SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. Disclosure Statement
  8. References
  9. Supporting Information

The hedgehog (Hh) signaling pathway is activated in various types of cancer including pancreatic ductal adenocarcinoma. It has been shown that extremely low oxygen tension (below 1% O2) is found in tumor tissue including pancreatic ductal adenocarcinoma cells (PDAC) and increases the invasiveness of PDAC. To investigate the contribution of the Hh pathway to hypoxia-induced invasiveness, we examined how hypoxia affects Hh pathway activation and the invasiveness of PDAC. In the present study, three human PDAC lines were cultured under normoxic (20% O2) or hypoxic (1% O2) conditions. Hypoxia upregulated the transcription of Sonic hedgehog (Shh), Smoothened (Smo), Gli1 and matrix metalloproteinase9 (MMP9) and increased the invasiveness of PDAC. Significantly, neither the addition of recombinant Shh (rhShh) nor the silencing of Shh affected the transcription of these genes and the invasiveness of PDAC. On the other hand, silencing of Smo decreased the transcription of Gli1 and MMP9 and PDAC invasiveness. Silencing of Gli1 or MMP9 decreased PDAC invasiveness. These results suggest that hypoxia activates the Hh pathway of PDAC by increasing the transcription of Smo in a ligand-independent manner and increases PDAC invasiveness. (Cancer Sci 2011; 102: 1144–1150)

Pancreatic cancer is an aggressive malignancy with an overall 5-year survival rate of <5% when all stages are combined.(1,2) One reason for its lethality is its highly invasive and metastatic character. Another reason is that chemotherapy and radiation therapy are largely ineffective. The exact molecular mechanisms responsible for this dismal clinical course remain largely unknown. A better understanding of the mechanisms that underlie the development of pancreatic cancer could help to identify novel molecular targets for treatment.

Tumor hypoxia is found in regions that are distant from the supporting tumor vasculature.(3) Understanding this hypoxic microenvironment is important for treating pancreatic cancer. The critical O2 partial pressure in tumors, below which the detrimental changes associated with reduced O2 consumption have been observed, is 8–10 mmHg.(4) Hypoxia has been shown to be associated with resistance to chemotherapy and radiation therapy, and hence with a poor prognosis.(5) Invasion is the most common cause of morbidity and mortality induced by cancer. Recent studies have reported that hypoxia induces invasiveness, and that the hypoxia-induced invasiveness is related to hypoxia inducible factor 1α (HIF-1α), Notch signaling, hepatocyte growth factor/c-Met pathway, insulin receptor substrate-2 and transcription factor Sp1.(6–13) We have previously shown that the hedgehog (Hh) signaling pathway contributes to the invasiveness of pancreatic cancer in normoxic conditions.(14) However, the relationship between Hh signaling and hypoxia-associated invasiveness is unknown.

The Hh signaling pathway is crucial to growth and patterning in a wide variety of tissues, including the pancreas, during embryonic development.(15) Gli1 is an activator of target genes, and is itself a transcriptional target of the Hh pathway.(16–18) Recent studies have reported an association between Hh pathway activation and initiation of human tumors.(19) It has also been shown that cyclopamine, a Smoothened (Smo) antagonist, suppresses the growth of pancreatic cancer.(20,21) Recently, a paracrine paradigm for Hh pathway-mediated carcinogenesis in pancreatic ductal adenocarcinoma cells (PDAC) has been the focus of various studies.(22,23) They indicate that the pancreatic epithelium is not receptive to tumor cell-derived Hh ligands, but instead, Hh ligands promote PDAC via a paracrine signaling mechanism received by tumor stromal cells.

In the present study, we show for the first time that hypoxia induces upregulation of Smo transcription, consequently increasing Hh pathway activation in a ligand-independent manner and enhancing the invasiveness of pancreatic cancer.

