SEARCH

SEARCH BY CITATION

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Patients
  6. PBL isolation, activation and MACS
  7. Genomic DNA extraction and telomere length measurement
  8. Quantification of telomerase activity
  9. RNA extraction and quantification hTERT mRNA expression
  10. Statistical analyses
  11. Results
  12. Telomere length
  13. Telomerase activity
  14. hTERT mRNA expression
  15. Correlation between telomerase activity, hTERT expression and telomere length
  16. The effect of smoking on hTERT mRNA expression
  17. The effect of azathioprine on telomerase activity
  18. Disease duration, extent and activity
  19. Discussion
  20. Ethical considerations
  21. Acknowledgement
  22. References

Background : The chromosome instability observed in peripheral blood lymphocytes in ulcerative colitis could be a biomarker of cancer susceptibility.

Aim : To determine whether accelerated telomere shortening could explain chromosome instability and assess the effect of drugs and smoking on telomere dynamics in these cells.

Methods : Peripheral blood lymphocytes were isolated from ulcerative colitis, Crohn's disease and non-inflammatory bowel disease control patients. Telomere lengths were measured by quantitative real-time polymerase chain reaction. After activation and cell separation, telomerase activity and human telomerase reverse transcriptase messenger ribonucleic acid were measured by telomerase repeat amplification protocol enzyme-linked immunosorbent serological assay and quantitative real-time polymerase chain reaction, respectively.

Results : Age-related telomere loss in peripheral blood lymphocytes was similar in ulcerative colitis, Crohn's disease and control patients. Telomerase activity decreased with age in all groups and correlated positively with telomere length (r = 0.489, P =0.006). Among Crohn's disease patients, azathioprine was associated with decreased telomerase activity (0.66 vs. 1.54, P = 0.026, P < 0.05) and smoking was associated with decreased human telomerase reverse transcriptase mRNA expression (10.5 vs. 33.3, P =0.036, P < 0.05).

Conclusions : Telomere shortening is not accelerated and therefore cannot be the cause of the chromosome instability observed in ulcerative colitis peripheral blood lymphocytes. Azathioprine and cigarette smoking modify telomerase expression in these cells.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Patients
  6. PBL isolation, activation and MACS
  7. Genomic DNA extraction and telomere length measurement
  8. Quantification of telomerase activity
  9. RNA extraction and quantification hTERT mRNA expression
  10. Statistical analyses
  11. Results
  12. Telomere length
  13. Telomerase activity
  14. hTERT mRNA expression
  15. Correlation between telomerase activity, hTERT expression and telomere length
  16. The effect of smoking on hTERT mRNA expression
  17. The effect of azathioprine on telomerase activity
  18. Disease duration, extent and activity
  19. Discussion
  20. Ethical considerations
  21. Acknowledgement
  22. References

The inflammatory bowel diseases (IBD), ulcerative colitis (UC) and Crohn's disease (CD) are characterized by loss of intestinal epithelial barrier function and exaggerated and inappropriate immune activity.1 UC, in particular, is associated with an increased risk for colorectal cancer that is directly related to both the duration and extent of the disease.2, 3 It has been proposed that this risk is caused by increased chromosome instability including more frequent chromosome rearrangements, telomere fusions and other genetic changes, which facilitate multistep carcinogenesis.4 The link between CD and colon cancer is less well-defined, although the risk for the development of either large or small bowel carcinoma may be increased in long-term sufferers.5, 6

One possible cause of chromosome instability is telomere shortening. Telomeres are specialized structures that protect the ends of chromosomes. They shorten with each cell division and as a result of cellular stress.7–10 When a critical length is reached, cell division ceases and the cells undergo either senescence or apoptosis.11 If these two processes are bypassed and the cell continues to divide, the exposed chromosome ends are susceptible to fusion, chromatin bridge formation and the rearrangement of genetic material.12 This process is likely to be particularly relevant to IBD, because of the increased replicative and oxidative challenges placed on cells by inflammation. Indeed, short telomeres and increased chromosomal instability have been observed in colon epithelial cells from UC patients showing signs of progressing to colon cancer.13

Higher frequencies of chromosomal rearrangements and telomere fusions have also been observed in peripheral blood lymphocytes (PBLs) in UC.14 This may indicate a global predisposition towards genomic instability in IBD, which could represent a biomarker for increased cancer risk, as has been observed in several other malignant and premalignant diseases,15–20 including colon cancer21 and celiac disease.22 Alternatively, this chromosome instability could be caused by environmental factors including those related to inflammation. Accelerated telomere shortening could be one such factor, and this possibility has not so far been explored in IBD PBLs. Telomere shortening is accelerated in PBLs in inflammatory diseases such as rheumatoid arthritis,23, 24 lupus erythematosus,25 psoriasis26, 27 and atopic dermatitis,26 some of which are also associated with chromosome instability.28–31

Drugs used for the treatment of IBD suppress inflammation in the bowel. Furthermore, steroids and azathioprine have extra-colonic immune-modulatory activity mediated through PBLs.32 It would be of interest to determine if these drugs affect telomerase activity (TA), human telomerase reverse transcriptase (hTERT) mRNA expression and telomere length (TL) in PBLs from IBD patients. Smoking also has a profound effect on the natural history of IBD: protecting against UC and making CD less responsive to treatment.33, 34 There is little data on the effect of smoking on telomere dynamics in PBLs in IBD.

Accelerated telomere shortening could also be caused by a defect in the activity of telomerase. This enzyme adds on telomeric repeats to the existing chromosome ends and therefore maintains telomeres.8, 12, 35 Telomerase consists of two essential components: hTR (the telomerase RNA and template for the telomeric repeats) and hTERT (the reverse transcriptase subunit), and several non-essential proteins of unknown function. The hTR is ubiquitously expressed, but hTERT is often absent from tissues lacking TA.35 The transcription and alternative splicing of hTERT mRNA are believed to be the main telomerase regulatory factors,36 but the enzyme can also be regulated by post-translational mechanisms.37, 38 Telomerase is expressed in germ cells, cancer cells and highly replicative tissues including colon epithelial cells.12, 35 It is also expressed in lymphocytes, but only when they are activated and stimulated to divide.39 In both colon cells and activated lymphocytes, telomerase is not expressed at sufficient levels to prevent telomere shortening,39 but altered activity may modify the rate of telomere loss with age. TA is decreased in the colonic mucosa in UC40 and the telomerase knockout mouse suffers colitis-like ulcers of the bowel.41, 42 These observations suggest some involvement of telomeres and telomerase in the pathogenesis of IBD.

