SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. Disclosure Statement
  8. References

Aberrant microRNA (miRNA) expression is presently proposed to correlate with various human cancers and common single-nucleotide polymorphisms (SNP) at miRNA genes can influence the maturation of miRNAs or miRNA-mediated transcriptional regulation. However, whether miRNAs SNP alter gastric cancer susceptibility is still unclear. Here we investigated the possible role of a common A/G polymorphism (rs895819) within hsa-mir-27a in the development or progression of gastric cancer, and assessed the effect of rs895819 on the expression of miR-27a and its target gene Zinc finger and BTB domain containing 10 (ZBTB10). In the present case-control study, we found that subjects with the variant genotypes (AG + GG) showed a significantly increased risk of gastric cancer relative to AA carriers (adjusted odds ratio = 1.48, 95% confidence interval 1.06–2.05; = 0.019). The elevated risk was especially evident in older subjects (age >58 years), men, nonsmokers and rural subjects. A significant association of hsa-mir-27a variant genotypes with lymph node metastasis was also observed. Further functional analyses indicated that variant genotypes might be responsible for elevated miR-27a levels and reduced ZBTB10 mRNA. Moreover, an inverse correlation was found between ZBTB10 and miR-27a levels. In conclusion, we were the first to show that a common polymorphism (rs895819) in hsa-mir-27a, by modulating miR-27a and ZBTB10 levels, acted as an important factor of the gastric cancer susceptibility. (Cancer Sci 2010)

Gastric cancer is one of the commonest malignant tumors in the world.(1) Of all the treatment modalities, only surgical resection may offer an opportunity for long-term survival. However, in most cases, curative resection of the tumor is impossible because of the advanced stage at the time of diagnosis.(2) In this regard, early detection of gastric cancer currently is the most important measure to decrease disease-associated mortality. Therefore, it appears very important to find novel diagnosis biomarkers to improve patient prognosis.

MicroRNAs (miRNAs), a class of small endogenous noncoding RNA, negatively regulate post-transcriptional gene expression by directly cleaving target mRNA or by inhibiting their translation.(3) Although the underlying biological functions are not completely clear, it has been shown to play important roles in a variety of cellular processes including apoptosis, differentiation and cell proliferation.(4–6) Recent studies have identified that aberrant miRNAs expression correlated with various human cancers such as colon tumors, breast cancer, lung cancer, pancreatic cancer and gastric cancer.(7)

There is increasing evidence that single nucleotide polymorphisms (SNP) or mutations could make a significant contribution to disease susceptibility and outcome. The high degree of phylogenetic conservation in miRNA sequences determines that the functional variation in miRNAs may influence various biological processes. Therefore, a mutation or a SNP in miRNA genes might influence the transcription of primary miRNAs (pri-miRNAs), maturation of miRNAs, or miRNA-mediated transcriptional regulation.(8) Recently, one study has systematically identified 323 SNP in 227 known human miRNAs, and 12 SNP are located within the miRNA precursors.(9) One A/G polymorphism (rs895819) was found in hsa-mir-27a, and it was located at position 40 relative to the first nucleotide. MicroRNA-27a (MiR-27a) is found on chromosome 19, and has been shown to function as oncogenes in gastric adenocarcinoma by targeting prohibitin.(10) The latest studies also revealed that oncogenic miR-27a is a target for anticancer drugs.(11,12) Moreover, Mertens-Talcott et al.(13) reported that transfection of antisense miR-27a led to increased Zinc finger and BTB domain containing 10 (ZBTB10) levels in MDA-MB-231 cells. Similarly, Scott et al. revealed that miR-27a suppressed the expression of ZBTB10 mRNA, which could potentially inhibit gastrin gene expression by interfering with Sp1 activation.(14,15) Transcription factor Sp1 expression and activation could contribute to gastric cancer cell survival, growth, and angiogenesis.(16) Given the importance of ZBTB10 in the expression of Sp1, we hypothesized that miR-27a might play a role in gastric cancer development and progression by modifying the levels of ZBTB10 mRNA.