Materials and Methods

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. Disclosure Statement
  8. References
  9. Supporting Information

Cell culture and reagents.  Three human pancreatic ductal cell lines (ASPC-1, SUIT-2 and CFPAC-1) were maintained in RPMI 1640 medium (Nacalai Tesque, Kyoto, Japan) supplemented with 10% fetal calf serum (FCS; Life Technologies, Grand Island, NY, USA) and antibiotics (100 units/mL of penicillin and 100 μg/mL of streptomycin). For normoxic conditions, cells were cultured in 5% CO2 and 95% air. For hypoxic conditions, cells were cultured in 1% O2, 5% CO2 and 94% N2 using a multigas incubator (Sanyo, Tokyo, Japan). Cell numbers were counted by a Coulter counter (Beckman Coulter, Fullerton, CA, USA). Cyclopamine, purchased from Toronto Research Chemicals (Toronto, ON, Canada), was diluted in 100% ethanol. In some experiments, recombinant Sonic hedgehog (Shh) NH2-terminal peptide (rhShh, R&D system, Minneapolis, MN, USA) was added in the culture medium.

Real-time PCR.  Total RNA was extracted using a High Pure RNA Isolation kit (Roche, Mannheim, Germany) and quantified by spectrophotometry (Ultrospec 2100 Pro; Amersham Pharmacia Biotech, Cambridge, UK). For real-time RT-PCR, 1 μg of RNA was treated with DNase and was reverse transcribed to cDNA with the Quantitect Reverse Transcription kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s protocol. Reactions were run with iQ SYBR Green Supermix (Bio-Rad, Hercules, CA, USA), on a DNA Engine Option 2 System (MJ Research, Waltham, MA, USA). All primer sets amplified fragments <200-bp long. The primer sequences used were: Smo, forward, CAGGTGGATGGGGACTCTGTGAGT, reverse, GAGTCATGACTCCTCGGATGAGG; Shh, forward, 5′-GTG TAC TAC GAG TCC AAG GCA C-3′, reverse, 5′-AGG AAG TCG CTG TAG AGC AGC-3′; Gli1, forward, 5′-GGT TCA AGA GCC TGG GCT GTG T-3′, reverse, 5′-GGC AGC ATT CTC AGT GAT GCT G-3′; matrix metalloproteinase9 (MMP9), forward, 5′-TGGGCTACGTGACCTATGACAT-3′, reverse, 5′-GCCCAGCCCACCTCCACTCCTC-3′; HIF-1α, forward, 5′-GAAGTGTACCCTAACTAGCCGAGG-3′, reverse, 5′-TTTCTTATACCCACACTGAGGTTGG-3′; and β-actin, forward, 5′-TTGCCGACAGGATGCAGAAGGA-3′, reverse, 5′-AGGTGGACAGCGAGGCCAGGAT-3′. The amount of each target gene in a given sample was normalized to the level of β-actin.

Matrigel invasion assay.  The invasiveness of pancreatic cancer cells was assessed based on the invasion of cells through Matrigel-coated transwell inserts as previously described.(24) In brief, the upper surface of a filter (pore size, 8.0 μm; BD Biosciences, Heidelberg, Germany) was coated with basement membrane Matrigel (BD Biosciences). Cells were suspended in RPMI-1640 with 10% FCS. Then, 0.8 × 105 cells were added to the upper chamber and incubated for 16 h. After incubation, the filter was fixed and stained with Diff-Quick reagent (International Reagents, Kobe, Japan). All cells that had migrated from the upper to the lower side of the filter were counted under a light microscope (BX50; Olympus, Tokyo, Japan) at a magnification of ×100. Tumor cell invasiveness testing was carried out in triplicate wells.

RNA interference.  SiRNA for Gli1 (ON-TARGETplus SMART pool, L-003896), siRNA for Smo (ON-TARGETplus SMART pool, L-005726), siRNA for HIF-1α (ON-TARGET plus SMART pool, L-004018), siRNA for Shh (ON-TARGETplus SMART pool, L-006036), siRNA for MMP9 (ON-TARGETplus SMART pool, L-005970) and negative control siRNA (ON-TARGETplus si CONTROL non-targeting pool, D-001810) were purchased from Dharmacon RNA Technologies (Chicago, IL, USA). Cells (0.2 × 106 cells/well) seeded in six-well plates were transfected with 100 nM siRNA using Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Cells were used for experiments at 2 days after transfection.

