species, only a small change in the Bifidobacterium proportion was observed after tea consumption. Subjects C and D, who each had only one species, showed an increase in the proportion of Bifidobacterium. This suggests that competition among species and/or interaction with other species in the colon causes great changes in the compositions and proportions of some bacteria. In addition, other Bifidobacterium species that we did not analyze in this study, such as B. ruminantium and B. gallicum, might have been present.

We detected B. longum subsp. infantis, a species characteristically of infants, in three subjects. This corresponds to the report of Saito et al. (9). Although we did not detect B. longum subsp. infantis after green tea consumption in two subjects, we did detect it in one subject after the tea regimen had been stopped. In subject B, however, we continuously detected B. infantis in all three samples. Moreover, we did not detect B. animalis subsp. lactis in subject E and B. longum subsp. infantis in subject J after green tea ingestion and did not recover these organisms after the 7-day no-tea period. We did not detect B. longum subsp. longum in subject G before the onset of green tea consumption but it was present afterwards. Anti-bacterial or bacterial growth-stimulating factors in the tea may modulate the appearance and disappearance of specific speciesy. Moreover, inter-individual variation in absolute amounts of various species and inter-individual responses to the green tea consumption might influence this. Further investigation of the species-specific influence of green tea is necessary.

The B. catenulatum group and B. longum subsp. longum are reportedly dominant Bifidobacterium species in human adults (36). Our study also showed a similar pattern of bifidobacterial frequencies. However, in this study we did not detect B. bifidum, which others have previously been detected in 38% of adults.

The composition of HIMs change depending on age (37, 38). In this study, we deliberately selected subjects of widely differing ages to elucidate the patterns of influence of different age ranges. However, we did not observe a correlation between age and proportion of Bifidobacterium spp. in this study.

In this study, green tea consumption changed the compositions of fecal microbiotas and demonstrated prebiotic properties. More studies of individuals on controlled diets are necessary to establish the effect of green tea on human fecal microbiota and any concomitant improvements in human health.

ACKNOWLEDGMENTS

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGMENTS
  7. DISCLOSURE
  8. REFERENCES

The NHK (Japan Broadcasting Corporation) funded part of this project and assisted with recruitment of the volunteers.

