Nicotinic acetylcholine receptors on basophils and mast cells

Authors


P. S. Sudheer
E-mail: sudheerps@Cardiff.ac.uk

Summary

Anaphylaxis in response to drugs administered during anaesthesia is a rare but potentially catastrophic event. The anaesthetic drugs most commonly associated with anaphylaxis are neuromuscular blocking agents. As these drugs act on the nicotinic acetylcholine receptor of the neuromuscular junction, potentiation of anaphylaxis by a nicotinic receptor on basophils and mast cells is plausible. The aim of this study was to investigate whether nicotinic acetylcholine receptors are present on a human basophil and mast cell lines as their presence may suggest a mechanism of associated anaphylaxis. Nicotinic receptors were demonstrated on a basophil and a mast cell line using an α-bungarotoxin–fluorescein conjugate by flow cytometry and by both conventional and confocal microscopic techniques. The identity of this receptor was confirmed by reverse transcriptase PCR and quantitative PCR.

Anaphylaxis is an important peri-operative clinical problem. It is estimated that there are 500 cases of anaphylaxis secondary to anaesthetic drugs per year in the UK and the incidence may be increasing, although the true incidence has been difficult to determine due to poor case reporting and confusing terminology. Of the cases reported, 10% result in fatalities, with the remainder making major demands on NHS resources as patients need resuscitation and Intensive Care Support. This compares with a mortality of only 3.1% for anaphylaxis induced by other drugs [1].

French epidemiological studies demonstrate that the incidence of anaphylaxis specifically in response to neuromuscular blocking agents (NBAs) is much higher than with other drugs, with one study demonstrating an incidence of 1/6500 for NBAs and 1/13 000 overall for anaesthetic drugs [2]. In the same study, 62% of patients who had a clinical reaction to an anaesthetic drug subsequently presented a positive result to NBAs in clinical allergy testing. More recent major French surveys continue to support these figures [3].

Such adverse reactions may be classified as anaphylactic reactions, wherein the mechanism of action is thought to be due to an IgE-mediated response, or anaphylactoid reactions, where the reaction is due to an unknown mechanism with the possible involvement of complement and IgG along with other proteases released by mast cells and basophils. The distinction, however, is difficult to appreciate, as the clinical signs of anaphylactic and anaphylactoid reactions are indistinguishable and the assays used to measure the specific IgE for most of the drugs used in anaesthesia are not commercially available.

Muscarinic Acetylcholine (ACh) receptors have been characterised on human mast cells, the tissue-based mediators of immediate hypersensitivity [4–6] and nicotinic ACh receptors are also suspected to exist on these cells and on basophils, their humoral counterparts [7]. As neuromuscular blocking drugs used in anaesthesia act on the nicotinic receptors on the neuro-muscular junction, we considered the hypothesis that these drugs may also act on a nicotinic receptor on the cells involved in acute anaphylaxis; basophils and mast cells. The report of basophil degranulation induced by cigarette smoking perhaps lends some support to the hypothesis [8]. To our knowledge, there is no report suggesting human basophils and mast cells have nicotinic receptors. The aim of the following experiments was to look for an acetylcholine nicotinic receptor on the human basophil cell line, KU-812 and the human mast cell line, HMC-1.

Method

Materials

Nicotine, bungarotoxin-fluorescein isothiocyanate (FITC), RPMI and MG624 were purchased from Sigma (Manchester, UK). The human basophil cell line, KU812, the mast cell line, HMC-1 and the monocyte cell line, THP-1, were a kind gift from Dr Philippe Gasque of the Neuroinflammation Centre, Cardiff, UK. The monocyte cell line was chosen as a negative control not known to express nicotinic acetylcholine receptors.

Flow cytometry

Cells (mast cells, monocytes and basophils) were cultured in RPMI. This formulation is based on the RPMI-1630 series of media utilizing a bicarbonate buffering system and alterations in the amounts of amino acids and vitamins.