The aim of this study is to investigate whether accelerated telomere shortening could be the cause of the chromosome instability observed in UC PBLs, and thus help us determine whether this instability is genetically or environmentally determined. We measured TLs in PBLs from UC, CD and non-IBD control patients of various ages and determined whether the rate of telomere loss per year was increased in IBD. Finding no difference in the rates of telomere shortening in our three patient groups, we then assessed TA and hTERT mRNA expression in the same cells to see if we could explain our observations. Since telomerase is only expressed in activated lymphocytes, the PBLs were stimulated in vitro and activated cells separated, before the measurements were performed. We have also investigated the effect of drug and smoking history, disease duration, location and activity on TL, TA and hTERT mRNA expression.

Patients

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Patients
  6. PBL isolation, activation and MACS
  7. Genomic DNA extraction and telomere length measurement
  8. Quantification of telomerase activity
  9. RNA extraction and quantification hTERT mRNA expression
  10. Statistical analyses
  11. Results
  12. Telomere length
  13. Telomerase activity
  14. hTERT mRNA expression
  15. Correlation between telomerase activity, hTERT expression and telomere length
  16. The effect of smoking on hTERT mRNA expression
  17. The effect of azathioprine on telomerase activity
  18. Disease duration, extent and activity
  19. Discussion
  20. Ethical considerations
  21. Acknowledgement
  22. References

Blood samples were collected from 19 UC and 17 CD consecutive patients attending an IBD clinic (see Table 1). As we primarily intended to investigate the relationship between TL and patient age and how this relationship was affected by IBD, we did not attempt to match the mean ages of our patient groups. The diagnosis of IBD was established by traditional techniques of endoscopy, radiology and histology. Disease activity for UC and CD was assessed with the St Marks Score (SMS) and the Harvey-Bradshaw Index (HBI)43 respectively. Disease extent, age at diagnosis, drug and smoking history were ascertained by direct questioning and review of patient records. Smokers were patients who smoked five or more cigarettes daily. Azathioprine-takers were those taking the drug at the time of blood sampling and none had taken the drug for <6 months. Patients on steroids were being treated for an acute exacerbation of their disease and those receiving 5-aminosalicylate (5-ASA) drugs were taking it on a maintenance basis.

Table 1.  Patient characteristics
ParametersPatient group
NUCCD
  1. SMS, St Marks Score; HBI, Harvey-Bradshaw Index; UC, ulcerative colitis; CD, Crohn's disease.

Number of patients in group181917
Mean age (years)564548
Sex
 Males1114 8
 Females75 9
Smoking status
 Smokers22 7
 Non-smokers151710
Drug history
 No medication184 3
 ASA015 9
 Steroids05 2
 Azathioprine02 9
Mean inflammatory score (SMS/HBI)  2 (range 0–6) 4 (range 0–11)
Mean disease duration (years) 1012
Disease location UC
 Pancolitis 8 
 Left-sided 11 
Disease location CD   
 Ileocolonic   5
 Small bowel only   4
 Colon only   8

Blood was also sampled from 18 non-IBD controls with a normal colonoscopy. In most cases, their final diagnosis was irritable bowel syndrome. Drug and smoking history was also ascertained in this group.

We knew from previous experiments on colonic mucosa in UC that differences in telomerase expression could be detected in 10 paired samples. We therefore set a minimum sample size of 10 for each group in this study.

PBL isolation, activation and MACS

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Patients
  6. PBL isolation, activation and MACS
  7. Genomic DNA extraction and telomere length measurement
  8. Quantification of telomerase activity
  9. RNA extraction and quantification hTERT mRNA expression
  10. Statistical analyses
  11. Results
  12. Telomere length
  13. Telomerase activity
  14. hTERT mRNA expression
  15. Correlation between telomerase activity, hTERT expression and telomere length
  16. The effect of smoking on hTERT mRNA expression
  17. The effect of azathioprine on telomerase activity
  18. Disease duration, extent and activity
  19. Discussion
  20. Ethical considerations
  21. Acknowledgement
  22. References

Peripheral blood lymphocytes (PBLs) were isolated from 20 mL of whole blood using Ficoll-Hypaque density-gradient centrifugation, according to the manufacturer's protocol (Lymphoprep; Nycomed Pharma AS, Oslo, Norway). The cells were re-suspended in RPMI 1640 medium (Gibco-Invitrogen, Paisley, UK) supplemented with 10% foetal calf serum, 2 mml-glutamine, 100 units/mL penicillin and 100 μg/mL streptomycin and counted using Trypan blue exclusion staining.44 For each subject, 3 × 106 cells were activated in complete medium containing 5 μg/mL of phytohaemagglutinin (PHA; Sigma-Aldrich Co., Poole, UK) for 72 h at 37 °C, and the remainder were pelleted and stored at −20 °C for DNA extraction and TL measurement. Activated lymphocytes were isolated from the cultures using magnetic-activated cell sorting (MACS) with CD25 microbeads and miniMACS columns (Miltenyi Biotec, Bisley, UK), according to the manufacturers instructions. Cells in the resulting positive (CD25+) fraction were counted using Trypan blue exclusion staining,44 pelleted and stored in separate aliquots for estimation of TA and quantification of hTERT expression.

Genomic DNA extraction and telomere length measurement

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Patients
  6. PBL isolation, activation and MACS
  7. Genomic DNA extraction and telomere length measurement
  8. Quantification of telomerase activity
  9. RNA extraction and quantification hTERT mRNA expression
  10. Statistical analyses
  11. Results
  12. Telomere length
  13. Telomerase activity
  14. hTERT mRNA expression
  15. Correlation between telomerase activity, hTERT expression and telomere length
  16. The effect of smoking on hTERT mRNA expression
  17. The effect of azathioprine on telomerase activity
  18. Disease duration, extent and activity
  19. Discussion
  20. Ethical considerations
  21. Acknowledgement
  22. References

Genomic DNA was prepared from resting lymphocyte pellets using the Puregene DNA Isolation Kit (Gentra Systems, Minneapolis, MN, USA). After extraction, DNA was rehydrated overnight at room temperature, quantified by absorbance spectrophotometry at a wavelength of 260 nm and stored at 4 °C.

