• Open Access

Gene status of head and neck squamous cell carcinoma cell lines and cetuximab-mediated biological activities

Authors

Errata

This article is corrected by:

  1. Errata: Correction Volume 105, Issue 11, 1518, Article first published online: 20 November 2014

To whom correspondence should be addressed. E-mail: kondonorio@cick.jp

Abstract

Cetuximab is a chimeric IgG1 monoclonal antibody that targets epidermal growth factor receptor (EGFR). Cetuximab binds to EGFR and prevents phosphorylation of EGFR. Moreover, preclinical results have shown the ability of cetuximab to induce either complement-mediated tumor cell killing (CDC) or antibody-dependent cell-mediated-cytotoxicity (ADCC). We previously reported mutation in EGFR regarding head and neck squamous cell carcinoma (HNSCC) cell lines. In the present study, we analyzed the same 16 HNSCC cell lines for mutations in KRAS, PIK3CA, BRAF and PTEN. Furthermore, we evaluated cetuximab-mediated biological activities (antiproliferative effect by the MTT assay and ADCC) regarding these cell lines. Mutations in PIK3CA and PTEN were observed in two cell lines (2/16, 12.5%), but no mutation was observed in KRAS and BRAF. The antiproliferative effect of cetuximab by the MTT assay was not strong, and no correlation was observed between the antiproliferative effect of cetuximab and mutations in EGFR, KRAS, PIK3CA, BRAF and PTEN in these cell lines. Therefore, the mutation status of EGFR and downstream molecules were not useful for predicting the antitumor effects of cetuximab on HNSCC. Cetuximab-mediated ADCC was observed in these cell lines and might have been influenced by the expression of EGFR. Therefore, cetuximab-mediated ADCC seems to be an important part of the antitumor mechanisms of cetuximab and the expression levels of EGFR might influence the antitumor activity of cetuximab. Therefore, besides the antiproliferative effect of cetuximab by the MTT assay, it appeared important to evaluate cetuximab-mediated ADCC as well as EGFR expression in HNSCC cells. (Cancer Sci 2011; 102: 1717–1723)

Epidermal growth factor receptor (EGFR) is a 170-kDa receptor tyrosine kinase and belongs to the HER family of receptor tyrosine kinases, which include EGFR (ErbB1 or HER-1), HER-2 (ErbB2), HER-3 (ErbB3) and HER-4 (ErbB4). Ligand binding to the extracellular region of EGFR triggers receptor homo- or heterodimerization, autophosphorylation on the specific tyrosine residues, and creates binding sites for the recruitment of adaptor molecules, which in turn transduce signals intracellularly to the nucleus through multiple pathways.(1)

Overexpression of EGFR has been frequently observed in head and neck squamous cell carcinoma (HNSCC) and is thought to correlate with carcinogenesis, metastasis, clinical stage and poor prognosis.(2,3)

Cetuximab, a human/murine chimeric IgG1 monoclonal antibody that targets EGFR, exerts synergistic antitumor interactions with several cytotoxic drugs. The antitumor effect of cetuximab combined with chemotherapy is reported for treating colorectal cancer and HNSCC.(4,5) Cetuximab combined with radiotherapy is also effective in patients with locally advanced HNSCC.(6) Cetuximab binds to EGFR with a 10-fold higher affinity than its natural ligands and prevents ligand-induced phosphorylation of EGFR. Other mechanisms have also been proposed for cetuximab-mediated antitumor activity. Preclinical results have already shown the ability of cetuximab to induce either complement-mediated tumor cell killing (CDC) or antibody-dependent cell-mediated-cytotoxicity (ADCC) by interacting with natural killer (NK) cells, monocytes and granulocytes.(7–10)

A number of randomized trials have shown that the efficacy of therapies targeting EGFR is not observed in patients with advanced colorectal cancer, whose tumors harbor mutations in KRAS, PIK3CA and BRAF.(11–13) In addition, the loss of expression or mutation of PTEN has been reported to correlate with the treatment efficacy of cetuximab in colorectal cancer.(14,15) However, the mechanisms underlying these genetic mutations and the clinical response to these mutations remain largely unknown.