Immunoblotting.  Whole-cell extraction was performed with M-PER Reagents (Pierce Biotechnology, Rockford, IL, USA) according to the manufacturer’s instructions. Protein concentration was determined with a Bio-Rad Protein Assay (Bio-Rad), and whole-cell extract (50 μg) was separated by electrophoresis on SDS-polyacrylamide gel, and transferred to Protran nitrocellulose membranes (Dassel, Germany). Blots were then incubated with anti-α-tubulin (1:1000; Sigma Aldrich Co., St. Louis, MO, USA) or anti-Smo (1:500; N-19, sc-6366, Santa Cruz Biotechnology, Santa Cruz, CA, USA) primary antibody overnight at 4°C. Blots were then incubated in HRP-linked secondary antibody (Amersham Biosciences, Piscataway, NJ, USA) at room temperature for 1 h. Immunocomplexes were detected with ECL plus Western Blotting Detection System (Amersham Biosciences) and visualized with a Molecular Imager FX (Bio-Rad). α-tubulin was used for the protein loading control. Band densities were normalized by α-tubulin using ImageJ software (NIH, Bethesda, MD, USA).

Clinical samples and triple staining fluorescence immunohistochemistry.  Surgical specimens were obtained from 10 patients with PDAC, all of whom underwent resection at the Department of Surgery and Oncology, Kyushu University (Fukuoka, Japan). Informed consent was obtained from all patients. Slides were deparaffinized with xylene, rehydrated with alcohol, and antigen retrieval was achieved by microwaving in Target Retrieval Solution (pH 6.0; DAKO, Tokyo, Japan) for 10 min. The sections were rinsed with PBS and blocked using skim milk (Yukijirushi, Gunma, Japan) for 10 min at room temperature. The sections were incubated with anti-CA-9 (Carbonic anhydrase-IX, 1:200; Novus Biologicals, Littleton, CO, USA), anti-MMP9 (1:100, sc-6840; Santa Cruz Biotechnology), anti-Gli1 (1:100, N-16, sc-6153, Santa Cruz Biotechnology), and anti-Smo (1:100; N-19, sc-6366; Santa Cruz Biotechnology) antibodies at 4°C overnight. Primary antibodies were then visualized by incubating cells with Alexa 488 conjugated chicken anti-rabbit (1:1000; Invitrogen) and Alexa 594 conjugated donkey anti-goat (1:1000; Invitrogen) for 1 h at 37°C, respectively. After incubation with secondary antibodies, the sections were rinsed three times with PBS. The cells were counterstained with 4′,6-diamidino-2-phenylindole (DAPI; Sigma Aldrich) and then mounted in VECTASHIELD (Vector laboratories, Burlingame, CA, USA). The samples were examined by fluorescence microscopy (Carl Zeiss, Tokyo, Japan).

Statistical analysis.  Student’s t-test was used for statistical analysis. A P-value of <0.05 was considered significant.

Results

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. Disclosure Statement
  8. References
  9. Supporting Information

Hypoxia increases the invasiveness and Hh pathway activation of PDAC.  We first examined the influence of hypoxia on the invasiveness of PDAC. When three PDAC lines were cultured for 24 h under normoxic or hypoxic conditions, the number of cells was not different between these culture conditions. An incubation time of 16 h was selected for the invasion assay. Hypoxia significantly increased the invasiveness of these PDAC (Fig. 1a). We next examined the influence of hypoxia on Hh pathway activation. Hypoxia significantly increased the transcription of Hh pathway-related genes including Shh and Gli1 (Fig. 1b). Gli1 is a target gene and a transcriptional factor for the Hh pathway (16–18). Thus, the data strongly indicate that hypoxia increases Hh pathway activation in these PDAC.

