SEARCH

SEARCH BY CITATION

Keywords:

  • deletions;
  • horse;
  • male-to female XY sex reversal;
  • SRY;
  • Y chromosome

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflict of interest
  9. References

Male-to-female 64,XY sex reversal is a frequently reported chromosome abnormality in horses. Despite this, the molecular causes of the condition are as yet poorly understood. This is partially because only limited molecular information is available for the horse Y chromosome (ECAY). Here, we used the recently developed ECAY map and carried out the first comprehensive study of the Y chromosome in XY mares (n = 18). The integrity of the ECAY in XY females was studied by FISH and PCR using markers evenly distributed along the euchromatic region. The results showed that the XY sex reversal condition in horses has two molecularly distinct forms: (i) a Y-linked form that is characterized by Y chromosome deletions and (ii) a non-Y-linked form where the Y chromosome of affected females is molecularly the same as in normal males. Further analysis of the Y-linked form (13 cases) showed that the condition is molecularly heterogeneous: the smallest deletions spanned about 21 kb, while the largest involved the entire euchromatic region. Regardless of the size, all deletions included the SRY gene. We show that the deletions were likely caused by inter-chromatid recombination events between repeated sequences in ECAY. Further, we hypothesize that the occurrence of SRY-negative XY females in some species (horse, human) but not in others (pig, dog) is because of differences in the organization of the Y chromosome. Finally, in contrast to the Y-linked SRY-negative form of equine XY sex reversal, the molecular causes of SRY-positive XY mares (5 cases) remain as yet undefined.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflict of interest
  9. References

Male-to-female sex reversal in horses is a developmental disorder in which phenotypic females or female-like animals are genetically males with 64,XY karyotype. The condition has been found in several breeds (Kent et al. 1986, 1988b; Makinen et al. 1999; Bugno et al. 2003; Switonski et al. 2005), and after X chromosome monosomy, it is the most common sex chromosome abnormality in horses (Lear & Bailey 2008; Villagomez et al. 2009). The male-to-female sex reversal has been described in humans (known also as Swyer syndrome) (Michala et al. 2008), cattle, river buffalo, and sheep (Ferrer et al. 2009; Villagomez et al. 2009).

Phenotypes of the XY sex reversal horses can vary in a broad range, from a very feminine to a greatly masculinized mare (Kent et al. 1988b). The majority of ‘feminine’-type animals have normal female external and internal genitalia, and no somatic or behavioural abnormalities (Power 1986; Bowling et al. 1987). Primary cause of infertility of these mares is typically because of ovarian dysgenesis and underdeveloped uterus (Power 1986; Pailhoux et al. 1995; Makinen et al. 1999). The overall phenotype of the ‘feminine’-type XY mares is very similar to those of 64,XO females (Bowling et al. 1987).

Another less frequently observed phenotype shows various degrees of masculinization and virilization (Kent et al. 1986; Long 1988; Lear & Bailey 2008; Villagomez et al. 2009). The ‘masculine’-type XY mares usually have abnormally developed genital tract, and the gonads can range from ovotestes to testicular feminization (Kent et al. 1986; Bowling et al. 1987; Kent et al. 1988a; Howden 2004; Villagomez et al. 2009), leading to male pseudohermaphrodites. All XY female horses studied so far have been found to be infertile, except one that gave birth to a normal 64,XX filly (Sharp et al. 1980).

Most equine male-to-female sex reversal cases are sporadic, or have no supporting pedigree data. However, in some instances, familiar patterns of inheritance, particularly in certain Arabian sire lines, have been observed (Kieffer 1976; Kent et al. 1986; Bowling et al. 1987; Kent et al. 1988b).

Despite the relatively frequent occurrence of XY mares among animals with chromosome abnormalities, the molecular causes of the condition are poorly understood. One of the reasons is the very limited knowledge about the molecular organization of the horse Y chromosome. The only molecular test, initiated in 1995 (Pailhoux et al. 1995), is PCR with the Y-linked male sex-determining gene SRY. According to this, two molecularly distinct types of XY females have been identified. The most prevalent are mares with no SRY gene (Pailhoux et al. 1995; Abe et al. 1999; Makinen et al. 1999; Bugno et al. 2003). Another type, represented by a single case, is an SRY-positive mare (Switonski et al. 2005).

In this study, we carried out the first comprehensive molecular analysis of the Y chromosome in XY sex-reversed mares. This was performed by sequencing the bacterial artificial chromosome (BAC) clones containing the SRY-region (Raudsepp et al. 2004b; Raudsepp & Chowdhary 2008b; Paria 2009) and developing markers that precisely defined the deletion in sex-reversed individuals.