These mutations have been reported regarding HNSCC;(16–18) however, the biomarker, which best predicts the clinical efficacy of cetuximab, has not been identified. Moreover, there are no reports that refer to the efficacy of the antitumor effects of cetuximab, that is, the antiproliferative effect by the MTT assay and ADCC, in relation to the mutation status of EGFR, KRAS, PIK3CA, BRAF and PTEN.

In the present study, we analyzed 16 HNSCC cell lines with regard to the frequency of mutations in KRAS, PIK3CA, BRAF and PTEN. Furthermore, we evaluated the antitumor activity of cetuximab, that is, the antiproliferative effect by the MTT assay and ADCC.

Materials and Methods

Drug.  Cetuximab (Erbitux) was provided by Merk Serono (Darmstadt, Germany).

Cell lines and culture conditions.  Sixteen human HNSCC cell lines were examined in the present study. The origins of these cell lines were the oral floor (YCU-OR891), hypopharynx (YCU-H891), mesopharynx (YCU-M862, KCC-M871 and YCU-M911), larynx (KCC-L871 and YCU-L891), tongue (KCC-T871, KCC-T873, YCU-T891 and YCU-T892) and maxillary sinus (KCC-MS871 and YCU-MS861), and metastatic tumors from different tongue carcinomas (KCC-TCM901, KCC-TCM902 and KCC-TCM903). These cell lines were established in the Department of Otolaryngology, Yokohama City University School of Medicine and Research Institute, Kanagawa Cancer Center. The cell lines were maintained in RPMI-1640 medium (Life Technologies Inc., Tokyo, Japan) supplemented with 10% fetal bovine serum (Gibco, Grand Island, NY, USA), 2 mM l-glutamine, 100 U/mL penicillin and 100 μg/mL streptomycin. These cells were incubated at 37°C in a moist atmosphere containing 5% CO2.

Detection of EGFR mRNA by quantitative RT-PCR.  Cells were grown until nearly confluent in RPMI-1640 supplemented with 10% FBS. Total RNA was extracted from 17 human HNSCC cells with phenol solution (ISOGEN; Nippon Gene Inc., Tokyo, Japan) according to the manufacture’s protocol. One microgram of total RNA was converted into cDNA using the TaKaRa RNA PCR kit (AMV) Ver. 3.0 (TAKARA BIO Inc., Tokyo, Japan). Quantification of the relative expression levels of GAPDH and EGFR were carried out with the TaqMan Gene Expression Master Mix (Applied Biosystems, Foster City, CA, USA) using an ABI Prism 7500 Sequence Detection System (Applied Biosystems). PCR was conducted using the following cycle parameters: 50°C for 2 min, 95°C for 10 min, followed by 60 cycles at 95°C for 15 s and 60°C 1 min. The primers used to detect each factor were as follows: GAPDH, Hs99999905 m1 (Applied Biosystems); and EGFR, Hs01076092 m1 (Applied Biosystems). The results were normalized by the corresponding GAPDH levels. Each PCR amplification was performed at least three times and the mean was calculated.

In vitro MTT proliferation assays.  A cell proliferation assay was performed to assess the effect of treatment on the growth of 16 human HNSCC cell lines. These cells were plated in 96-well flat plates at a concentration of 1 × 103 cells/well. After 72 h exposure to cetuximab (five wells of the 96-well plate per experimental condition), cell proliferation was assayed by incubating with Tetra Color One (Seikagaku Co., Ltd, Tokyo, Japan). Relative growth inhibition was calculated by dividing the number of recovered drug-treated cells by the number of vehicle-treated control cells.

Detection of KRAS, PIK3CA, BRAF and PTEN mutations.  Genomic DNA was extracted using the SepaGene kit (Sanko Junyaku Co., Ltd, Tokyo, Japan). Exons 2 and 3 of KRAS, exons 8, 10 and 21 of PIK3CA, exons 11 and 15 of BRAF, and exons 1–9 of the PTEN gene were amplified by polymerase chain reaction (PCR) using the specific primer set list in Table 1.(16–21) The PCR products were further analyzed by direct nucleotide sequencing using the ABI PRISM 3100 DNA Analyzer (Applied Biosystems) in order to detect mutations.