Figure 1.  Hypoxia increases the invasiveness and Hh pathway activation of pancreatic ductal adenocarcinoma cells (PDAC). (a) The PDAC were seeded into a Matrigel-coated invasion chamber and incubated under normoxic (N) or hypoxic (H) conditions for 16 h. Representative pictures stained with Diff-Quick reagent are shown (upper panels). The number of cells was counted under a light microscope (lower panels). Bar, 10 μm. (b) The PDAC were cultured under normoxic (N) or hypoxic (H) conditions for 16 h. Then, Shh and Gli1 mRNA expressions were estimated by real-time RT-PCR. (c) After PDAC were treated with 1 or 10 μM cyclopamine for 12 h or transfected with Gli1 siRNA for 48 h under normoxic conditions, the PDAC were transferred and cultured under hypoxic conditions for 16 h. Then, Gli1 mRNA expression was estimated by real-time RT-PCR. (d) After the PDAC were treated with 1 or 10 μM cyclopamine for 12 h or transfected with Gli1 siRNA for 48 h under normoxic conditions, cells were seeded into a Matrigel-coated invasion chamber and incubated under hypoxic conditions. The number of cells was counted under a light microscope. *P < 0.05. Bar, SD.

Download figure to PowerPoint

image

We then investigated the relationship between hypoxia-induced invasiveness and hypoxia-induced Hh pathway activation using a Smo antagonist, cyclopamine and siRNA targeting Gli1. Cyclopamine treatment or Gli1 siRNA transfection did not affect the cell number after 16 h culture (Fig. S1). A high dose (10 μM) but not a low dose (1 μM) of cyclopamine decreased both transcription of Gli1 (Fig. 1c) and PDAC invasiveness (Fig. 1d). Transfection of siRNA targeting Gli1 reduced mRNA expression of Gli1 by almost 60% (Fig. 1c) and decreased the invasiveness of PDAC (Fig. 1d). These findings indicate a linkage between invasiveness and Hh pathway activation under hypoxic conditions.

Hypoxia increases the invasiveness and Hh pathway activation of PDAC in a Shh-independent manner.  Several in vitro experiments using cell lines indicate that Hh activation in PDAC is dependent on Shh.(14,25) The current study indicates that hypoxia increases the transcription of Shh (Fig. 1b). Therefore, we examined whether hypoxia-induced Shh contributes to increased invasiveness and Hh pathway activation induced by hypoxia. To examine this possibility, we silenced Shh at the mRNA level. Transfection of siRNA targeting Shh significantly reduced mRNA expression of Shh by 80% or more (Fig. S2a). Surprisingly, silencing of Shh did not significantly affect the transcription of Gli1 (Fig. S2b) and PDAC invasiveness (Fig. S2c) under hypoxic conditions. Next, PDAC lines were co-cultured with rhShh under hypoxic conditions. rhShh did not affect proliferation of these cells during the Matrigel invasion assay (data not shown). The addition of rhShh did not affect either the transcription of Gli1 (Fig. S2d) or PDAC invasiveness (Fig. S2e) under hypoxic conditions. These data suggest that hypoxia-induced increased Shh transcription does not contribute to increased invasiveness and Hh pathway activation under hypoxic conditions. That is to say, hypoxia-induced invasiveness and Hh pathway activation are essentially independent of Shh.

Hypoxia increases PDAC invasiveness and Hh pathway activation by increasing the transcription of Smo.  Our current studies showed that cyclopamine blocked transcription of Gli1 and PDAC invasiveness. Next, we evaluated whether hypoxia affected transcription of Smo. Surprisingly, hypoxia increased the transcription of Smo (Fig. 2a) and Smo protein (Fig. 2b). Therefore, we then examined the possibility that hypoxia-induced increased transcription of Smo contributes to increased invasiveness and Hh pathway activation. Silencing of Smo by siRNA significantly reduced mRNA expression of Smo by 80% or more (Fig. 2c). Silencing of Smo did not affect the transcription of Shh (Fig. 2d). However, as we expected, silencing of Smo significantly decreased both Gli1 mRNA expression (Fig. 2e) and PDAC invasiveness (Fig. 2f) induced by hypoxia.