Materials and methods

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflict of interest
  9. References

Animals

The study involved 18 female horses from various breeds. The animals were referred in 2001–2009 to the Texas A&M Molecular Cytogenetic Laboratory because of infertility and/or abnormal genitalia (Table 1). The laboratory received peripheral blood samples from each individual in sodium heparin and EDTA Vacutainers (VACUTAINER™; Becton Dickinson).

Table 1.   Summary of the phenotypes and genotypes of the female horses used in this study.
NoBreedPhenotypeKaryotypePCR with SRYSTS content analysisFISH analysis
 1ThoroughbredAbnormal cervix, small ovaries (7–12 mm)64,XYdelNegDeleted Contig I and hetrochromatinCon I neg, the rest of Y pos
 2ThoroughbredSmall uterus and ovaries64,XYdelNegDeleted all MSY and PARAll negative
 3ArabianMale-like behaviour64,XYNegDeleted ∼21 kb around SRYAll positive
 4StandardbredSmall uterus and ovaries, not cycling64,XYNegDeleted ∼21 kb around SRYAll positive
 5ThoroughbredSmall uterus and ovaries, not cycling, aggressive in behaviour64,XYNegDeleted ∼21 kb around SRYAll positive
 6Quarter HorseSmall uterus and ovaries, not cycling,aggressive in behaviour64,XYNegDeleted ∼21 kb around SRYAll positive
 7ThoroughbredSmall stature, gonadal dysgenesis, suspected XO64,XYNegDeleted ∼21 kb around SRYAll positive
 8ThoroughbredSmall ovaries (20 mm), no follicular activity64,XYNegDeleted ∼21 kb around SRYAll positive
 9ArabianN/a64,XYNegDeleted ∼21 kb around SRYAll positive
10ThoroughbredLarge stature, small ovaries (10 mm)64,XYNegDeleted ∼21 kb around SRYAll positive
11ThoroughbredImmature reproductive tract, small ovaries64,XYNegDeleted ∼21 kb around SRYAll positive
12ThoroughbredNormal stature, small ovaries (10 mm)64,XYNegDeleted ∼21 kb around SRYAll positive
13StandardbredNo pregnancies64,XYNegDeleted ∼21 kb around SRYAll positive
14AppaloosaNormal external genitalia, hypoplastic uterus,underdeveloped mammary glands. Shows oestrous behaviour to stallions.64,XYPosNo ECAY deletionsAll positive
15Mixed warmbloodAbnormal: uterus, vulva located ventrally between rear legs at the location of mammary glands.64,XYPosNo ECAY deletionsAll positive
16StandardbredMale pseudohermaphrodite64,XYPosNo ECAY deletionsAll positive
17StandardbredMale pseudohermaphrodite64,XYPosNo ECAY deletionsAll positive
18Quarter HorseMale pseudohermaphrodite64,XYPosNo ECAY deletionsAll positive

Cell cultures and chromosome analysis

Cell cultures and chromosome preparations were made using standard cytogenetic methods as previously described (Raudsepp & Chowdhary 2008a). For karyotyping, the slides were stained with Giemsa, the sex chromosomes were identified by C-banding (Arrighi & Hsu 1971), and at least 20 cells were analysed for each technique.

Fluorescence in situ hybridization, FISH

The approximate size of Y chromosome deletions in XY females were determined by FISH using selected BAC clones from the physical map of ECAY (Raudsepp et al. 2004b; Raudsepp & Chowdhary 2008b) (Table 2). BAC DNA was isolated using the Plasmid Midi Kit (Qiagen) according to the manufacturer’s instructions. The BAC DNA was labelled and hybridized to metaphase chromosomes of XY females and control males following our standard FISH protocol (Raudsepp & Chowdhary 2008a). The results were analysed with a Zeiss Axioplan2 fluorescent microscope equipped with Isis V5.2 (MetaSystems GmbH) software.

Table 2.   Markers and BAC clones used for FISH analysis.
ECAY contigMarker symbolBAC cloneBAC libraryReference
PARPRKXY164O9CHORI-241(Raudsepp & Chowdhary 2008a,b)
VZFY110.3H12TAMU(Raudsepp et al. 2004a,b)
IVAMELY180P20CHORI-241(Raudsepp et al. 2004a,b)
IIINLGN4Y112E12CHORI-241(Paria 2009)
IIYE1118L7CHORI-241(Raudsepp et al. 2004a,b)
IIY3B12190M2CHORI-241(Raudsepp et al. 2004a,b)
IKDM5D (SMCY)60D8CHORI-241(Raudsepp et al. 2004a,b)
ISRY140M23CHORI-241(Raudsepp et al. 2004a,b)
24I23CHORI-241(Raudsepp et al. 2004a,b)
49.3F11TAMU(Raudsepp et al. 2004a,b)
79.4H1TAMU(Raudsepp et al. 2004a,b)
107.3H9TAMU(Raudsepp et al. 2004a,b)

