SEARCH

SEARCH BY CITATION

Keywords:

  • fish;
  • genotyping;
  • Japan;
  • mycobacterium

Abstract

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGMENTS
  7. DISCLOSURE
  8. REFERENCES

In Japan, a Mycobacterium marinum-like mycobacterium was isolated from the yellowtail, Seriola quinqueradiata. The species was identified as M. marinum by a commercial mycobacterial DNA-DNA hybridization kit. Nevertheless, PCR restriction analysis of the DNA of its RNA polymerase β-subunit gene definitively showed that this Mycobacterium sp. was M. ulcerans. PCR analysis revealed the genotypic characteristics of M. ulcerans in the Mycobacterium sp., only the mup053 gene sequence being absent, as has been found previously in other piscine mycobacteria such as M. marinum strains DL240490 and DL045 and M. pseudoshottsii. With one exception, this Mycobacterium sp. and M. pseudoshottsii had identical 16S rRNA gene sequences, which is also probably true of M. marinum strains DL240490 and DL045. Similarly, according to comparisons of the 16S rRNA gene, ITS region, and hsp65 gene sequences, this Mycobacterium sp. is more closely related to M. pseudoshottsii than to M. ulcerans or M. marinum. A PCR product of approximately 2000 bp was amplified from region of difference 9 in the Mycobacterium sp. The nucleotide sequence revealed insertion of IS2404, the sequence of which is 1366 bp long. The novel single nucleotide polymorphisms identified in this region distinguished this Mycobacterium sp. from M. marinum strain DL240490 and M. pseudoshottsii. The present findings raise the possibility that these species have a common ancestor. Further studies are required to improve our understanding of the relationship between their geographical origin and genetic diversity.

List of Abbreviations:
16S rRNA

16S ribosomal RNA

DDH

DNA-DNA hybridization

hsp65

65kDa heat-shock protein

ITS

internal transcribed spacer

PRA

PCR-restriction analysis

RIDOM

Ribosomal Differentiation of Microorganisms

rpoB

RNA polymerase-subunit

SNPs

single nucleotide polymorphisms

Mycobacteria are Gram-positive, aerobic, acid-fast, nonmotile bacteria that cause mycobacteriosis in various hosts. Mycobacteriosis in cultured yellowtail was first reported in 1985 in Sukumo Bay, Kochi Prefecture, Japan [1], and subsequently reported in cultured striped jack, Pseudocaranx dentex [2]. A resurgence of mycobacteriosis has recently occurred in Japan; however, no effective treatment for this disease is yet available to the aquaculture industry [3].

Kusuda et al. previously isolated a mycobacterial species from the yellowtail that is photochromogenic and slow growing, as is M. marinum, and initially classified it as M. seriolae based on some distinctive phenotypic characteristics [1]. A subsequent study showed that this piscine mycobacterium displayed a close phylogenetic relationship to M. marinum [4]. To confirm its relationships, in this study we examined other genotypic characteristics.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. MATERIALS AND METHODS
  4. RESULTS
  5. DISCUSSION
  6. ACKNOWLEDGMENTS
  7. DISCLOSURE
  8. REFERENCES

Bacterial strains and DNA extraction

The Mycobacterium sp. strains used in this study are listed in Table 1. They were cultured at 25°C for four weeks on a slant of 1% Ogawa egg medium. M. marinum type strain ATCC 927 and M. smegmatis type strain ATCC 19420 were cultured at 25°C for two weeks and three days, respectively. A loop of each slant culture was suspended in 500 μL of lysis buffer (50 mM Tris, pH 8.5, 50 mM EDTA, 15% (wt/vol) sucrose, 1 mg/mL lysozyme, 2 mg/mL RNase) and incubated at 37°C for 1 hr. Following incubation, 5 μL of 20 mg/mL proteinase K and 50 μL of 10% (wt/vol) sodium dodecyl sulfate were added to the mixture and incubated at 55°C overnight. The DNA was extracted three times with water-saturated phenol-chloroform-isoamyl alcohol (25:24:1, vol/vol/vol) and precipitated with ethanol-sodium acetate at −20°C overnight. The DNA pellets were washed with 70% ethanol and resuspended in TE buffer (10 mM Tris, pH 8.5, 1 mM EDTA). The DNA of M. ulcerans strain DN2798 that had been isolated from a Japanese patient was obtained from the Gifu Type Culture Collection, Gifu University, Japan. The DNA of M. marinum strain M was obtained from the American Type Culture Collection.