Figure 2.  Hypoxia increases the invasiveness and Hh pathway activation of pancreatic ductal adenocarcinoma cells (PDAC) by increasing the transcription of Smo. (a) The PDAC were cultured under normoxic (N) or hypoxic (H) conditions for 16 h. Then, Smo mRNA expression was estimated by real-time RT-PCR. (b) Smo protein expression was evaluated by immunoblotting (left panel). Band densities were normalized by α-tubulin (right panel). (c,d,e) After PDAC were transfected with Smo siRNA for 48 h under normoxic conditions, PDAC were transferred and cultured under hypoxic conditions for 16 h. Then, Smo (c), Shh (d) and Gli1 (e) mRNA expressions were evaluated by real-time RT-PCR. (f) After the PDAC were transfected with Smo siRNA for 48 h, the cells were seeded into a Matrigel-coated invasion chamber and incubated under hypoxic conditions for 16 h. The number of cells was counted under a light microscope. *P < 0.05. Bar, SD.

Download figure to PowerPoint

image

Hypoxia increases the expression of MMP9 mRNA by increasing the transcription of Smo.  To examine the key molecules that play a role in hypoxia-induced increased invasiveness of PDAC, we examined the transcription of MMP9 according to the results of our previous study.(14) As we expected, hypoxia significantly increased MMP9 transcription (Fig. 3a). Importantly, silencing of Smo or Gli1 significantly inhibited the increased MMP9 transcription induced by hypoxia (Fig. 3b). However, as also expected, silencing of Shh or addition of rhShh did not affect MMP9 transcription (Fig. 3c). These data indicate that hypoxia increases the transcription of Smo, then Gli1, and finally MMP9. Data indicate that hypoxia-induced MMP9 transcription is also Shh independent.

Figure 3.  Hypoxia increases MMP9 expression by increasing Hh pathway activation. (a) Pancreatic ductal adenocarcinoma cells (PDAC) were cultured under normoxic (N) or hypoxic (H) conditions for 16 h. Then MMP9 mRNA expression was estimated by real-time RT-PCR. (b) After the PDAC were transfected with Smo or Gli1 siRNA for 48 h under normoxic conditions, the PDAC were transferred and cultured under hypoxic conditions for 16 h. Then, MMP9 mRNA expression was estimated by real-time RT-PCR. (c) After the PDAC were transfected with Shh siRNA for 48 h under normoxic conditions, the PDAC were cultured under hypoxic conditions for 16 h, or PDAC were cultured under hypoxic conditions with or without 0.5 μg/mL of rhShh for 16 h. Then, MMP9 mRNA expression was analyzed by real-time RT-PCR. (d) After the PDAC were transfected with MMP9 siRNA for 48 h under normoxic conditions, the PDAC were seeded into a Matrigel-coated invasion chamber and incubated under hypoxic conditions for 16 h. The number of cells was counted under a light microscope. *P < 0.05. Bar, SD.

Download figure to PowerPoint

image

To confirm that MMP9 is one of the molecules thatplay a crucial role in hypoxia-induced increased invasiveness, we silenced the transcription of MMP9 by siRNA. Silencing of MMP9 reduced mRNA expression of MMP9 by 80% or more (data not shown). Silencing of MMP9 almost abrogated the invasiveness of PDAC under hypoxic conditions (Fig. 3d).

Hypoxia also increases MMP9 expression by inducing HIF-1α.  Because silencing of MMP9 almost abolished the invasiveness of PDAC under hypoxic conditions, we speculated that pathways other than the Hh pathway are involved in the increased transcription of MMP9 induced by hypoxia. HIF-1α expression in PDAC under hypoxic conditions was higher than that under normoxic conditions (Fig. S3). HIF-1α was recently reported as an invasion factor.(6–8,26) Therefore, we silenced HIF-1α at the mRNA level. Transfection of siRNA targeting HIF-1α significantly reduced mRNA expression of HIF-1α by 70% or more (Fig. S4a). As expected, silencing of HIF-1α significantly decreased MMP9 transcription (Fig. S4b) and the PDAC invasiveness (Fig. S4c) induced by hypoxia. Data indicate that HIF-1α also plays an important role in hypoxia-induced increased MMP9 expression and PDAC invasiveness.