Sequencing

Initial Y chromosome sequence information around the SRY gene was obtained by internal sequencing of two SRY-containing BAC clones, viz., 140M23 and 24I23 (CHORI-241 BAC library: http://bacpac.chori.org/quine241.htm). The first-step sequencing primers were designed in SRY-coding sequence and used for sequencing in both 3′ and 5′ directions. The newly obtained sequences served as templates to design primers for the next step. Such ‘walking’ was repeated several times. Sequencing reactions were carried out in 10 -μl volume with 1 μg of BAC DNA template and BigDye chemistry and resolved on an ABI-3730 capillary sequencer.

Next, the two SRY-containing BAC clones, viz., 140M23 and 24I23, were completely sequenced at Broad Institute of MIT and Harvard (Cambridge, MA, USA) using Sanger sequencing technology. The draft sequence GenBank Accessions are AC214740 and AC215855, respectively. Additionally, a third SRY-containing BAC clone, 107.3H9 from TAMU BAC library (http://hbz7.tamu.edu/homelinks/bac_est/bac.htm), was completely sequenced at Research and Testing Laboratory (Lubbock) following standard Roche 454-sequencing protocols (Roche). A total of 260 150 sequences with an average length of 421 bp were derived and initially assembled using NGen (DNAstar). The contigs were aligned with SeqMan, resulting in a continuous 116 857 -bp sequence (GenBank HM103387). Sequences of the three BACs and all available STSs in the SRY-region (Raudsepp et al. 2004b) were aligned using Sequencher 4.7 (Gene Codes) software and analysed using RepeatMasker (http://www.repeatmasker.org/), GENSCAN (http://genes.mit.edu/GENSCAN.html) and NCBI BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi).

Finally, 1 185 bp of the single exon of SRY (Table 3), including the 684 -bp open reading frame, was sequenced from all SRY-positive sex-reversal females using BigDye chemistry. The sequences were aligned with the reference sequence (GenBank AB004572) using Sequencher 4.7 (Gene Codes) software.