Telomere lengths were measured using a quantitative polymerase chain reaction (PCR) method developed by Cawthon45 and modified by Martin-Ruiz et al.46 Further modifications to this protocol were as follows: telomere PCRs included 450 nm primer Tel1b (5′ CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT 3′), 450 nm primer Tel2b (5′ GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT 3′), 10 ng genomic DNA, 0.1X SYBR green (Sigma-Aldrich Co.) and 1X Platinum Quantitative PCR Supermix-UDG (Invitrogen Ltd, Paisley, UK) in a 30 μL reaction. The reactions were set up in quadruplicate in 96-well plates. Each plate included four DNA quantity standards, one negative control and three TL standards, also assayed in quadruplicate. The DNA quantity standards were serial dilutions of a reference DNA sample giving final DNA quantities of between 15 and 1.87 ng per 30 μL reaction. The negative control contained water instead of genomic DNA and the three TL standards included 15 ng of genomic DNA from Human Brain (TL 5500 bp), hTERT-transfected BJ fibroblasts (TL 8000 bp) and SH-SY5Y neuroblastoma cells (TL 3000 bp). Both sets of standards were used to construct standard curves, one for the conversion of threshold cycle number to starting quantity (SQ) of DNA and one for the conversion of the telomere/single copy gene SQ ratio45, 46 to TL in bp. The PCR cycle conditions included an initial denaturation step at 95 °C for 3 min, followed by 40 cycles of 95 °C for 15 s and 56 °C for 60 s. Following amplification, a dissociation curve was performed in order to confirm the specificity of the reaction. This consisted of 46 repeats of increasing temperature, starting at 50 °C and rising by 1 °C every 10 s. PCRs and dissociation curves were performed on the iCycler real-time PCR system (Bio-Rad Laboratories, Hercules, CA, USA).

Quantification of telomerase activity

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Patients
  6. PBL isolation, activation and MACS
  7. Genomic DNA extraction and telomere length measurement
  8. Quantification of telomerase activity
  9. RNA extraction and quantification hTERT mRNA expression
  10. Statistical analyses
  11. Results
  12. Telomere length
  13. Telomerase activity
  14. hTERT mRNA expression
  15. Correlation between telomerase activity, hTERT expression and telomere length
  16. The effect of smoking on hTERT mRNA expression
  17. The effect of azathioprine on telomerase activity
  18. Disease duration, extent and activity
  19. Discussion
  20. Ethical considerations
  21. Acknowledgement
  22. References

Telomerase activity was quantified using the telomerase PCR enzyme-linked immunosorbent serological assay (ELISA) kit (Roche Diagnostics, Lewes, UK) according to the manufacturer's instructions. Pellets of 2 × 105 cells, frozen after MACS, were resuspended in 250 μL lysis buffer. Preliminary experiments revealed that the linear range of the assay was between 0 and 1000 cells for activated lymphocytes, using a telomerase extension time of 10 mins at 25 °C. Therefore, a volume of lysate equivalent to 800 cells (1 μL) was assayed for each sample. All samples were assayed on a single 96-well plate to eliminate interassay variation and a positive control lysate (included in the kit) was assayed three times in different areas of the plate to check for intra-assay variation. Other controls included were three blanks (lysis buffer added to the PCR mix instead of lysate) and a specificity negative control for each sample (lysates heated for 20 min at 65 °C to inactivate the enzyme).

RNA extraction and quantification hTERT mRNA expression

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Patients
  6. PBL isolation, activation and MACS
  7. Genomic DNA extraction and telomere length measurement
  8. Quantification of telomerase activity
  9. RNA extraction and quantification hTERT mRNA expression
  10. Statistical analyses
  11. Results
  12. Telomere length
  13. Telomerase activity
  14. hTERT mRNA expression
  15. Correlation between telomerase activity, hTERT expression and telomere length
  16. The effect of smoking on hTERT mRNA expression
  17. The effect of azathioprine on telomerase activity
  18. Disease duration, extent and activity
  19. Discussion
  20. Ethical considerations
  21. Acknowledgement
  22. References

Pellets of activated lymphocytes obtained from MACS were thawed on ice and RNA was extracted using the SV Total RNA Isolation System (Promega Ltd, Southampton, UK). Quantification of hTERT mRNA expression was achieved using a real-time PCR technique (TeloTAGGG hTERT Quantification Kit; Roche Diagnostics) and the Roche Lightcycler quantitative PCR machine, according to the manufacturer's instructions.

Statistical analyses

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Patients
  6. PBL isolation, activation and MACS
  7. Genomic DNA extraction and telomere length measurement
  8. Quantification of telomerase activity
  9. RNA extraction and quantification hTERT mRNA expression
  10. Statistical analyses
  11. Results
  12. Telomere length
  13. Telomerase activity
  14. hTERT mRNA expression
  15. Correlation between telomerase activity, hTERT expression and telomere length
  16. The effect of smoking on hTERT mRNA expression
  17. The effect of azathioprine on telomerase activity
  18. Disease duration, extent and activity
  19. Discussion
  20. Ethical considerations
  21. Acknowledgement
  22. References

Linear regressions, graphical functions and between group comparisons were performed using PRISM Graphpad. Pearson's correlation matrices were generated using spss for windows. Between group comparisons were performed using one-way anova (first P-value) followed by Bonferronis multiple comparisons test when a significant difference was found (second P-value where two are given). For the data presented in Figures 4 and 5, only groups consisting of more than two data points were included in the analysis. When unequal standard deviations or non-Gaussian distributions were detected during anova, an equivalent non-parametric test (Kruskall–Wallis test followed by Dunn's multiple comparison test) was also performed, but this did not alter the statistical outcomes at any point. Adjustments for age were performed by calculating the residuals of the UC and CD values with respect to the control regression line and adding an arbitrary value to remove negative integers. Age-adjusted TL values were also divided by 1000 since they no longer represented length in base pairs.

image

Figure 4. The effect of cigarette smoking on human telomerase reverse transcriptase (hTERT) mRNA expression in inflammatory bowel disease (IBD) lymphocytes. The average hTERT mRNA expression levels for smokers (black bars) and non-smokers (white bars) in the control (N), ulcerative colitis (UC) and Crohn's disease (CD) groups are shown. Error bars represent the standard error of the mean. Blocks without error bars represent a single patient and thus mean values and SEM were not calculated. The significant differences between smokers and non-smokers within the CD group and between control and CD non-smokers are indicated by asterisks and hashes respectively. Groups including >2 data points were compared using anova (P = 0.036) followed by Bonferronis post hoc test (P < 0.05 for both * and #). Control group: smokers, n = 1; non-smokers, n = 14. UC group: smokers, n = 1; non-smokers, n = 14. CD group: smokers, n = 6; non-smokers, n = 8.