Table 1.   Primers used for PCR and sequencing for screening of mutations
Target exonForward (5>3)Reverse (5>3)
KRAS
 Exon 2GGCCTGCTGAAAATGACTGAAGTCCTGCACCAGTAATATGC
 Exon 3CTGTAATAATCCAGACTGTGTCCCCAGTCCTCATGTACTG
PIK3CA
 Exon 8TGAATTTTCCTTTTGGGGAAGCAAACTCCAACTCTAAGCATGG
 Exon 10TTGAAAATGTATTTGCTTTTTCTGTCATGTAAATTCTGCTTTATTTATTCCA
 Exon 21CATTTGCTCCAAACTGACCAGGTCTTTGCCTGCTGAGAGT
BRAF
 Exon 11TCCCTCTCAGGCATAAGGTAACGAACAGTGAATATTTCCTTTGAT
 Exon 15TAGGAAAGCATCTCACCTCATCCCACTGATTTTTGTGAATACTGGGAAC
PTEN
 Exon 1CAAGTCCAGAGCCATTTCCATCGCAACCTGACCAGGGTTAAATG
 Exon 2CTCCAGCTATAGTGGGGAAAACGTCCATTAGGTACGGTAAGCCA
 Exon 3CTACTCTAAACCCATAGAAGGGCTTGGACTTCTTGACTTAATCGG
 Exon 4GGGGGTGATAACAGTATCTACTCAGTAAGATACAGTCTATCGGG
 Exon 5CTCTGGAATCCAGTGTTTCTTTCCAATAAATTCTCAGATCCAGG
 Exon 6CTACGACCCAGTTACCATAGCAGGCTTCTTTAGCCCAATGAGTTG
 Exon 7GCTTGAGATCAAGATTGCAGCAATGCCAGAGTAAGCAAAAC
 Exon 8GCAACAGATAACTCAGATTGCCGTTCTTCATCAGCTGTACTCCT
 Exon 9CTTTCTCTAGGTGAAGCTGTACTTTTCATGGTGTTTTATCCCTCTTGA

Cytotoxic assays.  Peripheral blood mononuclear cells (PBMC) were separated from peripheral blood obtained from three healthy donors (donors A, B, and C) by centrifugation with BD Vacutainer (Becton, Dickinson and Company, Franklin Lakes, NJ, USA). Cytotoxicity of the PBMC cells was evaluated with lactate dehydrogenase (LDH) release experiments using CytoTox 96 Non-Radioactive Cytotoxicity Assays (Promega, Madison, WI, USA) according to the manufacturer’s instructions. Target cells were seeded at a concentration of 1 × 104 cells/well in 96-well plates and cetuximab at a concentration of 100 nM and effector cells of each effector/target (E/T) cell ratio (20:1, 10:1, 5:1 and 2.5:1) were added.

Cytotoxicity was evaluated with the following formula: % cytotoxicity = (Experimental − Effector Spontaneous − Target Spontaneous)/(Target Maximum − Target Spontaneous) × 100.

Statistical analysis.  For statistical analyses, Spearman’s correlation coefficient or the rank test and Student’s paired t-test were used. Significance was considered at P < 0.05.

Results

Expression of EGFR mRNA in 16 HNSCC cell lines.  Using real-time quantitative RT-PCR, we analyzed steady state levels of mRNA for EGFR in 16 different HNSCC cell lines. Relative expression levels of mRNA for EGFR were calculated by comparison with the expression levels of GAPDH. Although the expression levels of mRNA for EGFR varied widely, all cell lines expressed mRNA encoding EGFR (Fig. 1). The steady state level of EGFR mRNA was highest in KCC-T873 and lowest in KCC-MS871.

Figure 1.

 Expression of epidermal growth factor receptor (EGFR) mRNA in head and neck squamous cell carcinoma (HNSCC) cell lines. Expression of mRNA was determined by real-time RT-PCR in 16 HNSCC cell lines. The level of each mRNA was normalized relative to GAPDH mRNA.