To expand our knowledge regarding the new polymorphism and biological function of miR-27a, the current study was designed to determine whether the polymorphism was associated with a risk of gastric cancer. We also investigated miR-27a and its target gene ZBTB10 expression in consideration of the genotype. As expected, our study is the first to show that a common polymorphism in hsa-mir-27a, by modulating miR-27a and its target gene ZBTB10 levels, acted as an important factor in gastric cancer susceptibility.

Materials and Methods

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. Disclosure Statement
  8. References

Subjects.  This hospital-based case-control study comprised 304 gastric cancer cases and 304 cancer-free controls. Cases were inpatients newly diagnosed with histologically confirmed gastric cancer, consecutively recruited at the Affiliated Hospital of Nanjing Medical University. Those with secondary or recurrent malignancies were excluded. The controls were selected from patients hospitalized because of a variety of nonmalignant diseases. Those controls with a previous history of cancer or severe clinical symptoms were excluded. All subjects were interviewed to obtain information on age, gender, smoking status, residence (urban or rural), past medical history and medical treatment by questionnaires. Individuals who formerly or currently smoked ≥10 cigarettes per day on average were defined as smokers. In addition, the following parameters were obtained from the pathological reports of the gastric cancer patients studied: tumor, node, metastasis (TNM) staging, differentiation grade (World Health Organization classification) and tumor location.

For miR-27a and ZBTB10 expression, 65 tumor tissue samples with histological evidence of primary gastric carcinoma were obtained from Tissue Bank of Affiliated Hospital of Nanjing Medical University. All tissues were snap-frozen in liquid nitrogen after surgical resection and stored at −80°C until RNA extraction. Detailed clinical features for each tissue donor, including age, sex, smoking status, clinical staging, residence, tumor location and survival times were collected. All subjects were genetically unrelated ethnic Han Chinese. The study was approved by the Nanjing Medical University Affiliated Hospital Ethics Committee and informed consent was obtained from all participants.

Genotyping.  Genomic DNA was isolated from the buffy coat of blood or tissue samples according to standard phenol/chloroform extraction procedures, as described previously.(17) The SNP (rs895819) was analyzed by polymerase chain reaction (PCR)-restriction fragment length polymorphism. The 182-bp DNA fragment containing the polymorphic site was amplified using two primers (forward 5′-GAACTTAGCCACTGTGAACACCACTTGG-3′, and reverse 5′-TTGCTTCCTGTCACAAATCACATTG-3′). The forward primer was modified at position 47 (underlined), thus creating a recognition site for the restriction endonuclease Dra III (CACNNN/GTG) in the presence of the T allele at position 40. The PCR reaction was performed in a total volume of 20 μL containing 2 μL 10× PCR buffer (MBI Fermentas, Vilnius, Lithuania), 1.625 mM MgCl2, 0.15 mM dNTPs, 0.25 μM each primer, 200 ng of genomic DNA and 1.1 U of Taq DNA polymerase (MBI Fermentas). The reaction mixtures were denatured at 95°C for 5 min, followed by 32 cycles of 95°C for 25 s, 60°C for 30 s and 72°C for 30 s, with a final elongation at 72°C for 6 min. Six μL of the PCR product was digested with 10 U of Dra III (New England BioLabs, Waltham, MA, USA) at 37°C overnight. The genotypes were assessed as follows: a single 182 bp fragment for the CC (GG) genotype; two fragments of 155 and 27 bp for the TT (AA) genotype; and three fragments of 182, 155 and 27 bp for the TC (AG) genotype. The resultant fragments were electrophoresed on a 3% agarose gel containing ethidium bromide, and bands were then visualized by ultraviolet transillumination (Fig. 1A). In addition, 10% of the samples were randomly selected for repeat assays, and the results were 100% concordant. Genotyping was performed without knowledge of the subjects’ case and control status. The PCR products of the SNP with different genotypes were selected and verified by direct sequencing using ABI 3730 DNA analyzer (Applied Biosystems, Foster City, CA, USA) (Fig. 1).