Download figure to PowerPoint

image

Figure 5. The effect of azathioprine on telomerase activity in inflammatory bowel disease (IBD) lymphocytes. The average telomerase activity (age-adjusted) for patients taking the drug azathioprine (aza, black bars) and patients not taking it (white bars) in the non-IBD control (N), ulcerative colitis (UC) and Crohn's disease (CD) patient groups are shown. Error bars represent the standard error of the mean. The significant difference between aza-takers and non-takers in the CD group is indicated with an asterisk. Groups including >2 data points were compared by anova (P = 0.026) followed by Bonferronis post hoc test (P < 0.05 for *). There were no patients taking azathioprine in the control group, since the drug is an IBD treatment; control aza non-takers, n = 12. UC group: aza-takers, n = 2; non-takers, n = 10. CD group: aza-takers, n = 7; non-takers, n = 5.

Download figure to PowerPoint

Telomere length

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Patients
  6. PBL isolation, activation and MACS
  7. Genomic DNA extraction and telomere length measurement
  8. Quantification of telomerase activity
  9. RNA extraction and quantification hTERT mRNA expression
  10. Statistical analyses
  11. Results
  12. Telomere length
  13. Telomerase activity
  14. hTERT mRNA expression
  15. Correlation between telomerase activity, hTERT expression and telomere length
  16. The effect of smoking on hTERT mRNA expression
  17. The effect of azathioprine on telomerase activity
  18. Disease duration, extent and activity
  19. Discussion
  20. Ethical considerations
  21. Acknowledgement
  22. References

We measured TLs in ex vivo PBLs after isolation by density-gradient centrifugation. Data was obtained for 15 subjects in the control and CD groups and 19 patients from the UC group. Regression analysis, considering the patients as a single group, shows a significant dependency of TL on donor age, with a decrease 32.7 bp per year (r2 = 0.244, P = 0.0004, Figure 1a). There were no significant differences in the slopes or intercepts of the regression lines between the control, UC or CD groups (Figure la), and no significant differences between the groups, after adjusting for age (2.0 vs. 1.8 vs. 1.9, P = 0.759, Figure 1b).

image

Figure 1. Telomere length in resting peripheral blood lymphocytes. Panel (a): linear regression analysis of telomere length vs. donor age for the control (solid line), ulcerative colitis (UC; long dotted line) and Crohn's disease (CD; short dotted line) patient groups. Panel (b): age-adjusted mean telomere length (dotted lines), S.E.M. (solid error bars), and data points for the control (N), UC and CD patient groups. Control values are shown as solid squares, UC values as open triangles and CD values as open circles. There are no significant differences in the slopes of the regression lines or the mean telomere lengths between the inflammatory bowel disease (IBD) patients and controls, but overall there is a statistically significant linear decrease in telomere length as patient age increases (r2 = 0.244, P = 0.0004). AU, arbitrary units.

Download figure to PowerPoint

Telomerase activity

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Patients
  6. PBL isolation, activation and MACS
  7. Genomic DNA extraction and telomere length measurement
  8. Quantification of telomerase activity
  9. RNA extraction and quantification hTERT mRNA expression
  10. Statistical analyses
  11. Results
  12. Telomere length
  13. Telomerase activity
  14. hTERT mRNA expression
  15. Correlation between telomerase activity, hTERT expression and telomere length
  16. The effect of smoking on hTERT mRNA expression
  17. The effect of azathioprine on telomerase activity
  18. Disease duration, extent and activity
  19. Discussion
  20. Ethical considerations
  21. Acknowledgement
  22. References

Telomerase activity was quantified in 12 samples from each patient group, after density centrifugation, in vivo activation and MACS separation. The results are shown in Figure 2. When the subjects were considered as a single group, TA decreased significantly as donor age increased (r2 = 0.32, P = 0.0003, Figure 2a). There were no significant differences between the slopes of the regression lines for the control, UC and CD groups, indicating that the rate of decrease of TA with age is not altered in IBD. We also compared mean TA between the three groups (after adjusting for age) and found no significant difference (Figure 2b).

image

Figure 2. Telomerase activity in activated peripheral blood lymphocytes. Panel (a): linear regression of telomerase activity vs. donor age for the control (solid line), ulcerative colitis (UC; long dotted line) and Crohn's disease (CD; short dotted line) patient groups. Panel (b): age-adjusted mean telomerase activity (dotted line), S.E.M. (solid error bars), and data points for the control (N), UC and CD patient groups. Control values are shown as solid squares, UC values as open triangles and CD values as open circles. There are no significant differences in the slopes of the regression lines or the mean telomere lengths between the inflammatory bowel disease (IBD) patients and controls, but overall there is a statistically significant linear decrease in telomerase activity with increasing patient age (r2 = 0.32, P = 0.0003).