Antiproliferative effect of cetuximab on 16 HNSCC cell lines.  We determined the antiproliferative effect of 0–100 nM cetuximab on HNSCC cell lines. As shown in Figure 2, KCC-T871 was most sensitive to cetuximab and was the only cell line to reach 50% inhibition of cell growth. In the other cell lines, cetuximab induced <50% inhibition of cell growth. In almost all cell lines, cell viability reached a plateau at concentrations over 10 nM of cetuximab.

Figure 2.

 Antiproliferative activity of cetuximab. In the proliferation assay described in the Materials and Methods, tumor cells were exposed to various concentrations of cetuximab for 72 h. Data presented are mean values (= 3 per group). Each data was expressed as a percentage of cell growth relative to untreated controls. Error bars indicate standard error.

Comparison of the antiproliferative effect of cetuximab with EGFR expression and mutations.  To determine the correlation between the antiproliferative effect of cetuximab and expression of EGFR, we analyzed levels of mRNA for EGFR in 16 HNSCC cell lines. In an earlier article, we reported expression of EGFR protein levels in the same HNSCC cell lines.(22) Expression levels of EGFR mRNA were determined by densitometry, and relative expression levels were calculated by comparison with expression levels of GAPDH. The steady state level of EGFR protein was highest in KCC-T873 and lowest in YCU-MS861. Because the IC50 of cetuximab could not be calculated in any cell line except KCC-T871 and the cell viability of almost all cell lines showed a plateau at concentrations over 10 nM cetuximab, an index of the antiproliferative effect of cetuximab was evaluated with a value of cell viability (% of control) at a concentration of 10 nM.

Linear regression analysis showed that EGFR protein levels have no correlation with the antiproliferative effect of cetuximab (r = −0.28, = 0.27) (Fig. 3A). In addition, levels of mRNA for EGFR had no correlation with the antiproliferative effect of cetuximab (r = −0.19, = 0.45) (Fig. 3B).

Figure 3.

 Response to cetuximab correlated to epidermal growth factor receptor (EGFR) protein levels and EGFR mRNA levels. The EGFR protein levels were determined by densitometoric analysis of western blot as described in earlier articles.(22) The EGFR mRNA levels were quantified by real-time RT-PCR. (A) EGFR protein level versus a value of cell viability (% of control) of cetuximab at a concentration of 10 nM (r = −0.28, = 0.27). (B) EGFR mRNA level versus a value of cell viability (% of control) of cetuximab at a concentration of 10 nM (r = −0.19, = 0.45). A correlation was not observed in two groups. Statistical correlation was analyzed with Spearman’s correlation coefficient or by the rank test.

We reported in an earlier article that the heterozygous EGFR mutation at exon 20 was found in nine cell lines and these cell lines showed higher sensitivity to gefitinib than the cell lines with wild-type EGFR.(22) Using these results, we analyzed the correlation between EGFR mutation at exon 20 and the antiproliferative effect of cetuximab, but no correlation was observed (= 0.57) (Fig. 4).

Figure 4.

 Correlation between mutations of EGFR at exon 20 and a value of cell viability (% of control) of cetuximab at a concentration of 10 nM. Statistical significance was not observed between cells with the wild-type (WT) and G/A genotype (= 0.57). A significant difference was analyzed by the Student’s paired t-test.