Table 1. Mycobacterium sp. strains used in this study
Reference strainDate of isolationSourceGeographic originOrgan of isolationReference
  1. NA, not available; NC, not clear.

YM-127 September 1985YellowtailKochiKidney[1]
YM-2 (ATCC 49159)4 October 1985YellowtailKochiSpleen[1]
YM-3 (ATCC 49160)1 February 1986YellowtailKochiKidney[1]
M-1420 February 1991Striped jackOgasawara, TokyoKidney[2]
M-2727 February 1991Striped jackOgasawara, TokyoSpleen[2]
SMY-0107197NC, 2004YellowtailOitaKidneyNA
NJB 041918 October 2004YellowtailKagoshimaKidney[4]
NJB 042018 October 2004YellowtailKagoshimaSpleen[4]
Table 2. Comparison of the 3′-end sequence of the 16S rRNA geneThumbnail image of
  • *Nucleotide positions are based on the Escherichia coli 16S rRNA gene sequence numbering (GenBank accession number J01859).

  • **Sequences described previously by Portaels et al. [17].

  • ITM, Institute of Tropical Medicine.

  • Table 3. Comparisons of the almost complete 16S rRNA gene, ITS region, and partial hsp65 and rpoB gene sequences
    Species/strainNucleotide sequence positions
    16S rRNA*ITS regionhsp65**rpoB**
    95487–84929671005121512471288177204209204320386388396546112612181269
    1. * Nucleotide positions are based on the Escherichia coli 16S rRNA gene sequence numbering.

    2. ** Nucleotide positions are based on the M. ulcerans strain Agy99 hsp65 and rpoB gene sequence numberings (GenBank accession number CP000325).

    M. ulcerans
    Agy99TGGAAGTGCGGTTCCCACCTC
    ATCC 19423TGGAAGTGCGGTTCCCACTTC
    M. shinshuense
    ATCC 33728TGGGAGTGGGGTCTCCATTCC
    M. marinum
    ATCC 927TGGAAGTAAGGTCCCTGCTCG
    M. pseudoshottsii
    JCM 15466CGAAGTCAAAGCCCTCGCTCC
    Mycobacterium sp.
    YM-1CGAAGTCAAAGCCCTCGCCCC
    YM-2CGAAGTCAAAGCCCTCGCCCC
    YM-3CGAAGTCAAAGCCCTCGCCCC
    M-14CGAAGTCAAAGCCCTCGCCCC
    M-27CGAAGTCAAAGCCCTCGCCCC
    SMY-0107197CAAAGTCAAATCCCTCGCCCC
    NJB 0419CGAAGTCAAAGCCCTCGCCCC
    NJB 0420CGAAGTCAAAGCCCTCGCCCC

    DNA-DNA hybridization

    A commercial mycobacterial DDH kit (Kyokuto Pharmaceuticals, Tokyo, Japan) was used with Mycobacterium sp. strain YM-2 according to the manufacturer's instructions.

    Polymerase chain reaction restriction analysis of RNA polymerase β-subunit DNA (342 bp)

    Polymerase chain reaction restriction analysis of rpoB DNA was conducted according to the method of Kim et al. [5] with minor modifications. Briefly, HincII (isoschizomer of HindII) and BstNI (isoschizomer of MvaI) were used.