Download figure to PowerPoint

hTERT mRNA expression

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Patients
  6. PBL isolation, activation and MACS
  7. Genomic DNA extraction and telomere length measurement
  8. Quantification of telomerase activity
  9. RNA extraction and quantification hTERT mRNA expression
  10. Statistical analyses
  11. Results
  12. Telomere length
  13. Telomerase activity
  14. hTERT mRNA expression
  15. Correlation between telomerase activity, hTERT expression and telomere length
  16. The effect of smoking on hTERT mRNA expression
  17. The effect of azathioprine on telomerase activity
  18. Disease duration, extent and activity
  19. Discussion
  20. Ethical considerations
  21. Acknowledgement
  22. References

In vitro activated lymphocyte samples from 15 control, 15 UC and 14 CD patients were able to be analysed for hTERT mRNA expression. Regression analysis revealed a slight decrease in hTERT mRNA with increasing donor age, but this relationship was not statistically significant (r2 = 0.05, P = 0.139, Figure 3a). There were no significant differences between the slopes of the regression lines for the control, UC and CD groups. There was a trend towards increased mean hTERT expression in both the UC and CD groups when compared with controls (25.6 and 25.5 vs. 17.0, P = 0.326, Figure 3c).

image

Figure 3. Human telomerase reverse transcriptase (hTERT) mRNA expression levels in activated peripheral blood lymphocytes. Panel (a): linear regression analysis of hTERT mRNA expression level vs. donor age for the control, ulcerative colitis (UC) and Crohn's disease (CD) patient groups. Panel (b): mean hTERT expression level (dotted lines), S.E.M. (solid error bars), and data points for the control (N), UC and CD patient groups. Control values are shown as solid squares, UC values as open triangles and CD values as open circles. There are no significant differences in the mean hTERT level between any of the patient groups and no significant linear relationship between hTERT level and patient age, either overall (r2 = 0.05, P = 0.139) or in the patient groups.

Download figure to PowerPoint

Correlation between telomerase activity, hTERT expression and telomere length

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Patients
  6. PBL isolation, activation and MACS
  7. Genomic DNA extraction and telomere length measurement
  8. Quantification of telomerase activity
  9. RNA extraction and quantification hTERT mRNA expression
  10. Statistical analyses
  11. Results
  12. Telomere length
  13. Telomerase activity
  14. hTERT mRNA expression
  15. Correlation between telomerase activity, hTERT expression and telomere length
  16. The effect of smoking on hTERT mRNA expression
  17. The effect of azathioprine on telomerase activity
  18. Disease duration, extent and activity
  19. Discussion
  20. Ethical considerations
  21. Acknowledgement
  22. References

In order to investigate the relationships between lymphocyte TL, TA and hTERT mRNA expression in more detail, we carried out a correlation analysis of our data (see Table 2). As we observed no significant differences in the linear regression analysis between the control, UC and CD groups, we performed correlations on the data as a single group. There was a positive correlation between TL and TA (r = 0.489, P = 0.006). However TA did not significantly correlate with hTERT mRNA expression level (r = 0.137, P = 0.432), reinforcing the suggestion that TA is not transcriptionally regulated in activated lymphocytes. hTERT mRNA expression also did not significantly correlate with TL.

Table 2.  Pearson correlation matrix for donor age, TA, hTERT mRNA expression level and TL
 AgeTAhTERTTL
  1. Coefficients indicating significant correlations are highlighted in bold.

  2. hTERT, human telomerase reverse transcriptase; TA, telomerase activity; TL, telomere length.

Age1.0000.565−0.2270.494
TA 1.0000.1370.489
hTERT  1.000−0.063
TL   1.000

The effect of smoking on hTERT mRNA expression

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Patients
  6. PBL isolation, activation and MACS
  7. Genomic DNA extraction and telomere length measurement
  8. Quantification of telomerase activity
  9. RNA extraction and quantification hTERT mRNA expression
  10. Statistical analyses
  11. Results
  12. Telomere length
  13. Telomerase activity
  14. hTERT mRNA expression
  15. Correlation between telomerase activity, hTERT expression and telomere length
  16. The effect of smoking on hTERT mRNA expression
  17. The effect of azathioprine on telomerase activity
  18. Disease duration, extent and activity
  19. Discussion
  20. Ethical considerations
  21. Acknowledgement
  22. References

Among CD patients, those who smoked (six of 14) had significantly lower levels of hTERT than non-smokers (n = 8) in this group (10.5 vs. 33.3, P = 0.036, P < 0.05, see Figure 4). It is possible that this effect may extend to the control and UC groups, since in both groups the single patient who smoked had lower hTERT mRNA levels than the average for the non-smokers. We also found that CD non-smokers had significantly higher hTERT mRNA levels than control non-smokers (33.3 vs. 16.2, P = 0.036, P < 0.05, see Figure 4), a difference that was not observed in our original analysis including all patients (Figure 3b). There were no differences in hTERT mRNA levels between UC and control non-smokers or between UC and CD non-smokers. Smoking had no detectable effect on TA or TL in the groups studied.

The effect of azathioprine on telomerase activity

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Patients
  6. PBL isolation, activation and MACS
  7. Genomic DNA extraction and telomere length measurement
  8. Quantification of telomerase activity
  9. RNA extraction and quantification hTERT mRNA expression
  10. Statistical analyses
  11. Results
  12. Telomere length
  13. Telomerase activity
  14. hTERT mRNA expression
  15. Correlation between telomerase activity, hTERT expression and telomere length
  16. The effect of smoking on hTERT mRNA expression
  17. The effect of azathioprine on telomerase activity
  18. Disease duration, extent and activity
  19. Discussion
  20. Ethical considerations
  21. Acknowledgement
  22. References

Among CD patients, those taking azathioprine (n = 7 of 12) had significantly decreased TA, after adjusting for age, compared with those not taking it (0.66 vs. 1.54, P = 0.026, P < 0.05, see Figure 5). There were only two azathioprine-takers in the UC group and none in the controls, so these groups was not included in the statistical analysis. We then investigated the effect of excluding azathioprine-takers on the result presented in Figure 2b. We found trend towards higher TA in both UC and CD non-azathioprine-takers vs. controls, but neither of these was individually statistically significant (1.40 and 1.54 vs. 1.0, P = 0.026, P > 0.05). Azathioprine had no detectable effect on hTERT mRNA levels or TL and excluding patients taking the drug had no effects on the previous analysis for these parameters. We observed no effects of any other drug (including 5-ASA and steroids) on any of the variables we measured.