Mutation status of KRAS, PIK3CA, BRAF and PTEN in 16 HNSCC cell lines and correlation with the antiproliferative effect of cetuximab.  We investigated the genomic DNA of 16 human HNSCC cell lines by direct sequencing of PCR products from primers designed to amplify KRAS, PIK3CA, BRAF and PTEN (Table 2). We found heterozygous mutations in exon 21 of PIK3CA and in exon 1 of PTEN. Mutations of PIK3CA at exon 21 were observed in KCC-T871 (3397G>A transition) (Fig. 5A) and YCU-OR891 (3232C>T transition) (Fig. 5B) (NM_006218 in GenBank). KCC-T871 was most sensitive to cetuximab, but YCU-OR891 was resistant to cetuximab. Based on these results, PIK3CA mutation in exon 21 was not important for predicting the antiproliferative effect of cetuximab. A mutation in PTEN in exon 1 was observed in KCC-T871 (1023C>G transition) (Fig. 6A) and YCU-M911 (1023C>G transition) (Fig. 6B) (NM_000314 in GenBank). Similar to the case of PIK3CA mutations in exon 21, KCC-T871 was most sensitive to cetuximab, but YCU-M911 was resistant to cetuximab. The PTEN mutation in exon 1 was also not important for predicting the antiproliferative effect of cetuximab. KCC-T871 was most sensitive to cetuximab and simultaneous mutations in EGFR at exon 20, PIK3CA at exon 21 and PTEN at exon 1 were identified. No mutation was observed in KRAS in exons 2 and 3 (NM_006218 in GenBank), BRAF in exons 11 and 15 (NM_004333 in GenBank) and PTEN at exons 2, 3, 4, 5, 6, 7, 8 and 9 (NM_000314 in GenBank). The mutation status of EGFR, KRAS, PIK3CA, BRAF and PTEN might not be important with regard to the sensitivity of cetuximab, because the frequency of mutation was low in KRAS, PIK3CA, BRAF and PTEN and the antiproliferative effect of cetuximab was not strong.

Table 2.   Mutation status of KRAS, PIK3CA, BRAF and PTEN in 16 head and neck squamous cell carcinoma cell lines
Cell lineKRASPIK3CABRAFPTEN
Exons 2 and 3ExonExons 8, 10 and 21Exons 11 and 15ExonExons 1–9
  1. WT, wild type.

YCU-M862WT WTWT WT
YCU-MS861WT WTWT WT
KCC-T871WT21G>A (3397)WT1C>G (1023)
KCC-MS871WT WTWT WT
YCU-H891WT WTWT WT
YCU-L891WT WTWT WT
YCU-T891WT WTWT WT
YCU-OR891WT21C>T (3232)WT WT
YCU-T892WT WTWT WT
KCC-M871WT WTWT WT
KCC-L871WT WTWT WT
KCC-T873WT WTWT WT
KCC-TCM901WT WTWT WT
KCC-TCM902WT WTWT WT
KCC-TCM903WT WTWT WT
YCU-M911WT WTWT1C>G (1023)
Figure 5.

 Mutation of PIK3A at exon 21. Genomic DNA was extracted and amplified with specific primers as shown in Table 1. (A) Mutation of PIK3CA at exon 21 was observed in KCC-T871 (3397G>A transition). (B) Mutation of PIK3CA at exon 21 was observed in YCU-OR891 (3232C>T transition).

Figure 6.

 Mutation of PTEN at exon 1. Genomic DNA was extracted and amplified with specific primers as shown in Table 1. (A) Mutation of PTEN at exon 1 was observed in KCC-T871 (1023C>G transition) and YCU-M911 (1023C>G transition). (B) Mutation of PTEN at exon 1 was observed in YCU-M911 (1023C>G transition).

Cytotoxic assays.  Cetuximab-mediated ADCC by peripheral blood mononuclear cells (PBMC) was evaluated using EGFR high- (KCC-T873), moderate- (YCU-OR891) and low- (YCU-T891 and YCU-MS861) expressing cells with LDH release experiments. The PBMC were obtained from three healthy donors (donors A, B and C) and the experiment was performed using the PBMC of each of the three donors (Fig. 7A–C). The ADCC activity ranged from high to low in the following order: KCC-T873 > YCU-OR891 > YCU-T891 and YCU-MS861. This order is the same as the EGFR mRNA and protein expression levels of each cell line. In particular, cetuximab-mediated ADCC of TCC-T873, which showed the highest EGFR mRNA and protein expression levels, was significantly higher in four cell lines. These results indicate that the level of ADCC was influenced by EGFR expression levels and was enhanced in accordance with the E/T ratio.

Figure 7.