    Polymerase chain reaction analysis

    Polymerase chain reaction was conducted with 1 μL of extracted DNA using the AmpliTaq Gold 360 Master Mix (Life Technologies, Tokyo, Japan) and 0.4 μM of each of the published primers for detecting IS2404 [6], IS2606 [7], plasmid pMUM001 [8], and the insertion sequence RD9-associated IS2404 [9]. The PCR products were resolved on an agarose gel by electrophoresis, visualized with ethidium bromide staining, and photographed using STAGE-1000 (AMZ System Science, Osaka, Japan).

    Sequence analysis

    Almost complete 16S rRNA gene, 16S-23S rRNA gene ITS region, and partial 65 kDa heat-shock protein (hsp65) and rpoB gene sequences were amplified by PCR. The PCR was conducted with the published primers for amplifying the 16S rRNA gene [10], ITS region [11], hsp65 gene [12], and rpoB gene [13]. The PCR products were gel purified with a High Pure PCR Product Purification Kit (Roche Diagnostics, Tokyo, Japan), and directly sequenced. For sequencing the RD9-associated IS2404, additional internal primers were designed as follows: 5′-CGACCGCTGGAGTCCTGGTG-3′,5′-GGGCAGTTACTTCACTGCAC-3′, 5′-GAAGTCGCACTACCTGATGA-3′, 5′-CAGTGACCGCAAATCCACGAT-3′ and 5′-CAACCAGGTTGTCGCCGTTGA-3′. The sequencing reactions were conducted with a BigDye Terminator Cycle Sequencing Kit version 1.1 (Life Technologies), followed by their analysis on a 3130 Genetic Analyzer instrument (Applied Biosystems, Tokyo, Japan). The DNA sequences were aligned and edited with BioEdit software version 7.0.5.3. The DNA sequence data were compared with the reference sequences of M. ulcerans, M. shinshuense, M. marinum, and M. pseudoshottsii from the National Center for Biotechnology Information Entrez Nucleotide database. The 16S rRNA gene sequences were subjected to RIDOM search (http://www.ridom-rdna.de/) [14]. The obtained nucleotide sequences were deposited in the GenBank database (http://www.ncbi.nlm.nih.gov/GenBank) [15] under accession numbers AB636126 to AB636134 for the 16S rRNA gene, AB738000 to AB738007 for the ITS region, AB738008 to AB738015 for the hsp65 gene, AB738016 to AB738023 for the rpoB gene and AB738895 to AB738902 for RD9-associated IS2404.

    RESULTS

    1. Top of page
    2. Abstract
    3. MATERIALS AND METHODS
    4. RESULTS
    5. DISCUSSION
    6. ACKNOWLEDGMENTS
    7. DISCLOSURE
    8. REFERENCES

    DNA-DNA hybridization

    The commercially available mycobacterial DDH kit (Kyokuto Pharmaceuticals) we used can identify 18 mycobacterial species: M. bovis, M. kansasii, M. marinum, M. simiae, M. scrofulaceum, M. gordonae, M. szulgai, M. avium, M. intracellulare, M. gastri, M. xenopi, M. nonchromogenicum, M. terrae, M. triviale, M. fortuitum, M. chelonae, M. abscessus and M. peregrinum. According to the identification criteria of this kit, we identified Mycobacterium sp. strain YM-2 as M. marinum (Fig. 1).

    image

    Figure 1. (a) Identification of Mycobacterium sp. strain YM-2 at the species level using a commercial mycobacterial DDH kit. (b) Optical density at 630 nm of 19 wells in a colorimetric microdilution plate. The criteria for identification are as follows: the ratio of the maximum color intensity in the test well to that in the negative control well (value for Escherichia coli) should be > 1.9, and the relative relatedness of the well emitting the second-strongest color intensity should be < 70% of the maximum color intensity. OD630, optical density at 630 nm.