They were checked for viability using the Trypan blue exclusion test; cells were > 90% viable. Cells (106) were washed and fixed overnight in 1% formalin, and then washed and stained with α-bungarotoxin–FITC on ice. The monocyte cell line THP-1 was used as a control. For experiments demonstrating competitive binding, cells were incubated with nicotine and the specific nicotine antagonist MG624, before staining with three different concentrations of α-bungarotoxin–FITC (0.125, 0.25 and 0.5 mg.l−1). In a different set of experiments, KU-812 cells were pre-incubated with five different log concentrations of nicotine (500, 50, 5, 0.5 and 0.05 ng.l−1) before staining with α-bungarotoxin–FITC and compared with cells stained with α-bungarotoxin–FITC without the influence of nicotine. Samples were analysed on a DAKO-Partec Galaxy flow cytometer (Glostrup, Denmark).

Conventional and confocal microscopy

Cells (mast and basophils) were cultured in RPMI and 106 cells were washed and fixed overnight in 1% formalin. They were washed, then stained with α-bungarotoxin–FITC and slides prepared using the Cytospin system (ThermoShandon, Cheshire, UK). Cells were examined for α-bungarotoxin–FITC distribution, reflecting acetylcholine-receptor expression, using a Leica DMRB microscope (Wetzlar, Germany) equipped with a Hamamatsu colour chilled 3CCD camera system or the Leica TCS SP2 confocal system.

RT-PCR and quantitative PCR

RNA was extracted from the basophil cell line, KU812 and the mast cell line, HMC-1 using Trizol reagent (Invitrogen, Paisley, UK). The first step of the RT-PCR was carried out with the Cloned AMV First-Strand cDNA Synthesis kit (Invitrogen) applying random hexamers. PCR was performed using specific primers for acetylcholine nicotinic receptor (GCCCGTGGCCAATGACTCGCA, forward, and GGGCTATCAATGGTACCGAATC, reverse). Samples were subjected to PCR for glyceraldehyde-3-phosphate dehydrogenase (primer sequences) as the standardising control.

Quantitative PCR was performed using SYBR Green PCR Master Mix (Applied Biosystems, Forster City, USA) as previously described [9]. Reactions were run on the Taqman 7000 (Applied Biosystems) using the same primer pairs as for the conventional PCR. Gene expression levels were calculated using the comparative Ct method (ΔΔCt). ΔΔCt validation experiments showed similar amplification efficiency for all templates used (difference between line slopes for all templates less than 0.1). At least two independent experiments were performed for each gene.

Results

On flow cytometry, basophils (KU812) and mast cells (HMC-1) demonstrated significantly increased mean fluorescent intensity in FL1, in comparison with the monocyte line (THP-1), corresponding to increased binding of bungarotoxin–FITC, consistent with increased binding to a nicotinic acetylcholine receptor (Fig. 1).

Figure 1.

 Demonstrating the increased binding of bungarotoxin-FITC on the three different cell lines, THP-1 (monocyte cell line), KU-812 (basophil cell line), HMC-1 (mast cell line). Graph is mean fluorescent intensity against cell count for the respective cell lines.

In competitive binding experiments, using the basophil cell line KU812, nicotine at 500 ng.l−1 was able to decrease binding of α-bungarotoxin–FITC at 0.125, 0.25 and 0.5 mg.l−1 by 62%, 26% and 40%, respectively (Fig. 2). The differences in binding at α-bungarotoxin concentrations of 0.125 mg.l−1 and 0.5 mg.l−1 were statistically significant (p = 0.025 and 0.024, respectively).

Figure 2.

 Demonstrating a decrease in bungarotoxin binding to cell of the KU-812 (basophil) cell line in the presence of nicotine (500 ng.ml−1). MFI is mean fluorescent intensity of cells analyzed by flow cytometry.

When the KU812 cells were pre-incubated with the specific nicotine antagonist, MG624 at 0.5 mg.l−1, the mean fluorescent intensity of α-bungarotoxin–FITC at 0.125, 0.25 and 0.5 mg.l−1 was decreased by 16%, 43% and 12%, respectively (Fig. 3). The decrease in mean fluorescent intensity due to prior incubation with MG624 was significant at 0.25 mg.l−1 (p < 0.001). In addition, when different concentrations of nicotine (1–10 μg.l−1) were used for pre-incubation, progressive decreases of α-bungarotoxin–FITC (0.25 mg.l−1) binding were observed (Fig. 4).