Figure 1.  PCR-RFLP analysis and automated sequencing of single-nucleotide polymorphism (SNP) rs895819 in hsa-mir-27a. (A) Representative gel electropherogram showing three genotypes of SNP rs895819. The PCR products were digested with restriction enzyme Dra III and analyzed on a 3% agarose gel. M, DNA marker; lane 1, TC (AG) heterozygous; lane 2, TT (AA) homozygous; lanes 3 and 4, CC (GG) homozygous. (B–D) DNA sequencing chromatograms of the PCR products confirmed rs895819 polymorphism. Double peaks labeled with Y and an arrow represented the heterozygous genotype TC (AG).

Download figure to PowerPoint

image

Quantitative RT-PCR.  Total RNA from the frozen tissue sample was extracted using Trizol RNA isolation reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. TaqMan microRNA assays (Applied Biosystems Inc.) were used to quantify miR-27a expression. Small nuclear RNA, U6B (Applied Biosystems Inc.), was considered as the normalization control. In brief, cDNA was synthesized from total RNA using gene-specific stem-loop RT primers. Reverse transcriptase reactions contained 60 ng of total RNA, 50 nmol/L stem-loop RT primer, 0.25 mM each of dNTP, 1× RT buffer, 5.33 U/μL MultiScribe reverse transcriptase and 0.38 U/μL RNase inhibitor. The RT reaction mixtures were incubated at 16°C for 30 min, 42°C for 30 min and 85°C for 5 min and then held at −20°C. The real-time PCR reaction was performed in a total volume of 10 μL containing 0.67 μL of RT product, 0.5 μL × 20 TaqMan microRNA assay mix, 5 μL TaqMan ×2 universal PCR Master Mix. The PCR parameters were as follows: one cycle of 95°C for 10 min, then 40 cycles of 95°C for 15 s and 60°C for 1 min.

ZBTB10 and TATA binding protein (TBP) (control) mRNA levels were examined by SYBR Green quantitative PCR.(13) Reactions were performed according to the manufacturer’s instructions using Power SYBR Green PCR Master Mix (Applied Biosystems Inc.). Forward (F) and reverse (R) primers were used as follows: ZBTB10, GCTGGATAGTAGTTATGTTGC and CTGAGTGGTTTGATGGACAGA; TBP, TGCACAGGAGCCAAGAGTGAA and CACATCACAGCTCCCCACCA. All real-time reactions were conducted with the ABI Prism 7300 sequence detection system (Applied Biosystems Inc.). Relative expression was calculated using the cycle threshold (Ct) values supplied by the manufacturer.(18)

Statistics.  Quantitative variables departing from the normal distribution including age were summarized as the median and analyzed by Mann–Whitney rank sum test. Distribution of categorical variables and genotype frequencies between gastric cancer cases and controls were compared by the Pearson χ2 test. Hardy–Weinberg equilibrium was assessed for controls by a goodness-of-fit χ2 test. The association between the SNP (rs895819) and risk of gastric cancer was estimated by odds ratios (OR) and 95% confidence intervals (CI). Carriers of the genotype AA comprised the reference group. The crude OR was assessed by the Woolf approximation method. The adjusted OR was computed by the unconditional logistic regression method, with adjustment for age, sex, smoking status, hypertension, diabetes and residence. Effects of the genetic variation on miR-27a and ZBTB10 expression were examined using anova. Correlation between the expression levels of ZBTB10 mRNA and miR-27a was analyzed using the Pearson correlation coefficient. All the analyses were carried out with the SPSS 13.0 (SPSS Inc., Chicago, IL, USA) and were based on two-tailed probability. A P value of <0.05 was considered statistically significant.

Results

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. Disclosure Statement
  8. References

Baseline characteristics.  Demographic characteristics of the study participants are summarized in Table 1. The sex and age distributions were fairly identical among the case and control subjects, indicating that the matching of controls to cases was adequate. There were no statistically significant differences between the cases and control subjects in terms of smoking status, residence, history of hypertension and diabetes. Most of the cases were adenocarcinoma (98.03%). Patients with cancer of the gastric cardia and non-cardia were 85 and 219, respectively. Among those 297 gastric cancers with available clinicopathological data, 52, 36, 142 and 67 were T1, T2, T3 and T4, respectively; 41, 139 and 117 were reported with well, moderate and poor differentiation, respectively. Positive lymph nodes were identified in 190 cases.