    Download figure to PowerPoint

    Polymerase chain reaction restriction analysis of RNA polymerase β-subunit DNA

    The digestion patterns of rpoB DNA when treated with four restriction enzymes are shown in Figure 2. HaeIII digestion can classify mycobacteria as rapidly or slowly growing types. The former type included M. smegmatis strain ATCC 19420, whereas the latter included Mycobacterium sp., M. ulcerans strain DN2798, and M. marinum strain ATCC 927. The AccII digestion pattern distinguished Mycobacterium sp. from M. marinum strain ATCC 927. On the other hand, all restriction enzyme digestion patterns were identical between Mycobacterium sp. and M. ulcerans strain DN2798. According to these results, the Mycobacterium sp. was M. ulcerans, not to M. marinum.

    image

    Figure 2. Restriction enzyme digestion patterns of rpoB DNA. The first lane in the upper and lower panels shows a 20 bp and 100 bp DNA ladder (Takara Bio, Shiga, Japan), respectively. Lane 1, M. smegmatis strain ATCC 19420; lane 2, M. marinum strain ATCC 927; lane 3, M. ulcerans strain DN2798; lane 4, Mycobacterium sp. strain YM-1; lane 5, Mycobacterium sp. strain YM-2; lane 6, Mycobacterium sp. strain YM-3; lane 7, Mycobacterium sp. strain M-14; lane 8, Mycobacterium sp. strain M-27; lane 9, Mycobacterium sp. strain SMY-0107197; lane 10, Mycobacterium sp. strain NJB 0419; lane 11, Mycobacterium sp. strain NJB 0420.

    Download figure to PowerPoint

    Detection of IS2404, IS2606, and pMUM001

    The Mycobacterium sp. was positive for IS2404 and IS2606, as shown in Figure 3. Of eight gene sequences in pMUM001, only the mup053 gene sequence was absent from Mycobacterium sp. M. ulcerans strain DN2798 did not serve as a positive control for the mup011 gene sequence, presumably because Japanese M. ulcerans strains lack this gene sequence, as reported by Nakanaga et al. [16]. M. marinum strain ATCC 927 was negative for IS2404, IS2606, and the whole pMUM001 plasmid.

    image

    Figure 3. PCR analysis of two insertion sequences (left panels) and the eight gene sequences of pMUM001 (right panels). The first lane shows a 100 bp DNA ladder. Lane 1, M. marinum strain ATCC 927; lane 2, M. ulcerans strain DN2798; lane 3, Mycobacterium sp. strain YM-1; lane 4, Mycobacterium sp. strain YM-2; lane 5, Mycobacterium sp. strain YM-3; lane 6, Mycobacterium sp. strain M-14; lane 7, Mycobacterium sp. strain M-27; lane 8, Mycobacterium sp. strain SMY-0107197; lane 9, Mycobacterium sp. strain NJB 0419; lane 10, Mycobacterium sp. strain NJB 0420.

    Download figure to PowerPoint

    Comparisons between the 16S ribosomal RNA gene, internal transcribed spacer region and hsp65 and RNA polymerase β-subunit gene sequences

    A RIDOM analysis showed that the16S rRNA gene of Mycobacterium sp. has over 99% similarity to those of M. marinum, M. ulcerans, and M. shinshuense. Sequence analysis of the 3′-end of the 16S rRNA gene has been used to discriminate rapidly between these three mycobacteria [17]. The 3′-end sequence of the 16S rRNA gene was identical between Mycobacterium sp. and M. marinum strain ATCC 927 (Table 2). However, seven of eight Mycobacterium sp. strains shared identical 16S rRNA and hsp65 gene sequences with M. pseudoshottsii strain JCM 154667 (Table 3). The other one, Mycobacterium sp. strain SMY-0107197, had only single nucleotide substitutions at nucleotide position 487 in the 16S rRNA gene sequence and nucleotide position 204 in the ITS region sequence, respectively. The hsp65 and rpoB gene sequences were conserved among Mycobacterium sp. strains; the former was also identical to that of M. pseudoshottsii strain JCM 154667.