 Cytotoxic assays in KCC-T873 (epidermal growth factor receptor [EGFR] expression, high), YCU-OR891 (EGFR expression, moderate), YCU-T891 (EGFR expression, low) and YCU-MS861 (EGFR expression, low). The PBMC were extracted from three healthy donors and cytotoxicity assays were performed at different effector/target (E/T) cell ratios in the presence of cetuximab at a concentration of 100 nM. (A) PBMC were obtained from healthy donor A. (B) PBMC were obtained from healthy donor B. (C) PBMC were obtained from healthy donor C. Cetuximab-mediated antibody-dependent cell-mediated-cytotoxicity seemed to be influenced by the expression of EGFR and the E/T ratio.

Discussion

Cetuximab (Erbitux), a human/murine chimerized IgG1 antibody with a high affinity to EGFR, has been approved by the FDA for clinical use in patients with colorectal cancer and HNSCC. Although the clinical efficacy of cetuximab was observed in phase III trials on patients with colorectal cancer and HNSCC, the exact antitumor mechanisms have not been clarified yet. We have previously reported the mutation status of EGFR and the antitumor effect of gefitinib (EGFR tyrosine kinase inhibitor) on HNSCC.(22) EGFR protein expression was expressed in 16 HNSCC cell lines and IC50 was calculated in all cell lines. Moreover, mutations of EGFR at exons 18–23 were detected, and heterozygous and synonymous transition of exon 20 correlated with high sensitivity to gefitinib.(22) In the present study, using the same HNSCC cell lines, the antiproliferative effect of cetuximab was evaluated using a MTT cell proliferation assay, and it was not strong. Only one cell line reached 50% of growth inhibition compared with the control. Approximately 20% growth inhibition was seen in four cell lines, whereas the other cell lines showed only 0–20%. Therefore, compared with gefitinib, cetuximab might have a weak antiproliferative effect as indicated by the results of the MTT cell proliferation assay. Some articles have reported that cetuximab does not induce significant apoptosis in vitro even when used at high concentrations in HNSCC cell lines.(23,24) The present result demonstrates that growth inhibition by cetuximab does not correlate with the expression levels of EGFR protein or mRNA. In fact, some cancer cells showing expression of EGFR demonstrate an ability to become less sensitive to cetuximab and proliferate in an independent manner in the EGFR/tyrosine kinase pathway.(25,26)

Several studies have revealed molecular mechanisms in which EGFR gene mutation is associated with altered sensitivity to gefitinib in non-small-cell lung carcinoma and HNSCC.(22,27,28) We reported that mutation of the EGFR gene in the tyrosine kinase domain at exon 20 of HNSCC increased sensitivity to gefitinib.(22) In terms of cetuximab, mutation of EGFR at exon 20 did not correlate with the results of the cell proliferation assay.

In colorectal cancer, there are many reports that the activating mutation in KRAS is a strong predictor of resistance to cetuximab. However, KRAS is not a perfect predictor as only 40–50% of patients with wild-type KRAS tumors respond to cetuximab treatment.(11,29) Therefore, other predictors, for example, PIK3CA, BRAF and PTEN, of sensitivity to cetuximab were examined. The prevention of ligand binding to EGFR by monoclonal antibodies or blockage of intracellular receptor phosphorylation by tyrosine-kinase inhibitors disrupts the signal transduction pathways, for example, RAS/RAF/MAPK and PIK/AKT cascades, which promote cell growth, proliferation, invasion, angiogenesis and metastasis.(30,31) PTEN functions as a protein phosphatase and has been implicated in the inhibition of cell migration, cell invasion and cell cycle progression.(32,33) Thus, PTEN is thought to act as a tumor suppressor gene through negative regulation of the PI3-kinase/AKT cell survival pathway.(18,34)