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Patients
  6. PBL isolation, activation and MACS
  7. Genomic DNA extraction and telomere length measurement
  8. Quantification of telomerase activity
  9. RNA extraction and quantification hTERT mRNA expression
  10. Statistical analyses
  11. Results
  12. Telomere length
  13. Telomerase activity
  14. hTERT mRNA expression
  15. Correlation between telomerase activity, hTERT expression and telomere length
  16. The effect of smoking on hTERT mRNA expression
  17. The effect of azathioprine on telomerase activity
  18. Disease duration, extent and activity
  19. Discussion
  20. Ethical considerations
  21. Acknowledgement
  22. References

Ulcerative colitis is characterized by an increased risk for colorectal cancer, which may be linked to global genomic instability. Chromosome aberrations and telomere fusions in PBLs have often been used as markers for genetic cancer risk and have been found at higher frequencies in UC.14–22 This is the first study to investigate whether chromosome instability in UC PBLs could be caused by accelerated telomere shortening induced by chronic inflammation. We also extended our investigations to look at CD. We were surprised to find no differences in the rate of telomere loss between UC and CD patients and controls.

The complexity of our experimental protocols including cell separation and DNA isolation from our patient samples increased the risk of experimental error. However, we believe that our TL results are robust since DNA is stable under the conditions used and the cells were not cultured before DNA extraction. Also the quantitative PCR technique used incorporates normalization to a housekeeping gene, which controls for any variations in cell numbers or DNA amounts added to the PCR. Furthermore, our results on lymphocytes compare well with previous experiments using this technique and another commonly used method: flow-fluorescence in situ hybridization (FISH). We observed a decrease in TL with increasing donor age of 32.7 bp/year in ex vivo peripheral blood mononuclear cells. This is in good agreement with similar studies on leucocytes, where telomere loss rates of 31–39 bp/year have been observed,47, 48 and on T cells where rates of 33 and 35 bp/year have been measured.49, 50

One possible explanation is that there is an increase in telomerase expression in IBD lymphocytes, which compensates for the increased turnover of the cells and allows telomere shortening rates to approximate those of unaffected cells. Increased levels of TA have previously been observed in peripheral lymphocytes in inflammatory diseases such as rheumatoid arthritis,51 psoriasis and atopic dermatitis.26, 52 This suggests that increased levels of lymphocyte TA could be generically linked with inflammation. We have investigated this hypothesis in our PBL samples, after in vitro activation and separation, but found little evidence for an increased capacity for telomerase activation in IBD, beyond some statistically non-significant trends. However, we have demonstrated that TA is decreased in PBLs from CD patients taking azathioprine. The biological significance of this observation is unclear. PBLs with decreased TA may have decreased replicative potential and this may be an additional mechanism of immunosuppression by azathioprine. Alternatively, decreased TA could be a consequence of reduced proliferative ability of PBLs resulting from the effect of the drug on nucleic acid biosynthesis.32 However, we found no evidence of shorter telomeres in azathioprine-takers. It may be that azathioprine has to be taken for a longer duration to produce a measurable effect on PBL TL. If the latter were the case, azathioprine could potentially encourage chromosomal instability adding to cancer susceptibility.53

It is likely, for several reasons, that our telomerase measurements were more affected by experimental variation during sample collection than our measurements of TL. For example, telomerase is an RNA-based enzyme that can lose activity during handling, and effects on its expression may vary between samples during culture and activation of lymphocytes. Also the used TRAP assay did not include normalization to an internal control. We were unable to quantify this potential variation, because of a scarcity of biological material, but we did undertake several measures in order to minimize it. First, all sample collection and processing was carried out using reliable non-varying protocols by a single operator, under appropriate conditions for maintaining TA. Secondly, isolation of activated lymphocytes by MACS, following culture and activation, controlled for variations in the response of cells to PHA. Thirdly, the amount of material added to the assay was controlled by cell number rather than protein content, to minimize variation introduced by changes in expression of proteins other than telomerase, and fourthly all samples were analysed in the same PCR plate to eliminate any interassay variation introduced by PCR efficiency. We demonstrated a linear decrease in TA with donor age in CD25+ lymphocytes that is concordant with recent studies in other leucocyte subsets,54–56 suggesting that our data is no more subject to the influence of experimental variation than other similar studies. However, there was no significant difference in this rate of decline in activated lymphocytes from UC or CD patients compared with controls.

In our study, activated lymphocyte hTERT mRNA expression level neither decreased with age nor correlated with TA, reinforcing the view that lymphocyte telomerase is regulated by mechanisms other than hTERT mRNA transcription.57–59 This observation holds true for UC and CD patients; there was no difference in hTERT mRNA levels between controls and the two IBD groups. We did find, however, that cigarette smoking was associated with lower hTERT mRNA expression in the CD group. This effect was not accompanied by an effect on TA, and although this casts doubt on its biological significance, it is consistent with the conclusion of this and other studies that lymphocyte telomerase is post-transcriptionally regulated.57–59 Smoking has been shown to be protective in UC, but to exacerbate CD.33, 34 Perhaps it causes a non-specific decrease in the expression of several genes, which then leads to suppression or exacerbation of the inflammatory response depending on the genetic background of the host, and changes in hTERT expression are epiphenomenal to this effect.

Measurements of mRNA expression are likely to be under a similar magnitude of influence by experimental variation as TA measurements, for similar reasons. Therefore, similar measures were taken to minimize this variation. In addition, the real-time PCR technique used, like the TL measurement, does have the advantage of including normalization to an internal control. As previously, our results on hTERT mRNA expression are concordant with other studies suggesting that experimental variation was not excessive in our case.