REFERENCES

  1. Top of page
  2. ABSTRACT
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGMENTS
  7. DISCLOSURE
  8. REFERENCES
  • 1
    Tancrède C. (1992) Role of human microflora in health and disease. Eur J Clin Microbiol Infect Dis 11: 10125.
  • 2
    Savage D.C. (1977) Microbial ecology of the gastrointestinal tract. Annu Rev Microbiol 31: 10733.
  • 3
    Guarner F. (2006) Enteric flora in health and disease. Digestion 73: 512.
  • 4
    Servin A.L. (2004) Antagonistic activities of lactobacilli and bifidobacteria against microbial pathogens. FEMS Microbiol Rev 28: 40540.
  • 5
    Hooper L.V. (2004) Bacterial contributions to mammalian gut development. Trends Microbiol 12: 12934.
  • 6
    Macfarlane S., Macfarlane G.T. (2006) Composition and metabolic activities of bacterial biofilms colonizing food residues in the human gut. Appl Environ Microbiol 72: 620411.
  • 7
    Camp J.G., Kanther M., Semova I., Rawls J.F. (2009) Patterns and scales in gastrointestinal microbial ecology. Gastroenterology 136: 19892002.
  • 8
    Turnbaugh P.J., Hamady M., Yatsunenko T., Cantarel B.L., Duncan A., Ley R.E., Sogin M.L., Jones W.J., Roe B.A., Affourtit J.P., Egholm M., Henrissat B., Heath A.C., Knight R., Gordon J.I. (2009) A core gut microbiome in obese and lean twins. Nature 457: 4804.
  • 9
    Saito Y., Hamanaka Y., Saito K., Takizawa S., Benno Y. (2002) Stability of species composition of fecal bifidobacteria in human subjects during fermented milk administration. Curr Microbiol 44: 36873.
  • 10
    Turnbaugh P.J, Ridaura V.K., Faith J.J., Rey F.E., Knight R., Gordon J.I. (2009) The effect of diet on the human gut microbiome: a metagenomic analysis in humanized gnotobiotic mice. Sci Transl Med 1: 6ra14.
  • 11
    Dethlefsen L., Huse S., Sogin M.L., Relman D.A. (2008) The pervasive effects of an antibiotic on the human gut microbiota, as revealed by deep 16S rRNA sequencing. PLoS Biol 6: 238399.
  • 12
    Matsumoto M., Kakizoe K., Benno Y. (2007) Comparison of fecal microbiota and polyamine concentration in adult patients with intractable atopic dermatitis and healthy adults. Microbiol Immunol 51: 3746.
  • 13
    Nishikawa J., Kudo T., Sakata S., Benno Y., Sugiyama T. (2009) Diversity of mucosa-associated microbiota in active and inactive ulcerative colitis. Scand J Gastroenterol 44: 1806.
  • 14
    Okubo T., Ishihara N., Oura A., Serit M., Kim M., Yamamoto T., Mitsuoka T. (1992) In vivo effects of tea polyphenol intake on human intestinal microflora and metabolism. Biosci Biotechnol Biochem 56: 58891.
  • 15
    Lambert J.D., Sang S., Yang C.S. (2007) Biotransformation of green tea polyphenols and the biological activities of those metabolites. Mol Pharmacol 4: 81925.
  • 16
    Pastore R.L., Fratellone P. (2006) Potential health benefits of green tea (Camellia sinensis): a narrative review. Explore (NY) 2: 5319.
  • 17
    Cabrera C., Artacho R., Giménez R. (2006) Beneficial effects of green tea: a review. J Am Coll Nutr 25: 7999.
  • 18
    Chacko S.M., Thambi P.T., Kuttan R., Nishigaki I. (2010) Beneficial effects of green tea: a literature review. Chinese Medicine 6: 13.
  • 19
    Schneider C., Segre T. (2009) Green tea: potential health benefits. Am Fam Physician 79: 5914.
  • 20
    Tzounis X., Vulevic J., Kuhnl G.G., George T., Leonczak J., Gibson G.R., Kwik-Uribe C., Spencer J.P. (2008) Flavanol monomer-induced changes to the human faecal microflora. Br J Nutr 99: 78292.
  • 21
    Lee H.C., Jenner A.M., Low C.S., Lee Y.K. (2006) Effect of tea phenolics and their aromatic fecal bacterial metabolites on intestinal microbiota. Res Microbiol 157: 87684.
  • 22
    Nagashima K., Hisada T., Sato M., Mochizuki J. (2003) Application of new primer-enzyme combinations to terminal restriction fragment length polymorphism profiling of bacterial populations in human feces. Appl Environ Microbiol 69: 125162.
  • 23
    Nagashima K., Mochizuki J., Hisada T., Suzuki S., Shimomura K. (2006) Phylogenetic Analysis of 16S Ribosomal RNA Gene Sequences from Human Fecal Microbiota and Improved Utility of Terminal Restriction Fragment Length Polymorphism Profiling. Bioscience and Microflora 25: 99107.
  • 24
    Shyu C., Soule T., Bent S.J., Foster J.A., Forney L.J. (2007) MiCA: a web-based tool for the analysis of microbial communities based on terminal-restriction fragment length polymorphisms of 16S and 18S rRNA genes. Microb Ecol 53: 56270.
  • 25
    Matsumoto M., Sakamoto M., Hayashi H., Benno Y. (2005) Novel phylogenetic assignment database for terminal-restriction fragment length polymorphism analysis of human colonic microbiota. J Microbiol Methods 61: 30519.
  • 26
    Livak K.J., Schmittgen T.D. (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt Method. Methods 25: 4028.
  • 27
    Mitsuoka T. (1990) Bifidobacteria and their role in human health. J Ind Microbiol Biotechnol 6: 2638.
  • 28
    Picard C., Fioramonti J., Francois A., Robinson T., Neant F., Matuchansky C. (2005) Review article: bifidobacteria as probiotic agents–-physiological effects and clinical benefits. Aliment Pharmacol Ther 22: 495512.
  • 29
    Ishihara N., Chu D.C., Akachi S., Juneja L.R. (2001) Improvement of intestinal microflora balance and prevention of digestive and respiratory organ diseases in calves by green tea extracts. Livest Prod Sci 68: 21729.
  • 30
    Goto K. (1998) The influence of tea catechins on fecal flora of elderly residents in long-term care facilities. Annals of Long-Term Care 6: 438.
  • 31
    Ahn Y.J., Sakanaka S., Kim M.J., Kawamura T., Fujisawa T., Mitsuoka T. (1990) Effect of green tea extract on growth of intestinal bacteria. Microb Ecol Health Dis 3: 3358.
  • 32
    Gibson G.R., Fuller R. (2000) Aspects of in vitro and in vivo research approaches directed toward identifying probiotics and prebiotics for human use. J Nutr 130: 3915S.
  • 33
    Matsuki T., Watanabe K., Fujimoto J., Kado Y., Takada T., Matsumoto K., Tanaka R. (2004) Quantitative PCR with 16S rRNA-gene-targeted species-specific primers for analysis of human intestinal bifidobacteria. Appl Environ Microbiol 70: 16773.
  • 34
    Malinen E., Kassinen A., Rinttilä T., Palva A. (2003) Comparison of real-time PCR with SYBR Green I or 5′-nuclease assays and dot-blot hybridization with rDNA-targeted oligonucleotide probes in quantification of selected faecal bacteria. Microbiology 149: 26977.
  • 35
    Nadkarni M.A., Martin F.E., Jacques N.A., Hunter N. (2002) Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set. Microbiology 148: 25766.
  • 36
    Matsuki T., Watanabe K., Tanaka R., Fukuda M., Oyaizu H. (1999) Distribution of bifidobacterial species in human intestinal microflora examined with 16S rRNA-gene-targeted species-specific primers. Appl Environ Microbiol 65: 450612.
  • 37
    Hopkins M.J., Sharp R., Macfarlane G.T. (2002) Variation in human intestinal microbiota with age. Dig Liver Dis 34: 128S.
  • 38
    Hopkins M.J., Macfarlane G.T. (2002) Changes in predominant bacterial populations in human faeces with age and with Clostridium difficile infection. J Med Microbiol 51: 44854.