Table 3.   Summary data for horse Y chromosome genes and STS markers.
MarkerECAY regionPrimer Sequences 5′–3″PCR product size, bpReferenceGenBank Accession No
107-STS1Con I: SRY-regionF: TGGGCAGTTATGAAAATACGA R: CCTGCACACTGTCCTGTAATTG121This studyHM103387
107-STS2Con I: SRY-regionF: TTTTGTTGGGTCATTTGTGG R: ATCTACATGCTGGGGCAAAC381This studyHM103387
107-STS3Con I: SRY-regionF: TCACTGCAGGAACATTCTGG R: CAAGCAAACAGATTGGAGCA196This studyHM103387
107-STS4Con I: SRY-regionF: CATGGAGGAGAGAGCCTTTG R: TCAGCTGAGGTTTTCCCAAT425This studyHM103387
110.3H12-M13Con VF: GGGCCAGAATATGCAAGGA R: GATGTGTTTGTGTGCCTCTGTT182Raudsepp et al. 2004a,bBV140834
81F8-SP6Con IIIF: GCAAAGGCTCTGAGAGAGGA R: CCATGCTTCTTGACCAGACA182Paria 2009CU011557
118L7-T7Con IIF: ATCTGCTCCCCTTTGGTTTT R: CCCCAGATTTACTGCCTTTG225Paria 2009CU025611
126G2-T7Con IIF: GCAACTTGCACTGATTGTCC R: ATTTGTGTGGAGGGCAGGT200This studyn/a
131N23-SP6Con VF: GCTTGTCCTAATTTGCCTCTG R: CTTTGAGGACGGGTAAATTG152Raudsepp &Chowdhary 2008a,bCU034701
168I4-T7Con IIF: CCATTTCAACTCCTGATCCA R: AAGGGTAGGTCAGAGAGGAAGG101Raudsepp et al. 2004a,bBV140781
24I23-T7Con I: SRY-regionF: ATCTGCTTCGGCCTTCTCTT R: GGTGTACCCTGCTTCTCGT101Raudsepp et al. 2004a,bBV140808, CT942288, AC215855
26B21-SP6Con IF: CAAGGAAGCCAGGAAGAGTG R: GTCTCTGGCCCATGAGTGAT160Paria 2009CT951493
3′STS4Con I: SRY-regionF: ATGTCCAGCTCCTTTTGCTT R: ATGATGTGGGGTCGGTGA690This studyAC214740
3′STS5Con I: SRY-regionF: AAAACAGAGGTTGGCCTTGA R: GCTGTGGACGAAAATAATCCA602This studyAC214740
3′STS6Con I: SRY-regionF: ATTTTTCCCCTTGCATCCTT R: CCTCCAATTTGCGTTTGTTT838This studyAC214740
3′STS7Con I: SRY-regionF: TCGCTGCTTTCTTTAGTGACTC R: CCTGAAGAGCTGTTCTAAATGGA797This studyAC214740
3′STS8Con I: SRY-regionF: CAGGAGCTTTGTGAAAGATGG R: TTGTTGACTCTTGGTCAATGTT596This studyAC214740
3′STS9Con I: SRY-regionF: TGAACCACAAGGGCATTTTT R: GACACGTTAAAATTGGGAAGAA218This studyAC214740
3′STS10Con I: SRY-regionF: TTCTCATAACTGCCCATAGACTACA R: ACGTGGATAATCCCTGCTTG492This studyAC214740
3′STS12Con I: SRY-regionF: GTGATTATGGCCGTTCGAGT R: TGAGACCGCCAACTTAACCT399This studyAC214740
3′STS13Con I: SRY-regionF: TGGAGCTTCCAGAGGAGGTA R: GCCTGCCTAACTGGAAAACA509This studyAC214740
419P11-T7PARF: ACAGGGCAGCTCCTACAAGA R: CCCAGAAAAAGCCCGTAAG151Raudsepp &Chowdhary 2008a,bCU267996
49.3F11-M13Con I: SRY-regionF: TGAAATCACAAAGCTCCAAATG R: GGTTACGAATGGCTCCTTGA172Raudsepp et al. 2004a,bBV140820
5.2A8-M13Con IVF: TCAGAATGGAGCTGCCTAAAA R: GGCCCTGGCTTTTCTTTATT274This studyn/a
5′STS1Con I: SRY-regionF: ACTCCTCCCCTCAAACGTG R: ATTTTAAGGAGGGGCAGAGC150This studyAC214740, AC215855
5′STS2Con I: SRY-regionF: GCTCTGCCCCTCCTTAAAAT R: AACGATGATGTTCACCATGAAT226This studyAC214740, AC215855
5′STS3Con I: SRY-regionF: TAGTTTAGCTCGGGGCCAAT R: TGCGATCTGCACTTGCTACT347This studyAC214740, AC215855
5′STS4Con I: SRY-regionF: CAAACAACCCACTTAACCAAA R: CATACCCTATTTTATTTGGATCTGA177This studyAC214740, AC215855
5′STS5Con I: SRY-regionF: TGTACATGTTGGGGAAGTGG R: ATTGAAGGCCTGTTCCAAGA399This studyAC214740, AC215855
5′STS6Con I: SRY-regionF: TCACCAGTTTGGCTACTGGA R: TCCCCAACATGTACACCTCA174This studyAC214740, AC215855
5′STS7Con I: SRY-regionF: AATGACGACATTTTAAAAGTACAAGTT R: TTTTCCTCATTGGCATCAAG153This studyAC214740, AC215855
5′STS8Con I: SRY-regionF: TTCTAGGTCATCATTGGTGCTC R: TGGCTATCTTCAAAAGACATTAAGAA848This studyAC214740, AC215855
5′STS9Con I: SRY-regionF: GCCATTTTTCCTTTGTTTGC R: CATGGTCGAGCGGTTAAGTT645This studyAC214740, AC215855
5′STS10Con I: SRY-regionF: TGGCAAGTCTTGGCTTTCTT R: TAGAGGCCTTGGGCTTGTAA188This studyAC214740, AC215855
5′STS12Con I: SRY-regionF: GCCCTTCATTCCTTTTCCTT R: AAAAGGCGACTCCAGGGTAT754This studyAC214740, AC215855
5′STS13Con I: SRY-regionF: GGTTTTCCACGTTGTGGTTT R: GGTCAAATTGGGTATGGTCAA755This studyAC214740, AC215855
5′STS14Con I: SRY-regionF: CACTAAACTGCAAAGACATTTTTCAT R: CAGGACGGTGTGCAGAGTAA192This studyAC214740, AC215855
5′STS16Con I: SRY-regionF: TGTGGTGTGTATTGGAGGAGA R: TGGGGACAATGTGTCAGAAA552This studyAC214740, AC215855
5′STS17Con I: SRY-regionF: AGCCCTGCAGATGCTAAGAA R: GAAGCCCAAAAGAGTCCTTG679This studyAC214740, AC215855
66M24-SP6Con IIIF: TTGGCTGCTCTCAGAATTGA R: GGATTGTGCATGTCATCTCG169This studyCU001288
79.4H1-M13Con I: SRY-regionF: AGTCCACACCACCACAGTGA R: TGATGGGAGTGGGAGTTTTC248Raudsepp et al. 2004a,bBV140821
90B11-SP6Con IVF: TTGCTTGTGGTATTTCCTTGC R: CCTTTCTTCTTTCCTTACATGC150This studyBV140791, CU015692
AMELYCon IVF: CCAACCCAACACCACCAGCCAA ACCTCCCT R: AGCATAGGGGGCAAGGGCTGCA AGGGGAAT160Hasegawa et al. 2000AB032194
KDM5DCon IF: AACAGCGAGCCAATGTTTTT R: GCAAAATTCTGGGAAATCCA400Agulnik et al. 1997; Lindgren et al. 2001EU687564, U52364
NLGN4YCon IIIF:GGGGATCCATCTTTGTGTTG R:GTCACACAGCAGGCTCTGAC156Paria 2009EU687560
PRKXYPARF: CGCTTCCTGTACATGCTGATGGAG R: TCTTGGCGAACCCGAAGTCGGTGA229Raudsepp &Chowdhary 2008a,bET052965
RBMYCon I: SRY-regionF: TTCGGCCTTCTCTTTCACAT R: ACTCAAGCAGCCGAAATGAT180Paria 2009EU687561
SH3B14Con IF: GTGACCTCCCAGGAGCTGT R: TCTGCCTATGCTCTGGTGAA486Wallner et al. 2004BV005745
SRY1Con IF:TGCATTCATGGTGTGGTCTC R:ATGGCAATTTTTCGGCTTC200Paria 2009EU687565
SRY2ConIF: CTTAAGCTTCTGCTATGTCCAGAGTATCC R: GGGGAGGGGAGGTAACATAA1,185This studyEU687565, AC214740, AC215855
Y3B12Con IIF: GGGAGGCACTGGAAAGTACA R: GGTGGAGGAATCAGCTGGAG400Wallner et al. 2004G72338
YE1Con IIF: CTTCACTCCCGACCAAGAGA R: GTGTGTCGTGCCGTGTTTAC199Wallner et al. 2004BV005727
YM2Con IF: TGGTTCAGATGGTGTATTTTGTT R: TTTGCAGCCAGTACCTACCTT119Wallner et al. 2004BV005725
ZFYCon VF: TGCACATTTCCTTTAATCT R: GCACATTAAAGAGAAACCTT342Lindgren et al. 2001AF178847 AF133198