Table 1.   Demographic information
CharacteristicsCases n (%) (= 304)Controls n (%) (= 304)P
  1. †Median (25th–75th percentiles).

Gender (male), n (%)228 (75.00)228 (75.00)1.000
Age† (years)59 (51–66.5)58 (50–66)0.861
Weight† (kg)62.5 (55–70)65 (58–72)0.012
Hypertension, n (%)54 (17.76)59 (19.41)0.602
Diabetes, n (%)17 (5.59)28 (9.21)0.088
Smoking, n (%)73 (24.01)58 (19.08)0.139
Residence, n (%)
 Rural146 (48.03)139 (45.72)0.569
 Urban158 (51.97)165 (54.28) 

SNP rs895819 and risk of gastric cancer.  As presented in Table 2, the frequency of G alleles in the cases was 39.97%, which was higher than in the controls (32.73%) (χ2 = 6.88; = 0.009). The difference in rs895819 genotype distributions between the cases and controls was statistically significant (χ2 = 6.55; = 0.038). The genotype distributions of the SNP among the controls (χ2 = 3.75; = 0.053) and the cases (χ2 = 1.69; = 0.194) were in Hardy–Weinberg equilibrium. When the genotype AA was used as the reference group, the adjusted OR of the GG genotype associated with the risk of gastric cancer was 1.69 (95% CI 1.04–2.75), after adjustment for age, sex, smoking status, hypertension, diabetes and residence. Subjects carrying the AG genotype were at a 41% elevated risk for the gastric cancer (95% CI 0.99–2.00). Moreover, subjects with the variant genotypes (AG + GG) showed an overall increased risk of gastric cancer relative to AA carriers (adjusted OR = 1.48, 95% CI 1.06–2.05).

Table 2.   Distributions of the rs895819 genotype in cases and controls, and risk rs895819 genotypes estimates for the variant
Hsa-mir-27a GenotypeCases n (%)Controls†n (%)Crude OR (95% CI)PAdjusted OR‡ (95% CI)P
  1. †Distributions of the rs895819 genotypes was in Hardy–Weinberg equilibrium, χ2 = 3.749, = 0.053. ‡Adjusted for age, sex, smoking status, hypertension, residence and diabetes. CI, confidence interval; OR, odds ratio.

Overall304304    
AA115 (37.83)145 (47.70)1.00 1.00 
AG135 (44.41)119 (39.14)1.43 (1.01–2.02)0.0431.41 (0.99–2.00)0.056
GG54 (17.76)40 (13.16)1.70 (1.06–2.74)0.0281.69 (1.04–2.75)0.033
AG + GG189 (62.17)159 (52.30)1.50 (1.08–2.07)0.0141.48 (1.06–2.05)0.019
rs895819 A allele365 (60.03)409 (67.27)    
rs895819 G allele243 (39.97)199 (32.73)    

Stratified analysis. Table 3 shows the results of stratified analyses by the median age of controls (58 years), sex, smoking status and residence with the SNP (rs895819). A statistically significant association between increased gastric cancer risk and rs895819 variant genotypes was observed in older (age >58 years) subjects (adjusted OR = 1.74, 95% CI 1.09–2.79), but not in younger (age ≤58 years) subjects. In men, possession of the variant genotypes was associated with a 53% increased risk of gastric cancer (adjusted OR = 1.53, 95% CI 1.05–2.22), while the association was not statistically significant in women. The elevated risk associated with the variant genotypes tended to be more evident in non-smokers (adjusted OR = 1.45, 95% CI 1.01–2.10) than in smokers. In statistical analyses stratified by residence, only a significant association was observed in rural subjects (adjusted OR = 1.80, 95% CI 1.10–2.94).

Table 3.   Stratified analyses for variant rs895819 genotypes in cases and controls
Variable(AG + GG)/AACrude OR (95% CI)PAdjusted OR† (95% CI)P
CasesControls
  1. †Adjusted for age, sex, smoking status, hypertension, residence and diabetes. CI, confidence interval; OR, odds ratio.