Hh and HIF-1α pathways increase MMP9 transcription by different mechanisms under hypoxia.  Because the HIF-1α pathway also increased MMP9 transcription, we analyzed a linkage between these two pathways in hypoxia-induced MMP9 transcription. Silencing of HIF-1α did not affect the transcription of Hh-related genes under hypoxia (Fig. S5). Silencing of Smo or Gli1 also did not affect HIF-1α expression under hypoxia (Fig. S6). These results suggest that Hh and HIF-1α pathways are acting independently of each other.

MMP9, Gli1 and Smo partially expressed in a hypoxic area of pancreatic cancer tissue.  To speculate if the in vitro phenomena investigated here could also be found in vivo, we examined triple staining fluorescence immunohistochemistry of surgically resected pancreatic cancer tissues. In the present study, we used CA-9 expression as a marker of hypoxia.(25) Fluorescence immunohistochemistry revealed that MMP9, Gli1 and Smo partially co-expressed with CA-9 (Fig. 4). These results indicate that the data presented here may be representative of conditions occurring in pancreatic cancer tissues.

Figure 4.  MMP9, Gli1 and Smo partially expressed in a hypoxic area in pancreatic cancer tissue. Representative pictures of triple staining fluorescence immunohistochemistry for (a) CA-9 (green) and MMP9 (red), (b) CA-9 (green) and Gli1 (red), and (c) CA-9 (green) and Smo (red) in pancreatic cancer tissue are shown. A co-expressed lesion turned yellow. Nuclei were stained by DAPI. Bars, 20 μm.

Download figure to PowerPoint

image

Discussion

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. Disclosure Statement
  8. References
  9. Supporting Information

In the current study, we showed for the first time that hypoxia could activate the Hh signaling pathway in PDAC by increasing transcription of Smo, but not Shh. In a previous study performed under normoxic conditions, we showed that rhShh and anti-Shh antibody increase and decrease the invasiveness of PDAC, respectively.(14,27) We have also shown that Shh secreted by LPS-stimulated monocytes increased the proliferation of PDAC.(26) In this experiment, when the expressions of Shh or Smo of PDAC were silenced using siRNAs, Shh secreted by monocytes could no longer induce Hh activation or proliferation. Based on these previous studies, we believe that Hh activation in pancreatic cancer is dependent on its ligand, Shh. However, recently a paracrine paradigm has been reported in a mouse model.(22,23) This paradigm suggests that pancreatic cancer cells do not react to Shh produced by themselves, and that growth factors induced by stromal cell activated by Hh signaling increase the proliferation of pancreatic cancer cells. The cause of this discrepancy in the results between the in vitro experiment and the in vivo mouse model is not clear. In the current study we focused on the difference in oxygen tension between in vitro and in vivo experiments. In vitro experiments are usually performed under 20% O2, as was done in our previous studies.(14) On the other hand, it has been reported that oxygen tension in cancer tissue is usually below 1%.(4) Accordingly, we considered the hypovascularity of pancreatic cancer tissues and performed the in vitro experiment under 1% O2. Increase of Shh transcription and indifference of Shh to Gli1 transcription or invasiveness under hypoxic conditions suggest that Shh produced by pancreatic cancer cells does not contribute to hypoxia-induced Hh signaling activation or to increased invasiveness of PDAC. This possibility is supported by the finding that rhShh did not induce Gli1 expression and PDAC invasiveness. In other words, it appears that Shh induced under hypoxia, different from normoxia, is not involved in Hh pathway activation. This difference in oxygen tensions may be one of the causes of the discrepancy found between the in vitro experiments and the in vivo mouse model.

The mechanism of hypoxia-induced Hh pathway activation was then investigated. We considered the fact that the Smo inhibitor cyclopamine suppressed Gli1 transcription and tumor invasiveness even under hypoxia. Because cyclopamine is a representative Smo antagonist, we analyzed the transcription of Smo under hypoxia. The results indicated that hypoxia could upregulate Smo expression (Fig. 2a,b). To confirm this novel hypothesis, Smo was silenced using Smo siRNA. Indifference of Smo to Shh transcription suggests that PDAC may not be responsive to Shh. We concluded that one of the mechanisms of non-response to Shh under hypoxia is due to the super-transcription of Smo rather than the activation of Smo through the binding of Shh to patched1.