Development of STS markers and STS content analysis

Initial analysis of the Y chromosome in XY mares was carried out by PCR using primers for the horse SRY gene and selected STS markers from ECAY maps (Raudsepp et al. 2004b; Raudsepp & Chowdhary 2008b) (Table 3). Thereafter, additional STS primers were designed from masked (RepeatMasker: http://www.repeatmasker.org/) sequences of the three completely sequenced BAC clones. Androgen receptor (AR) from the X chromosome (Raudsepp et al. 2004a) was used as a positive control for all PCR amplifications. A summary of the PCR primers developed and used in this study is presented in Table 3. The same primers were used for sequencing the PCR products and/or for internal BAC sequencing in the SRY-region.

STS content analysis was carried out on the genomic DNA isolated from EDTA-stabilized peripheral blood of the 18 XY females (Table 1). DNA from ‘Bravo’, the donor for CHORI-241 BAC library, served as the male control. Similarly, DNA from ‘Twilight’, the donor for the genome sequence project (Wade et al., 2009), served as the female control. STS content analysis for each animal was carried out in 10 -μl volume duplicate PCR with 0.25 units Taq polymerase (JumpStart RedTaq, Sigma Aldrich), 50 mM KCl, 10 mM Tris–HCl (pH 8.4), 0.2 mM dATP, dCTP, dTTP and dGTP, 0.3 μM of each primer, and 50 ng of genomic DNA as template. The PCR products were resolved in 2% agarose gels containing ethidium bromide.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflict of interest
  9. References

Cytogenetic analysis

Cytogenetic analysis of Giemsa-stained metaphase spreads revealed that all 18 female horses (Table 1) had normal diploid chromosome number (2n = 64) with the XY sex chromosome complement, which is typical of males. This was confirmed by C-banding, which clearly showed the presence of one X chromosome and one Y chromosome in all cells analysed (Fig. 1a–d). Animals 1 and 2 had extremely small Y chromosomes (Fig. 1c, d), compared to other XY females and male controls. In contrast, the Y chromosome in Animal 15 was larger than usual with a prominent and extended heterochromatic region (Fig. 1b).

image

Figure 1.  C-banded metaphase spreads (a–b) and Giemsa-stained karyotypes (c–d) of Animal 6 (a), Animal 15 (b), Animal 1 (c), and Animal 2 (d).