Age (median)
 ≤5884/6381/751.23 (0.78–1.94)0.3621.19 (0.75–1.89)0.469
 >58105/5278/701.81 (1.14–2.88)0.0121.74 (1.09–2.79)0.021
Gender
 Female50/2645/311.32 (0.69–2.56)0.4021.33 (0.69–2.59)0.396
 Male139/89114/1141.56 (1.08–2.27)0.0191.53 (1.05–2.22)0.027
Smoking status
 Smokers49/2432/261.66 (0.81–3.38)0.1621.55 (0.74–3.24)0.247
 Non-smokers140/91127/1191.44 (1.00–2.07)0.0481.45 (1.01–2.10)0.045
Residence
 Urban91/6789/761.16 (0.75–1.80)0.5091.19 (0.76–1.86)0.440
 Rural98/4870/692.01 (1.25–3.25)0.0041.80 (1.10–2.94)0.020

Additionally, the effect of the SNP (rs895819) was evaluated with stratification by clinicopathological characters of the gastric cancer patients (Table 4). It is observed that the SNP was significantly associated with lymph node metastasis (adjusted OR = 1.67, 95% CI 1.02–2.74). However, we found no significant association of the SNP and the location of the primary cancer, depth of tumor infiltration or grade of differentiation, respectively.

Table 4.   Associations between variant rs895819 genotypes and clinicopathological characteristics of gastric cancer†
Variable(AG + GG)/AACrude OR (95% CI)PAdjusted OR‡ (95% CI)P
  1. †Data for seven plaintively treated cases was not obtained for the inoperable tumors. ‡Adjusted for age, sex, smoking status, hypertension, residence and diabetes. CI, confidence interval; OR, odds ratio.

Tumor differentiation
 Well25161 1 
 Moderate86531.04 (0.51–2.12)0.9181.29 (0.60–2.78)0.513
 Poor73441.06 (0.51–2.20)0.8721.37 (0.61–3.07)0.449
Depth of tumor infiltration
 T133191 1 
 T219170.64 (0.27–1.53)0.3160.71 (0.27–1.86)0.486
 T392501.06 (0.55–2.05)0.8641.02 (0.51–2.01)0.965
 T440270.85 (0.40–1.80)0.6760.89 (0.41–1.96)0.778
Lymph node metastasis
 Negative58491 1 
 Positive126641.66 (1.02–2.70)0.0391.67 (1.02–2.74)0.042
Localization
 Cardia50351 1 
 Non-cardia139801.22 (0.73–2.03)0.4531.33 (0.78–2.29)0.297

Effect of SNP rs895819 on miR-27a expression.  To determine whether the identified polymorphism of hsa-mir-27a SNP rs895819 could affect miR-27a expression, we screened 65 tumor tissues obtained from gastric cancer patients. Among the 65 patients, 25 were of the rs895819 AA genotype, 30 of the AG genotype and 10 of the GG genotype. There was a significant influence of genotype on miRNA expression. As shown in Figure 2A, expression of miR-27a in the AG + GG cases compared with the AA cases was significantly different, relative Ct ratios were 73.74% ± 4.34% versus 78.98% ± 7.31% (< 0.001) (a lower Ct ratio represents a higher expression). The results showed that a common A/G polymorphism (rs895819) within the hsa-mir-27a sequence increased the amount of miR-27a from the variant genotypes compared with the A allele.

Figure 2.  Relationship between rs895819 genotypes and expression of miR-27a or Zinc finger and BTB domain containing 10 (ZBTB10). (A) Expression of miRNA-27a was determined by TaqMan MicroRNA Assays (Applied Biosystems Inc.). Normalization was performed with RNU6B. The box plot revealed the distribution of the miR-27a levels within each genotype class in 65 gastric cancer cases. (B) The relative expression of ZBTB10 mRNA normalization was performed with TATA binding protein (TBP) and determined by SYBR Green real-time PCR. The box plot revealed the distribution of the ZBTB10 mRNA levels within each genotype class in 65 gastric cancer cases. anova with Dunnett post-test, compared with the AA group. (C) Correlation between mRNA ZBTB10 and expression of miR-27a in 65 gastric cancer cases (= −0.379; = 0.002).