Several articles have reported the expression of PIK3CA, BRAF and PTEN in HNSCC. Sheikh et al.(17) analyzed KRAS mutations in tumor cells from 91 Japanese HNSCC patients and 12 HNSCC cell lines, but no mutation was found in KRAS, similar to the present results. Based on these facts, we conclude that the mutation status of KRAS is not useful for predicting sensitivity to cetuximab in HNSCC because the mutation frequency is low and the antiproliferative effect of cetuximab is not strong in HNSCC. The mutation status of BRAF has not been reported in HNSCC. In the present study, BRAF mutation was not found. Kozaki et al.(16) investigated PIK3CA mutations of 14 human oral squamous cell carcinoma (OSCC) cell lines and cells from 108 primary OSCC and identified mutations in 21.4% (3/14) of OSCC cell lines and 7.4% (8/108) of OSCC tumors. In contrast, Fenic et al.(35) investigated 33 HNSCC and detected no PIK3CA mutations. We found a heterozygous PIK3CA mutation at exon 21 in two cell lines (2/16, 12.5%). KCC-T871, which showed 3397G>A transition at exon 21, was most sensitive to cetuximab among the 16 cell lines. YCU-OR891 showed 3232C>T transition; however, this cell line was resistant to cetuximab. From these results, we conclude that PIK3CA is not a useful predictor of the efficacy of cetuximab. Kurasawa et al.(18) reported that mutations in PTEN were not found in the nine OSCC cell lines examined. Kozaki et al.(16) investigated 14 human OSCC cell lines and only one cell line showed mutation of PTEN at exon 8 (1/14, 7.1%). We confirmed the existence of genomic DNA encoding PTEN in all cell lines and found a heterozygous mutation of PTEN at exon 1 with a 1023C>G transition in the KCC-T871 and YCU-M911 cell lines (2/16, 12.5%). KCC-T871 was the most sensitive to cetuximab; however, YCU-M911 was resistant. On the basis of these results, we concluded that PTEN is not a useful indicator of the efficacy of cetuximab. KCC-T871 was most sensitive to cetuximab and had simultaneous mutations in EGFR at exon 20, PIK3CA at exon 21 and PTEN at exon 1. These simultaneous mutations might correlate with the antiproliferative effect of cetuximab, but this mutation status was observed in only one cell line of the 16 HNSCC cell lines.

Because the antiproliferative effect of cetuximab in the MTT proliferation assay was not strong, we investigated cetuximab-mediated ADCC using HNSCC cell lines. Experimental evidence showing that IgG1 antibody contributes to the killing of cancer cells by activating CDC and/or the ADCC process is well established. These IgG1 monoclonal antibodies, as well as cetuximab, are able to induce ADCC through blockage of the human Fc receptor, that is, IgG1 antibody is able to bind the Fc receptors expressed by NK cells, monocytes and granulocytes.(7–10) In HNSCC, cetuximab-mediated ADCC has been reported in several studies.(23,24,36) In the present study, four cell lines were used: KCC-T873 (EGFR expression, high); YCU-OR891 (EGFR expression, moderate); YCU-T891 (EGFR expression, low); and YCU-MS861 (EGFR expression, low). Our data show that cetuximab-mediated ADCC seems to be influenced by the expression level of EGFR. Some researchers(10,36,37) have reported that the expression level of EGFR has an impact on cetuximab-mediated ADCC, similar to our data. Cetuximab-mediated ADCC seems to be an important part of antitumor mechanisms of cetuximab, and expression levels of EGFR might influence the antitumor activity of cetuximab. Therefore, it seems important to evaluate ADCC in addition to EGFR expression in tumor cells as part of the predictive factors of the clinical efficacy of cetuximab in HNSCC. In fact, it is reported that polymorphisms in FcRγIII correlate with cetuximab-mediated ADCC.(24,36) In addition to ADCC and CDC, other immunological mechanisms have been suggested to account for the effects of tumor-antigen-targeted monoclonal antibodies, for example, rituximab, trastuzumab and cetuximab.(38) Patients with advanced HNSCC have lower absolute lymphocyte counts,(39) downregulation of cytokine and chemokine serum levels,(40) and impaired NK cell activity against HNSCC cells.(41) The clinical efficacy of cetuximab might be improved by a strategy to regulate the immune system, because HNSCC patients, particularly those with advanced-stage disease, are likely to have an impaired ADCC response.

Acknowledgments

This work was supported by the Yokohama Foundation for Advancement of Medical Science (N.K.).

Disclosure Statement

The authors have no conflict of interest.

Ancillary