It is clear from our results that accelerated telomere shortening cannot be the cause for the increased chromosome instability observed in UC PBLs by Cottliar et al.14 Other causes could include telomere uncapping, i.e. a decrease in the expression of telomere stabilizing proteins such as TRF1, TRF2 (telomere repeat binding factors 1 and 2) and TIN2 (TRF1 interacting nuclear factor 2)60 and/or loss of checkpoint proteins which ensure correct DNA damage repair or chromosome segregation during the cell cycle.3, 4, 61 The latter cause could be coupled with telomere shortening to bring about the effects seen. Therefore, it is still possible that the increased risk of colorectal cancer in UC is caused by a global chromosome instability syndrome, although localized inflammation and accelerated telomere shortening in colonic epithelial cells is likely to play an important role. Azathioprine and cigarette smoking decrease TA and hTERT expression, respectively, in IBD PBLs. These effects merit further investigation.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Patients
  6. PBL isolation, activation and MACS
  7. Genomic DNA extraction and telomere length measurement
  8. Quantification of telomerase activity
  9. RNA extraction and quantification hTERT mRNA expression
  10. Statistical analyses
  11. Results
  12. Telomere length
  13. Telomerase activity
  14. hTERT mRNA expression
  15. Correlation between telomerase activity, hTERT expression and telomere length
  16. The effect of smoking on hTERT mRNA expression
  17. The effect of azathioprine on telomerase activity
  18. Disease duration, extent and activity
  19. Discussion
  20. Ethical considerations
  21. Acknowledgement
  22. References
  • 1
    Bouma G, Strober W. The immunological and genetic basis of inflammatory bowel disease. Nat Rev Immunol 2003; 3: 52133.
  • 2
    Ekbom A, Helmick C, Zack M, et al. Ulcerative colitis and colorectal cancer. A population-based study. N Engl J Med 1990; 323: 122833.
  • 3
    Wong NA, Harrison DJ. Colorectal neoplasia in ulcerative colitis-recent advances. Histopathology 2001; 39: 22134.
  • 4
    Loeb KR, Loeb LA. Genetic instability and the mutator phenotype. Studies in ulcerative colitis. Am J Pathol 1999; 154: 16216.
  • 5
    Judge TA, Lewis JD, Lichtenstein GR. Colonic dysplasia and cancer in inflammatory bowel disease. Gastrointest Endosc Clin N Am 2002; 12: 495523.
  • 6
    van Hogezand RA, Eichhorn RF, Choudry A, et al. Malignancies in inflammatory bowel disease: fact or fiction? Scand J Gastroenterol Suppl 2002; 236: 4853.
  • 7
    de Lange T. Protection of mammalian telomeres. Oncogene 2002; 21: 53240.
  • 8
    Greider CW. Telomere length regulation. Annu Rev Biochem 1996; 65: 33765.
  • 9
    McEachern MJ, Krauskopf A, Blackburn EH. Telomeres and their control. Annu Rev Genet 2000; 34: 33158.
  • 10
    von Zglinicki T. Oxidative stress shortens telomeres. Trends Biochem Sci 2002; 27: 33944.
  • 11
    Harley CB. Telomere loss: mitotic clock or genetic time bomb? Mutat Res 1991; 256: 27182.
  • 12
    Wong JM, Collins K. Telomere maintenance and disease. Lancet 2003; 362: 9838.
  • 13
    O'Sullivan JN, Bronner MP, Brentnall TA, et al. Chromosomal instability in ulcerative colitis is related to telomere shortening. Nat Genet 2002; 32: 2804.
  • 14
    Cottliar A, Fundia A, Boerr L, et al. High frequencies of telomeric associations, chromosome aberrations, and sister chromatid exchanges in ulcerative colitis. Am J Gastroenterol 2000; 95: 23017.
    Direct Link:
  • 15
    Heim S, Johansson B, Mertens F. Constitutional chromosome instability and cancer risk. Mutat Res 1989; 221: 3951.
  • 16
    Bonassi S, Abbondandolo A, Camurri L, et al. Are chromosome aberrations in circulating lymphocytes predictive of future cancer onset in humans? Preliminary results of an Italian cohort study. Cancer Genet Cytogenet 1995; 79: 1335.
  • 17
    Hagmar L, Bonassi S, Stromberg U, et al. Chromosomal aberrations in lymphocytes predict human cancer: a report from the European Study Group on Cytogenetic Biomarkers and Health (ESCH). Cancer Res 1998; 58: 411721.
  • 18
    Dhillon VS, Dhillon IK. Chromosome aberrations and sister chromatid exchange studies in patients with prostate cancer: possible evidence of chromosome instability. Cancer Genet Cytogenet 1998; 100: 1437.
  • 19
    Murty VV, Mitra AB, Luthra UK, et al. Sister chromatid exchanges in patients with precancerous and cancerous lesions of cervix uteri. Hum Genet 1986; 72: 3742.
  • 20
    Paz-y-Mino C, Sanchez ME, Del Pozo M, et al. Telomeric association in women with breast and uterine cervix cancer. Cancer Genet Cytogenet 1997; 98: 1158.
  • 21
    Richard F, Muleris M, Dutrillaux B. Chromosome instability in lymphocytes from patients affected by or genetically predisposed to colorectal cancer. Cancer Genet Cytogenet 1994; 73: 2332.
  • 22
    Fundia AF, Gonzalez Cid MB, Bai J, et al. Chromosome instability in lymphocytes from patients with celiac disease. Clin Genet 1994; 45: 5761.
  • 23
    Koetz K, Bryl E, Spickschen K, et al. T cell homeostasis in patients with rheumatoid arthritis. Proc Natl Acad Sci U S A 2000; 97: 92038.
  • 24
    Schonland SO, Lopez C, Widmann T, et al. Premature telomeric loss in rheumatoid arthritis is genetically determined and involves both myeloid and lymphoid cell lineages. Proc Natl Acad Sci U S A 2003; 100: 134716.
  • 25
    Honda M, Mengesha E, Albano S, et al. Telomere shortening and decreased replicative potential, contrasted by continued proliferation of telomerase-positive CD8+CD28(lo) T cells in patients with systemic lupus erythematosus. Clin Immunol 2001; 99: 21121.
  • 26
    Wu K, Higashi N, Hansen ER, et al. Telomerase activity is increased and telomere length shortened in T cells from blood of patients with atopic dermatitis and psoriasis. J Immunol 2000; 165: 47427.
  • 27