    Genomic characterization in region of difference 9

    We amplified a PCR product of approximately 2000 bp from RD9 in Mycobacterium sp., this differs in size from those of M. marinum strains M and ATCC 927 (4a). Sequence analysis of the product revealed the insertion of IS2404, the sequence of which was 1366 bp long. In this region, we detected SNPs compared to the corresponding sequences of M. marinum strain DL240490 and M. pseudoshottsii strain L15 (4b). Of these, T174C, C195T, C222T, A300G, G318A, T688C, C692T, T774C, T819C, T1309C, and T1324C were unique to Mycobacterium sp.

    image

    Figure 4. (a) PCR analysis of the insertion of IS2404 in RD9. The first lane shows a 1k bp DNA ladder (Nacalai Tesque, Kyoto, Japan). Lane 1, M. marinum strain M; lane 2, M. marinum strain ATCC 927; lane 3, Mycobacterium sp. strain YM-1; lane 4, Mycobacterium sp. strain YM-2; lane 5, Mycobacterium sp. strain YM-3; lane 6, Mycobacterium sp. strain M-14; lane 7, Mycobacterium sp. strain M-27; lane 8, Mycobacterium sp. strain SMY-0107197; lane 9, Mycobacterium sp. strain NJB 0419; lane 10, Mycobacterium sp. strain NJB 0420. (b) Sequence variation in the RD9-associated IS2404. SNP positions are numbered with 1 corresponding to position 153575 in the plasmid pMUM001 of M. ulcerans strain Agy99 (GenBank accession number BX649209).

    Download figure to PowerPoint

    DISCUSSION

    1. Top of page
    2. Abstract
    3. MATERIALS AND METHODS
    4. RESULTS
    5. DISCUSSION
    6. ACKNOWLEDGMENTS
    7. DISCLOSURE
    8. REFERENCES

    A commercial mycobacterial DDH kit is widely used to identify mycobacterial species in Japan. This DDH assay identified the Mycobacterium sp. as M. marinum.

    Nevertheless, PRA of rpoB DNA showed definitively that this Mycobacterium sp. is M. ulcerans. Two distinct species, M. marinum and M. ulcerans, share over 4000 genes and have an average of 98.3% similarity in their DNA sequences [18]. The best explanation for this is that M. ulcerans evolved recently from an M. marinum ancestor [19]. This evolution occurred through the following two events: (i) major genomic remodeling involving insertion of over 300 copies of two insertion sequences, IS2404 and IS2606; and (ii) acquisition of the virulence plasmid pMUM001, which encodes the macrolide toxin mycolactone. Therefore, our PCR findings strongly support the contention that the Mycobacterium sp. is M. ulcerans, not M. marinum.

    According to PCR analysis of the pMUM001 plasmid, the Mycobacterium sp. lacks the mup053 gene sequence that is detectable in M. ulcerans. The same lack is reportedly present in M. marinum strains DL240490 and DL045 and M. pseudoshottsii [20]. M. marinum strains DL240490 and DL045 were isolated from the European sea bass, Dicentrarchus labrax, in the Red Sea, Israel [21], and the Mediterranean Sea, Greece [22], respectively. Importantly, M. marinum strain DL240490 causes clinical symptoms similar to those elicited by this Mycobacterium sp. [23]. Ucko et al. have described the 16S rRNA gene sequences of M. marinum strains DL240490 and DL045 [22] and deposited them in GenBank under accession numbers AF456238 and AF456241, respectively. At that time, the 16S rRNA gene sequence of M. marinum strain ATCC 927 was also determined and deposited in the GenBank under accession number AF456240. Strangely, this sequence has a gap corresponding to nucleotide position 1449 in the 16S rRNA gene sequence of Escherichia coli, at which position we identified a cytosine in our deposited sequence for M. marinum strain ATCC 927. Ucko et al. found the same gap in both sequences they deposited, as described above. The 16S rRNA gene sequence of M. marinum strain ATCC 927 recently deposited under accession number AB548717 matches our sequence data. Therefore, with one exception, the 16S rRNA gene sequence of Mycobacterium sp. is likely to correspond perfectly with those of M. marinum strains DL240490 and DL045. In addition, their 16S rRNA sequences also match that of M. pseudoshottsii, which was isolated from the striped bass, Morone saxatilis, in Chesapeake Bay, USA [24]. Comparisons of the 16S rRNA gene, ITS region, and hsp65 gene sequences, suggest that this Mycobacterium sp. is more closely related to M. pseudoshottsii than to M. ulcerans or M. marinum.