Download figure to PowerPoint

The presence of the Y chromosome was further confirmed by FISH using microdissected horse Y chromosome (Raudsepp & Chowdhary 1999) as a probe (Fig. 2a–b). Hybridization results confirmed the cytogenetic observations that the Y chromosomes in Animals 1 and 2 were abnormally small (Fig. 2b). Moreover, FISH with 8 BAC clones evenly distributed along the ECAY contig map (Table. 2, Fig. 3a) showed that the two rudimentary Y chromosomes are molecularly different. The Y chromosome in Animal 1 gave FISH signals with all contig II–V and PAR BACs (Fig. 2c, d) and was negative only for contig I clones containing SRY and KDM5D (alias SMCY). In contrast, no FISH signals with any of the probes were observed in Animal 2, indicating that the rudimentary Y chromosome is comprised of little or no euchromatin (Fig. 3b). In the remaining 16 animals, FISH signals were observed with all MSY and PAR BACs, including the five overlapping clones in the SRY-region (Table 2, Fig. 2e, f; Fig. 3c). Taken together, the cytogenetic and FISH analyses detected massive Y chromosome deletions over 10–15 Mb size (Raudsepp et al. 2004b) in two animals, whereas the gross organization of the Y chromosomes in all other XY mares appeared to be normal.

image

Figure 2.  Fluorescence in situ hybridization with microdissected Y chromosome painting probe (a–b), PAR gene GYG2 (c), MSY markers YE1 (green), and ZFY (red) (d), and BAC clones from SRY-region 24I23 (green) and 107.3H9 (red) (e–f). Hybridizations were carried out on metaphase chromosomes of Animal 15 (a and f), Animal 1 (b–d) and Animal 9 (e) (see Table 1 for details).

Download figure to PowerPoint

image

Figure 3.  Schematic showing various ECAY deletions in XY females. (a). Composite map of ECAY showing the heterochromatic region, five BAC contigs (I–V) in the male-specific region of Y (MSY), and the pseudoautosomal region (PAR). Markers that were used for FISH (bold and shaded grey) and PCR analysis are shown at the top of each region. Gene symbols are in italics. (b). Massive ECAY deletions (dark grey bars) in two XY females. (c). Contig of 5 overlapping BAC clones in the SRY-region. Clones demarcated in bold were completely sequenced. (d). Detailed map of a 146 432 -bp region of MSY showing the size and marker content of the deletion, the two directed repeats (yellow and green arrows R1 and R2), and MSY (blue bars).

Download figure to PowerPoint

Sequence analysis of the Y chromosome

Analysis by PCR with SRY primers divided the 18 XY females into two molecularly distinct groups: SRY negative (Animals 1–13, Table 1) and SRY positive (Animals 14–18). All XY mares were positive for the AR control gene. Next, we used a panel of 20 MSY and PAR markers (Fig. 3a) and studied by PCR their presence or absence in individual animals. As expected, all tested markers were negative in Animal 2, confirming the FISH results that the small Y chromosome is exclusively heterochromatic. In Animal 1, only markers from contigs II–V and the PAR were present. No amplification by PCR was observed with the 4 markers in contig I: YM2, KDM5D, SH3B14, and 26B21-SP6 (Fig. 3a). Thus, the PCR and FISH results for Animal 1 were in complete agreement. Similarly, PCR analysis confirmed and refined FISH results for the remaining animals. All 20 ECAY markers were positive in Animals 3–18, showing that regardless of the presence or absence of SRY, the overall integrity of the Y chromosome was retained.

Next, we investigated whether the deletion of SRY is the only molecular signature of the Y chromosome in the 11 SRY-negative females (Animals 3–13). We hypothesized that if only the single exon of SRY (Hasegawa et al. 1999) is deleted, it should be possible to design a simple PCR test to distinguish between normal males and XY SRY-negative females. We reasoned that if primers are designed to flank the deletion, distinctly different-sized PCR products would be amplified from normal males and XY females. Such tests will show the size of deleted segments in sex-reversed females and will be a useful alternative to the current presence- or absence-based PCR analysis with SRY primers.

To develop this test, we carried out a detailed STS content analysis with a panel of 34 markers in a 146 -kb region around SRY that was developed from three completely sequenced BAC clones (Fig. 3d). The analysis revealed that the deletion is not restricted to the SRY exon and includes at least 21 500 bp around it (Fig. 3d). We discovered that the deletion is flanked by approximately 28 kb of directed repeats (R1 and R2 arrows in Fig. 3d) that are present both in normal males and XY females. As the duplicated regions share a high degree of sequence similarity (approximately 96–100%), it was not possible to determine by PCR whether one or both segments are present in sex-reversed animals. As shown in Fig. 3d, the unique MSY-specific sequences (blue shades), which are suitable for primer design, are located tens of kilobase pairs away from the deletion. Thus, it was not possible to design primers for an alternative PCR test to distinguish between Y chromosomes in normal males and SRY-negative females.