Figure 3.

 Demonstrating decrease in bungarotoxin binding to cells of the KU-812 (basophil) cell line in the presence of the specific nicotine antagonist MG624 (50 μg.ml−1).

Figure 4.

 Graph demonstrating the decrease in binding of bungarotoxin in the presence of increasing concentrations of nicotine.

Conventional microscopy demonstrated surface binding of α-bungarotoxin–FITC on both the KU812 cells and the mast cell line HMC-1, and when pre-incubated with nicotine, the binding was greatly reduced (Fig. 5). Confocal microscopy also demonstrated surface binding of the α-bungarotoxin on the HMC-1 and KU812 cells (Fig. 6).

Figure 5.

 Conventional microscopy using a mercury light source and filter shows binding of α-bungarotoxin FITC (3 µg.ml−1) to basophils was largely blocked by preincubation with nicotine: a) KU-812 cells stained with α-bungarotoxin FITC (3 µg.ml−1) alone and b) with preincubation with nicotine at a final concentration of 500 ng.ml−1.

Figure 6.

 Confocal microscope images demonstrating α-bungarotoxin – FITC (3 µg.ml−1) binding to nicotinic receptors in clusters on a) basophil (KU-812) and b) a mast cell (HMC-1). Magnification ×200.

RT-PCR demonstrated 840 base pairs in both the cell lines, KU812 and HMC-1 (Fig. 7). This was confirmed by real time PCR, which suggested that the mast cell line had a three times greater expression of the nicotinic receptor in comparison with the basophil cell line.

Figure 7.

 Messenger RNA expression of nicotinic acetylcholine receptor α7 on basophils (KU812) and mast cells (HMC-1). a) RT-PCR analysis with a primer pair specific for the α7 subunit generated an 840 base pair α7 band for both cell lines, with GAPDH expression used as an internal control and b) Comparisons of nicotinic receptor expression in the two cell lines by quantitative PCR. Expression in the basophil cell line was arbitrarily taken as 100%. Data are presented as means (SE) for two independent RNA preparations, each of which was analyzed in triplicate. The mast cell lie expressed approximately 7 times as much mRNA for the receptor α7 chain than did the basophil cell line.

Discussion

Our work suggests that basophils and mast cells, as demonstrated by microscopy, flow cytometry and PCR techniques, possess nicotinic acetylcholine receptors. The main function of this family of receptors is to transmit signals for the neurotransmitter, acetylcholine, at neuromuscular junctions in the central and peripheral nervous system. Both depolarising and the non-depolarising muscle relaxants act on nicotinic acetylcholine receptors and this fact suggested the hypothesis for this experimental study.

It is known that central nervous system receptors can be found outside the nervous system and receptors for the neurotransmitter, acetylcholine, are found on several cell types outside the neuromuscular system. Richman and Arnason [10] showed evidence for a functionally distinct acetylcholine receptor on human lymphocytes and Wang et al. [11] demonstrated inhibition of release of tumour necrosis factor and other cytokines by α-bungarotoxin-sensitive nicotinic receptors on primary human macrophages. In addition, Kaliner et al. [6] showed that when human mast cells are activated, with anti-IgE, they produce histamine and slow-reacting substance of anaphylaxis (SRSA).

Basophils have been shown to have a number of receptors for low molecular weight transmitting substances such as β2 adrenergic substances, histamine and glucocorticoids. These receptors are believed to be inhibitory receptors as Thompson-Cree et al. [7] have demonstrated a decrease in IgE-mediated release of histamine by prior incubation of basophils with nicotine and a nicotine agonist, methyl-2-[3-pyridyl] pyrolidine.

Though the work done by Kaliner et al.[6] and Thompson-Cree et al.[7] might suggest a role for a nicotine receptor on basophils and mast cells, there is, as far as we know, no previous demonstration of such a receptor on human basophils and mast cells. Further work is underway to determine the function of these receptors on basophils and mast cells and their significance in potentiating the anaphylactic response to anaesthetic drugs.

Acknowledgements

This research was funded by the Association of Anaesthetists of Great Britain and Ireland and this paper has been presented in the free paper session at the AAGBI meeting in Cardiff 2004.

Ancillary