    Most reported infections by M. shinshuense have been in Japan [25]. The DDH method misidentified M. shinshuense as M. marinum. Currently, it is alternatively classified as M. ulcerans subsp. shinshuense [26]. Sequence analysis of the 3′-end of the 16S rRNA gene does not support any geographical association between this Mycobacterium sp. and M. shinshuense.

    Recently, Pidot et al. suggested classifying M. marinum strains DL240490 and DL045 and M. pseudoshottsii as M. ulcerans [27]. In fact, these strains have over 70% similar DDH values to M. ulcerans type strain ATCC 19423, based on the criteria for delineation of bacterial species in bacterial taxonomy [28]. Moreover, M. marinum strain DL240490 and M. pseudoshottsii cluster in the same unique group, which is characterized by the genomic event of insertion of IS2404 in RD9, whereas human mycobacteria cluster in different groups [9]. We detected RD9-associated IS2404 in this Mycobacterium sp. In this region, we identified novel SNPs that distinguish Mycobacterium sp. from M. marinum strain DL240490 and M. pseudoshottsii. Our findings raise the possibility that these organisms have a common ancestor. Further studies are required to improve our understanding of the relationship between their geographical origin and genetic diversity.

    ACKNOWLEDGMENTS

    1. Top of page
    2. Abstract
    3. MATERIALS AND METHODS
    4. RESULTS
    5. DISCUSSION
    6. ACKNOWLEDGMENTS
    7. DISCLOSURE
    8. REFERENCES

    This research was supported by a Grant-in-Aid for Scientific Research from the Japan Society for the Promotion of Science. We are most grateful to Michael Käser for communicating the RD9-associated IS2404 sequences of M. marinum strain DL240490 and M. pseudoshottsii strain L15. We thank Hiroya Fujioka for technical assistance.

    DISCLOSURE

    1. Top of page
    2. Abstract
    3. MATERIALS AND METHODS
    4. RESULTS
    5. DISCUSSION
    6. ACKNOWLEDGMENTS
    7. DISCLOSURE
    8. REFERENCES

    None of the authors has any conflicts of interest associated with this study.