Download figure to PowerPoint

image

Impact of SNP rs895819 on miR-27a target gene ZBTB10.  In order to investigate the functional consequences of impaired processing of miR-27a on its target genes, we measured ZBTB10 mRNA levels in 65 gastric tumor tissues. Expression of ZBTB10 in the AG + GG genotypes had significantly lower levels than the AA genotype. Subjects with the AG + GG genotypes displayed higher Ct ratios compared with the AA carriers (107.56% ± 7.05% versus 101.68% ± 7.16%; = 0.003). These data suggested that A/G polymorphism in hsa-mir-27a affected the expression of ZBTB10 mRNA (Fig. 2B).

Correlation of miR-27a with ZBTB10 in gastric carcinoma patients.  To further examine the correlation between miR-27a and ZBTB10 mRNA, we performed a Pearson correlation analysis. The result is shown in Fig. 2C, and as expected, we found that ZBTB10 mRNA expression inversely correlated with expression of miR-27a (r = −0.379; = 0.002). It suggests that ZBTB10 was a direct and functional target of miR-27a.

Discussion

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. Disclosure Statement
  8. References

In the present study, we found that the common A/G polymorphism within hsa-mir-27a (rs895819) was associated with a significantly increased risk of gastric cancer. Preliminary functional assays revealed the miR-polymorphism conferred a higher level of miR-27a, which accompanied significantly reduced ZBTB10 mRNA. Therefore, we might have identified a genetic mechanism and a molecular phenotype underlying the involvement of miR-27a in the susceptibility for gastric cancer.

Nowadays, a genome-wide association study is encouraging and widely conducted to help develop more accurate diagnostic and therapeutic strategies of various kinds of human tumors.(19) Our previous epidemiological observations also provided the evidence that the risk of gastric cancer was associated with genetic polymorphisms.(20–22) Recently, a class of novel functional polymorphisms in miRNAs and its binding sites are the most interesting and powerful. MiRNAs, a class of novel posttranscriptional regulators, represent only a small part of the genome, but they regulate almost one-third of human genes.(23) Several studies have shown that miRNA polymorphisms or aberrant expression is associated with various human cancers.(24,25) In gastric carcinoma, miR-15b and miR-16 have been shown to play crucial roles in the development of multidrug resistance in gastric cancer cells.(26) In our case-control study, we found that the variant genotypes of rs895819 located at hsa-mir-27a conferred a 48% increased risk of developing gastric cancer in the Chinese population. Hu et al. also indicated that SNP (rs11614913) in hsa-mir-196a2 and variant genotypes (rs3746444) in hsa-mir-499 were associated with significantly increased risks of breast cancer in Chinese women. Moreover, they suggested that a variant homozygote of rs11614913 in hsa-mir-196a2 had poor survival in patients with non-small cell lung cancer.(18,27) Therefore, it has been indicated that polymorphism within miRNA precursors might be used as candidate biomarkers for cancer susceptibility.

In addition, our stratified analyses revealed that the functional polymorphism was associated with the increased risk of gastric cancer among subgroups of older subjects (age >58 years), but not among younger subjects. Carcinogenesis is considered as accumulation of genetic events during aging, and gastric cancer has a steep slope for the age-specific increase in incidence.(28) The increased risk that was observed in older subjects implies that the gene–environment interaction might be involved in carcinogenesis and the hsa-mir-27a genotype effects tended to be age specific. We also found that an elevated risk was evident in rural subjects. Interestingly, we unexpectedly found that male subjects with the variant genotypes were associated with a 53% increased risk of gastric cancer. Previously, we also noted the gender-specific associations between the polymorphism and phenotypes.(20) Arisawa et al.(29) also found that the miR-27a polymorphism was associated with the gastric mucosal atrophy only in male subjects. Further studies are needed to clarify the underlying mechanism. More importantly, a significant association of hsa-mir-27a variant genotypes with lymph node metastasis was observed. A recent study also found a correlation between miR-27a and lymph node metastasis in undifferentiated gastric cancer.(30) It suggested that miR-27a, as one of the potential oncomirs, might contribute to tumor invasion and metastasis.