The next question is what molecules play a role in hypoxia-induced increased invasiveness. We have already shown that Gli1 contributes to the invasiveness of PDAC through MMP9 activation under normoxic condition.(14) It has been shown that HIF-1α induced by hypoxia increases MMP9 expression and consequently increases tumor invasiveness.(6) Thus, we focused on MMP9. It is noteworthy that both the Hh pathway and the HIF-1α pathway contribute to hypoxia-induced invasiveness but there is no direct link between these pathways.

In fluorescence immunohistochemistry of pancreatic cancer tissue, hypoxia marker, CA-9, Smo, Gli1 and MMP9 expressions showed significant correlation. We consider that the same mechanisms should work in pancreatic cancer tissue as well as in the in vitro system studied here. In early stage clinical studies, administration of the Smo-inhibitor GDC-0449 to patients with advanced basal cell carcinoma has produced promising results.(28) In addition, treatment of medulloblastoma patients harboring widespread metastatic disease with GDC-0449 resulted in rapid and dramatic tumor regression.(29) The increase in invasiveness through hypoxia-induced upregulation of Smo transcription was suppressed by a high dose of cyclopamine, suggesting that Smo inhibitor is also indicated in the treatment of pancreatic cancer. We think that a low dose of cyclopamine can not overcome the hypoxia-induced increase of Smo. Now we are evaluating the mechanisms by which hypoxia increases Smo transcription. We have summarized our findings in Fig. 5. Hypoxia upregulates the transcription of Shh, Smo and HIF-1α independently. Among these, Smo and HIF-1α are independently related to the hypoxia-induced invasiveness through MMP9 expression.

Figure 5.  Schematic figure of findings. Hypoxia upregulates the transcription of Shh, Smo and HIF-1α independently. Among these, Smo and HIF-1α are related to the hypoxia-induced invasiveness through MMP9 expression independently.

Download figure to PowerPoint

image

In conclusion, mechanisms dependent on Smo transcription, but not Shh transcription, inducing Hh signaling activation and invasiveness exist under hypoxic conditions. These results suggest that the Hh pathway could be a good therapeutic target for pancreatic cancer.

Acknowledgments

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. Disclosure Statement
  8. References
  9. Supporting Information

This study was supported by General Scientific Research Grants (21390363) from the Ministry of Education, Culture, Sports, Science and Technology of Japan. We thank Ms Kaori Nomiyama and Mrs Miyuki Omori (Kyushu University, Fukuoka, Japan) for their skillful technical assistance.

Disclosure Statement

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. Disclosure Statement
  8. References
  9. Supporting Information

The authors declare no financial or commercial conflict of interest.

References

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. Disclosure Statement
  8. References
  9. Supporting Information

Supporting Information

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgments
  7. Disclosure Statement
  8. References
  9. Supporting Information

Fig. S1. Cyclopamine treatment or Gli1 siRNA transfection did not affect the cell number after 16 h culture.

Fig. S2. Hypoxia increases the invasiveness and Hh pathway activation of PDAC in a Shh-independent manner.

Fig. S3. HIF-1α protein expressed under hypoxic conditions.

Fig. S4. Hypoxia increases MMP9 expression by inducing HIF-1a.

Fig. S5. Silencing of HIF-1α did not affect the transcription of Hh-related genes under hypoxia.

Fig. S6. Silencing of Smo or Gli1 did not affect HIF-1α expression under hypoxic conditions.

FilenameFormatSizeDescription
CAS_1912_sm_f1.tif74KSupporting info item
CAS_1912_sm_f2.tif98KSupporting info item
CAS_1912_sm_f3.tif201KSupporting info item
CAS_1912_sm_f4.tif83KSupporting info item
CAS_1912_sm_f5.tif76KSupporting info item
CAS_1912_sm_f6.tif373KSupporting info item

Please note: Wiley-Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.