    REFERENCES

    1. Top of page
    2. Abstract
    3. MATERIALS AND METHODS
    4. RESULTS
    5. DISCUSSION
    6. ACKNOWLEDGMENTS
    7. DISCLOSURE
    8. REFERENCES
    • 1
      Kusuda R., Kawakami K., Kawai K. (1987) A fish-pathogenic Mycobacterium sp. isolated from an epizootic of cultured yellowtail. Nippon Suisan Gakkaishi 53: 1797804.
    • 2
      Kusuda R., Inoue M., Sugiura H., Kawai K. (1993) Characteristics of a pathogenic Mycobacterium sp. isolated from cultured striped jack, Pseudocaranx dentex. Suisan Zousyoku 41: 12531.
    • 3
      Kato G., Kato K., Saito K., Pe Y., Kondo H., Aoki T., Hirono I. (2011) Vaccine efficacy of Mycobacterium bovis BCG against Mycobacterium sp. infection in amberjack Seriola dumerili. Fish Shellfish Immunol 30: 46772.
    • 4
      Weerakhun S., Aoki N., Kurata O., Hatai K., Nibe H., Hirae T. (2007) Mycobacterium marinum infection in cultured yellowtail Seriola quinqueradiata in Japan. Fish Pathol 42: 7984.
    • 5
      Kim B.J., Lee K.H., Park B.N., Kim S.J., Bai G.H., Kim S.J., Kook Y.H. (2001) Differentiation of mycobacterial species by PCR-restriction analysis of DNA (342 base pairs) of the RNA polymerase gene (rpoB). J Clin Microbiol 39: 21029.
    • 6
      Phillips R., Horsfield C., Kuijper S., Lartey A., Tetteh I., Etuaful S., Nyamekye B., Awuah P., Nyarko K.M., Osei-Sarpong F., Lucas S., Kolk A.H., Wansbrough-Jones M. (2005) Sensitivity of PCR targeting the IS2404 insertion sequence of Mycobacterium ulcerans in an assay using punch biopsy specimens for diagnosis of Buruli ulcer. J Clin Microbiol 43: 36506.
    • 7
      Stinear T., Ross B.C., Davies J.K., Marino L., Robins-Browne R.M., Oppedisano F., Sievers A., Johnson P.D. (1999) Identification and characterization of IS2404 and IS2606: two distinct repeated sequences for detection of Mycobacterium ulcerans by PCR. J Clin Microbiol 37: 101823.
    • 8
      Stinear T.P., Hong H., Frigui W., Pryor M.J., Brosch R., Garnier T., Leadlay P.F., Cole S.T. (2005) Common evolutionary origin for the unstable virulence plasmid pMUM found in geographically diverse strains of Mycobacterium ulcerans. J Bacteriol 187: 166876.
    • 9
      Käser M., Hauser J., Small P., Pluschke G. (2009) Large sequence polymorphisms unveil the phylogenetic relationship of environmental and pathogenic mycobacteria related to Mycobacterium ulcerans. Appl Environ Microbiol 75: 566775.
    • 10
      Springer B., Wu W.K., Bodmer T., Haase G., Pfyffer G.E., Kroppenstedt R.M., Schröder K.H., Emler S., Kilburn J.O., Kirschner P., Telenti A., Coyle M.B., Böttger E.C. (1996) Isolation and characterization of a unique group of slowly growing mycobacteria: description of Mycobacterium lentiflavum sp. nov. J Clin Microbiol 34: 11007.
    • 11
      Roth A., Fischer M., Hamid M.E., Michalke S., Ludwig W., Mauch H. (1998) Differentiation of phylogenetically related slowly growing mycobacteria based on 16S-23S rRNA gene internal transcribed spacer sequences. J Clin Microbiol 36: 13947.
    • 12
      Telenti A., Marchesi F., Balz M., Bally F., Böttger E.C., Bodmer T. (1993) Rapid identification of mycobacteria to the species level by polymerase chain reaction and restriction enzyme analysis. J Clin Microbiol 31: 1758.
    • 13
      Kim B.J., Lee S.H., Lyu M.A., Kim S.J., Bai G.H., Chae G.T., Kim E.C., Cha C.Y., Kook Y.H. (1999) Identification of mycobacterial species by comparative sequence analysis of the RNA polymerase gene (rpoB). J Clin Microbiol 37: 171420.
    • 14
      Harmsen D., Rothgänger J., Frosch M., Albert J. (2002) RIDOM: Ribosomal Differentiation of Medical Microorganisms Database. Nucleic Acids Res 30: 4167.