Recent studies have demonstrated that mutation or SNP in miRNAs could influence miRNAs expression and function.(31,32) Zeng et al.(33) have shown that the integrity and secondary structure of pre-miRNAs was crucial to the processing and maturation of miRNAs. One particular SNP located at the seed region of mature miR-125a could significantly affect pre-miRNA maturation and reduce miRNA-mediated posttranscriptional suppression.(9) Consistently, Jazdzewski et al.(24) indicated that a common polymorphism in pre-miR-146a could contribute to genetic predisposition to papillary thyroid carcinoma through affecting the expression of miR-146. This increasing evidence encouraged us to investigate the possible role of this SNP rs895819 in regulating expression of miR-27a and its target genes. On the basis of the model of Zeng and Cullen, mutations that took place in the stem of pre-miRNAs had a marked effect on miRNAs processing.(33) Although the polymorphism within miR-27a was observed in the terminal loop, our results also revealed that there was a significant influence on miR-27a expression based on genotypes. One possible reason is that a mutant with terminal loop may slightly impair processing of pri-miRNA and DGCR8 binding based on the ssRNA-dsRNA Junction Anchoring Model.(34)

We are the first to find that functional polymorphism might be responsible for elevated miR-27a expression levels, which were associated with significantly reduced ZBTB10 mRNA. Thus, we investigated whether ZBTB10 mRNA was negatively regulated by miR-27a in gastric cancer. As shown in Fig. 2C, ZBTB10 levels inversely correlated with miR-27a levels in patients with gastric cancer. This suggests ZBTB10 as a predominant target of miR-27a. ZBTB10, a novel zinc finger protein, could regulate gastrin gene expression by interfering with Sp1 transactivation.(15) There is growing evidence that Sp1–Sp4 proteins play a critical role in the growth and metastasis of many tumors by regulating expression of multiple genes such as VEGF, VEGFR1, VEGFR2 and survivin.(35,36) In particular, Sp1 protein is widely overexpressed in various human tumors including breast carcinoma, colorectal cancer and gastric carcinoma.(37) Moreover, strong Sp1 expression was more frequently observed at an advanced disease stage among gastric carcinoma patients.(38) Therefore, combined with previous observations, it is biologically plausible that miR-27a, through regulating ZBTB10, results in overexpression of Sp proteins and Sp-dependent genes, which play important roles in gastric cancer cell survival and angiogenesis.(13,38)

Potential limitations of the current study should be considered. First, the design was a hospital-based case-control study, and the controls were recruited from patients with non-malignant diseases. This could lead to the possibility of selection bias. Nonetheless, the genotype distribution of the controls was in Hardy–Weinberg equilibrium. Second, in the present study, only mature miR-27a expression was examined; whether the miR-27a SNP might also influence the processing of pri-miRNA and/or pre-miRNA still needs to be verified. Third, the sample size of the present study was relatively small, particularly for stratified analyses, for evaluating the relationship between the amount of miR-27a and tumor invasion or metastasis. Finally, Helicobacter pylori infection is one of the independent risk factors of gastric cancer. We did not have enough information on Helicobacter pylori status, because it was unethical to do Helicobacter pylori tests in every subject, especially in the controls. Therefore, further studies with a larger sample size are warranted. However, our observations provided valuable insights and interesting information and might serve to guide future studies in this area.

In conclusion, we are the first to provide evidence that genetic variants in hsa-mir-27a conferred not only an increased risk of gastric cancer but also with metastasis of gastric cancer in the Chinese population, possibly by increasing the levels of miR-27a, which is accompanied by reduced ZBTB10 mRNA. We expect our findings will provide novel insights into the molecular mechanisms of tumorigenesis and could eventually contribute to the development of early diagnosis for gastric cancer.

Acknowledgments

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. Disclosure Statement
  8. References

This work was supported by the following grants: National Natural Science Foundation of China (No. 30873099); Natural Science Foundation of Jiangsu Province (No. BK2006525); Natural Science Foundation of Jiangsu Provincial Education Office (No. 08KJB320004, KY101J28019); “333 Project”, “Qinglan Project” and “Six RenCai GaoFeng Project” Funding for the Young Academic Leader of Jiangsu Province.

References

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. Disclosure Statement
  8. References