Sequence analysis of the 146 432 -bp genomic segment around the deletion (Fig. 3d) identified three MSY genes –SRY, RBMY, and ATP6V0CY. The single-copy SRY is part of the deletion, a multicopy gene RBMY (Paria 2009) is located in both directionally duplicated segments on either side of the deletion (Fig. 3d), and ATP6V0CY is a newly found Y-linked gene in horses.

Finally, FISH and STS content analyses did not detect any molecular differences between the Y chromosomes of SRY-positive XY females and normal males. Likewise, sequences of the single exon of SRY in all 5 SRY-positive females were 100% identical with each other and with the male reference sequence (data not shown). Therefore, the detailed analysis of the Y chromosome in XY females showed that the molecular causes of SRY-positive male-to-female sex reversal in horses are not Y-linked and remain as yet undefined.

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflict of interest
  9. References

To our knowledge, this study represents the first comprehensive molecular characterization of the Y chromosome in XY sex-reversed female horses. Using recently available molecular tools for MSY and the PAR (Raudsepp et al. 2004b; Raudsepp & Chowdhary 2008b; Paria 2009), we considerably refined the underlying molecular aetiology of the SRY-negative (Pailhoux et al. 1995; Abe et al. 1999; Makinen et al. 1999, 2001; Bugno et al. 2003) form of sex reversal in horses.

Molecular heterogeneity of ECAY in SRY-negative XY females

A combination of cytogenetic, FISH, STS content, and sequence analysis revealed that the SRY-negative form of sex reversal is a molecularly heterogenous condition. Deletions that lead to the loss of SRY can be massive, including megabase pairs of DNA (Fig. 3b), or limited to a region around SRY, removing tens of kilobase pairs of DNA (Fig. 3d). Notably, none of the deletions is restricted to the SRY sequence only. Furthermore, as illustrated by Animals 1 and 2 (Table 1), the massive deletions differ from each other both in size and content (Fig. 3b). The loss of entire ECAY euchromatin in Animal 2 makes this case genetically very similar to X monosomy. This is in agreement with the animal’s phenotype (Table 1) and supports earlier observations that mares with XY and XO sex chromosome complements are frequently indistinguishable by overall appearance (small stature), behaviour (abnormal oestrus behaviour), and gonadal phenotype (underdeveloped ovaries and uterus) (Chandley et al. 1975; Bowling et al. 1987; Long 1988). However, as none of the earlier cytogenetic studies report about finding an abnormally small Y chromosome, the molecular cause of the XO-like phenotype in XY mares is probably not because of the massive loss of Y euchromatin. Female gonadal dysgenesis might rather be because of the absence of the second X chromosome.

Systematic mapping of the horse Y chromosome and the development of Y-linked markers started only recently (Raudsepp et al. 2004b). This is why all earlier molecular studies of XY mares have been limited to a few Y-linked genes, viz., SRY (Pailhoux et al. 1995; Abe et al. 1999; Makinen et al. 1999, 2001; Bugno et al. 2003), AMELY, STS-Y and ZFY (Makinen et al. 2001; Bugno et al. 2003). These tests confirmed the absence of SRY, and the presence of the three other markers, but had no knowledge about the relative order or map location of these genes. Therefore, the present study is the first in which the Y chromosomes of XY mares were analysed using detailed map information (Raudsepp et al. 2004b; Raudsepp & Chowdhary 2008b) and partial sequence data for ECAY. This allowed fine demarcation of ECAY deletions (Fig. 3) and showed that all SRY-negative mares, except Animals 1 and 2, share the same large 21.5 -kb deletion that includes SRY (Fig. 3d) but no other known functional MSY genes. The results are in agreement with the common idea that the female-like phenotype or the lack of male phenotype in SRY-negative mares is primarily because of the loss of SRY (Pailhoux et al. 1995; Makinen et al. 1999). However, the cause of female gonadal dysgenesis, another characteristic feature of both the XY and XO mares (Table 1), is not so clear. In females with X monosomy, haploinsufficiency for certain PAR genes has been considered as the cause of gonadal dysgenesis (Ellison et al. 1997; Blaschke & Rappold 2001). In this study, using SRY and a panel of 20 Y-linked markers (Fig. 3a), we showed that, except for the SRY-region, the rest of the Y chromosome is undisturbed. Thus, in contrast to XO females, the SRY-negative XY mares have two normal copies of the PAR. Therefore, given that the molecular causes of gonadal dysgenesis in XY and XO females are the same, they are more likely associated with incomplete dosage of some non-PAR Xp genes that escape X inactivation.