    Wu KD, Hansen ER. Shortened telomere length is demonstrated in T-cell subsets together with a pronounced increased telomerase activity in CD4 positive T cells from blood of patients with mycosis fungoides and parapsoriasis. Exp Dermatol 2001; 10: 32936.
  • 28
    Emerit I, Michelson AM. Chromosome instability in human and murine autoimmune disease: anticlastogenic effect of superoxide dismutase. Acta Physiol Scand Suppl 1980; 492: 5965.
  • 29
    Kinne RW, Liehr T, Beensen V, et al. Mosaic chromosomal aberrations in synovial fibroblasts of patients with rheumatoid arthritis, osteoarthritis, and other inflammatory joint diseases. Arthritis Res 2001; 3: 31930.
  • 30
    Tuschl H, Kovac R, Wolf A, et al. SCE frequencies in lymphocytes of systemic lupus erythematosus patients. Mutat Res 1984; 128: 16771.
  • 31
    Enerback C, Holmqvist D, Inerot A, et al. Cytogenetic analysis of 477 psoriatics revealed an increased frequency of aberrations involving chromosome region 11q. Eur J Hum Genet 1999; 7: 33944.
  • 32
    Nielsen OH, Vainer B, Rask-Madsen J. Review article: The treatment of inflammatory bowel disease with 6-mercaptopurine or azathioprine. Aliment Pharmacol Ther 2001; 15: 1699708.
  • 33
    Calkins BM. A meta-analysis of the role of smoking in inflammatory bowel disease. Dig Dis Sci 1989; 34: 184154.
  • 34
    Russel MG, Volovics A, Schoon EJ, et al. Inflammatory bowel disease: is there any relation between smoking status and disease presentation? European Collaborative IBD Study Group. Inflamm Bowel Dis 1998; 4: 1826.
  • 35
    Collins K, Mitchell JR. Telomerase in the human organism. Oncogene 2002; 21: 56479.
  • 36
    Ulaner GA, Hu JF, Vu TH, et al. Telomerase activity in human development is regulated by human telomerase reverse transcriptase (hTERT) transcription and by alternate splicing of hTERT transcripts. Cancer Res 1998; 58: 416872.
  • 37
    Aisner DL, Wright WE, Shay JW. Telomerase regulation: not just flipping the switch. Curr Opin Genet Dev 2002; 12: 805.
  • 38
    Wong JM, Kusdra L, Collins K. Subnuclear shuttling of human telomerase induced by transformation and DNA damage. Nat Cell Biol 2002; 4: 7316.
  • 39
    Hodes RJ, Hathcock KS, Weng NP. Telomeres in T and B cells. Nat Rev Immunol 2002; 2: 699706.
  • 40
    Usselmann B, Newbold M, Morris AG, et al. Deficiency of colonic telomerase in ulcerative colitis. Am J Gastroenterol 2001; 96: 110612.
    Direct Link:
  • 41
    Herrera E, Samper E, Martin-Caballero J, et al. Disease states associated with telomerase deficiency appear earlier in mice with short telomeres. EMBO J 1999; 18: 295060.
  • 42
    Lee HW, Blasco MA, Gottlieb GJ, et al. Essential role of mouse telomerase in highly proliferative organs. Nature 1998; 392: 56974.
  • 43
    Harvey RF, Bradshaw JM. A simple index of Crohn's disease activity. Lancet 1980; 1: 514.
  • 44
    Freshney R. Culture of Animal Cells: A Manual of Basic Technique. New York, USA: AR Liss, 1987.
  • 45
    Cawthon RM. Telomere measurement by quantitative PCR. Nucleic Acids Res 2002; 30: e47.
  • 46
    Martin-Ruiz C, Saretzki G, Petrie J, et al. Stochastic variation in telomere shortening rate causes heterogeneity of human fibroblast replicative life span. J Biol Chem 2004; 279: 1782633.
  • 47
    Robertson JD, Gale RE, Wynn RF, et al. Dynamics of telomere shortening in neutrophils and T lymphocytes during ageing and the relationship to skewed X chromosome inactivation patterns. Br J Haematol 2000; 109: 2729.
  • 48
    Xiao L, Zhou H, Yan J, et al. Changes of telomere length in human nasopharyngeal carcinoma. Hua Xi Yi Ke Da Xue Xue Bao 1999; 30: 2624.
  • 49
    Martens UM, Brass V, Sedlacek L, et al. Telomere maintenance in human B lymphocytes. Br J Haematol 2002; 119: 8108.
  • 50
    Son NH, Murray S, Yanovski J, et al. Lineage-specific telomere shortening and unaltered capacity for telomerase expression in human T and B lymphocytes with age. J Immunol 2000; 165: 11916.
  • 51
    Yamanishi Y, Hiyama K, Ishioka S, et al. Telomerase activity in the synovial tissues of chronic inflammatory and non-inflammatory rheumatic diseases. Int J Mol Med 1999; 4: 5137.
  • 52
    Wu K, Volke A, Lund M, et al. Telomerase activity is spontaneously increased in lymphocytes from patients with atopic dermatitis and correlates with cellular proliferation. J Dermatol Sci 1999; 22: 2430.
  • 53
    Fraser AG, Orchard TR, Robinson EM, et al. Long-term risk of malignancy after treatment of inflammatory bowel disease with azathioprine. Aliment Pharmacol Ther 2002; 16: 122532.
  • 54
    Mariani E, Meneghetti A, Formentini I, et al. Different rates of telomere shortening and telomerase activity reduction in CD8 T and CD16 NK lymphocytes with ageing. Exp Gerontol 2003; 38: 6539.
  • 55
    Mariani E, Meneghetti A, Formentini I, et al. Telomere length and telomerase activity: effect of ageing on human NK cells. Mech Ageing Dev 2003; 124: 4038.
  • 56
    Fan XG, Huang Y, Tang FQ, et al. Telomerase activity of peripheral blood lymphocytes in patients with chronic hepatitis B. Immunol Lett 2000; 73: 711.
  • 57
    Liu K, Hodes RJ, Weng N. Cutting edge: telomerase activation in human T lymphocytes does not require increase in telomerase reverse transcriptase (hTERT) protein but is associated with hTERT phosphorylation and nuclear translocation. J Immunol 2001; 166: 482630.
  • 58
    Liu K, Schoonmaker MM, Levine BL, et al. Constitutive and regulated expression of telomerase reverse transcriptase (hTERT) in human lymphocytes. Proc Natl Acad Sci U S A 1999; 96: 514752.
  • 59
    Sheng WY, Chien YL, Wang TC. The dual role of protein kinase C in the regulation of telomerase activity in human lymphocytes. FEBS Lett 2003; 540: 915.
  • 60
    Proctor CJ, Kirkwood TB. Modelling cellular senescence as a result of telomere state. Aging Cell 2003; 2: 1517.
  • 61
    Stewart ZA, Pietenpol JA. Cell cycle checkpoints as therapeutic targets. J Mammary Gland Biol Neoplasia 1999; 4: 389400.