    • 15
      Benson D.A., Karsch-Mizrachi I., Lipman D.J., Ostell J., Wheeler D.L. (2008) GenBank. Nucleic Acids Res 36: D2530.
    • 16
      Nakanaga K., Hoshino Y., Yotsu R.R., Makino M., Ishii N. (2011) Nineteen cases of Buruli ulcer diagnosed in Japan from 1980 to 2010. J Clin Microbiol 49: 382936.
    • 17
      Portaels F., Fonteyene P.A., de Beenhouwer H., de Rijk P., Guédénon A., Hayman J., Meyers M.W. (1996) Variability in 3′ end of 16S rRNA sequence of Mycobacterium ulcerans is related to geographic origin of isolates. J Clin Microbiol 34: 9625.
    • 18
      Stinear T.P., Seemann T., Pidot S., Frigui W., Reysset G., Garnier T., Meurice G., Simon D., Bouchier C., Ma L., Tichit M., Porter J.L., Ryan J., Johnson P.D., Davies J.K., Jenkin G.A., Small P.L., Jones L.M., Tekaia F., Laval F., Daffé M., Parkhill J., Cole S.T. (2007) Reductive evolution and niche adaptation inferred from the genome of Mycobacterium ulcerans, the causative agent of Buruli ulcer. Genome Res 17: 192200.
    • 19
      Stinear T.P., Jenkin G.A., Johnson P.D., Davies J.K. (2000) Comparative genetic analysis of Mycobacterium ulcerans and Mycobacterium marinum reveals evidence of recent divergence. J Bacteriol 182: 632230.
    • 20
      Ranger B.S., Mahrous E.A., Mosi L., Adusumilli S., Lee R.E., Colorni A., Rhodes M., Small P.L. (2006) Globally distributed mycobacterial fish pathogens produce a novel plasmidencoded toxic macrolide, mycolactone F. Infect Immun 74: 603745.
    • 21
      Knibb W., Colorni A., Ankaoua M., Lindell D., Diamant A., Gordin H. (1993) Detection and identification of a pathogenic marine Mycobacterium from the European seabass Dicentrarchus labrax using polymerase chain reaction and direct sequencing of 16S rDNA sequences. Mol Mar Biol Biotechnol 2: 22532.
    • 22
      Ucko M., Colorni A., Kvitt H., Diamant A., Zlotkin A., Knibb W.R. (2002) Strain variation in Mycobacterium marinum fish isolates. Appl Environ Microbiol 68: 52817.
    • 23
      Colorni A. (1992) A systemic mycobacteriosis in the European sea bass Dicentrarchus labrax cultured in Eilat (Red Sea). Isr J Aquacult Bamidgeh 44: 7581.
    • 24
      Rhodes M.W., Kator H., McNabb A., Deshayes C., Reyrat J.M., Brown-Elliott B.A., Wallace R. Jr., Trott K.A., Parker J.M., Lifland B., Osterhout G., Kaattari I., Reece K., Vogelbein W., Ottinger C.A. (2005) Mycobacterium pseudoshottsii sp. nov., a slowly growing chromogenic species isolated from Chesapeake Bay striped bass (Morone saxatilis). Int J Syst Evol Microbiol 55: 113947.
    • 25
      Kondo M., Kurokawa I., Ito Y., Yamanaka K., Yamazaki T., Mizutani H. (2009) Leg ulcer caused by Mycobacterium uclerans ssp. shinshuense infection. Int J Dermatol 48: 13303.
    • 26
      Nakanaga K., Ishii N., Suzuki K., Tanigawa K., Goto M., Okabe T., Imada H., Kodama A., Iwamoto T., Takahashi H., Saito H. (2007) Mycobacterium ulcerans subsp. shinshuense” isolated from a skin ulcer lesion: identification based on 16S rRNA gene sequencing. J Clin Microbiol 45: 38403.
    • 27
      Pidot S.J., Asiedu K., Käser M., Fyfe J.A., Stinear T.P. (2010) Mycobacterium ulcerans and other mycolactone-producing mycobacteria should be considered a single species. PloS Negl Trop Dis 4: e663.
    • 28
      Yip M.J., Porter J.L., Fyfe J.A., Lavender C.J., Portaels F., Rhodes M., Kator H., Colorni A., Jenkin G.A., Stinear T. (2007) Evolution of Mycobacterium ulcerans and other mycolactone-producing mycobacteria from a common Mycobacterium marinum progenitor. J Bacteriol 189: 20219.