Possible molecular mechanisms of Y chromosome deletions

Previously, it has been proposed that SRY-negative sex-reversal syndrome in horses is because of abnormal X-Y recombination in male meiosis, resulting in the loss of SRY from the Y to the X chromosome (Abe et al. 1999; Makinen et al. 2001; Bugno et al. 2003). The assumption was based on observations in humans where such uneven crossovers are common and give rise to 46,XY SRY-negative females and 46,XX SRY-positive males (Rosser et al. 2009). However, it must be noted that the molecular organization of the human and horse Y chromosomes are very different. In humans, the SRY is located only 35 kb away from the pseudoautosomal boundary (PAB) (Skaletsky et al. 2003), which makes uneven X-Y meiotic exchange feasible. In contrast, the horse SRY is located in the very proximal part of MSY (Raudsepp et al. 2004b), far from the PAB (Fig. 3a), and its involvement in abnormal meiotic exchange is unlikely (Raudsepp & Chowdhary 2008b).

A more plausible explanation of Y deletions lies in the intrinsic nature of Y chromosome sequences. A typical feature of the haploid and non-recombining Y chromosome is the presence of massive and numerous reversed (palindromic) and directional repeats (Skaletsky et al. 2003; Lange et al. 2009; Hughes et al. 2010). Sequence similarity between palindrome arms or repeated units might be as high as 99%–100%, facilitating inter-and intra-chromatid gene conversion and recombination (Lange et al. 2009). As such genetic exchanges help to maintain Y chromosome structural and functional integrity, the majority of important spermatogenesis genes are located in palindrome arms or directional repeats (Skaletsky et al. 2003; Lange et al. 2009). However, this mechanism also has a downside: inter-chromatid recombination can frequently lead to duplications and deletions which, in humans, are associated with spermatogenic failure, sex reversal, and Turner syndrome (Lange et al. 2009). In this study, we show that in the horse Y chromosome, the SRY-region is surrounded by two almost 100% identical directional repeats (Figs 3d & 4a). Not coincidentally, both repeated segments contain one copy of a known spermatogenesis-related gene, RBMY (Elliott 2004). It is possible that the deletion of the SRY-region, as seen in SRY-negative XY mares, is the result of an inter-chromatid recombination between the two repeats (Fig. 4b). Theoretically, this inter-chromatid exchange should remove from the Y chromosome of XY females not only SRY but also one of the directed repeats (Fig. 4c). However, this can be proven only by direct Y chromosome sequencing, and not by PCR. If our assumption is correct, the SRY-region is expected to become duplicated on another chromatid (Fig. 4c) and should be present in the Y chromosomes of paternal male full- or half-sibs of the XY females. Possibly, duplication of SRY and triplication of repeats have no significant phenotypic effects, and the carriers remain undetected. Further, we infer that the molecular mechanism of the two massive deletions in Animals 1 and 2 might be quite similar to that presented in Fig. 4, with the only difference that recombination events have taken place between more distantly located repeats resulting in larger deletions.

image

Figure 4.  Schematic of the likely mechanism of SRY deletion in XY females (adopted from Lange et al. 2009). (a). Double-stranded break (DSB) occurs in one of the directed repeats (R2) flanking SRY. (b). DSB is repaired by inter-chromatid homologous recombination using R1 as a template to repair DSB in R2. (c). Homologous recombination between sister chromatids of ECAY deletes SRY and R2 from one chromatid and moves them to another.

Download figure to PowerPoint

Taken together, the key factors causing SRY-negative sex reversal are Y-linked, although some X-linked genes might also contribute to the phenotype. Thus, the primary mutation, sporadic or genetically predisposed, is derived paternally. Indeed, as shown in earlier studies, there are certain sire lines that produce more XY females than expected by chance (Kieffer 1976; Kent et al. 1986; Bowling et al. 1987; Kent et al. 1988b). However, the 13 SRY-negative XY mares analysed in this study were from different breeds (Table 1) and families and were therefore not informative regarding the pedigree analysis.

The SRY-positive male-to-female sex reversal

The SRY-positive females are phenotypically distinct from the SRY-negative mares, as shown by a single previous report (Switonski et al. 2005) and this study. These mares display features that are not typically observed in SRY-negative animals, such as stallion-like behaviour, large body size, abnormal external genitalia, elevated blood testosterone levels, and male rather than female gonadal dysgenesis (Table 1). Based on this, it is possible that many more SRY-positive XY females have been described earlier, but because of the lack of molecular tools, they were not properly identified (Kieffer 1976; Kent et al. 1986, 1988a,b; Crabbe et al. 1992; Howden 2004). Therefore, the ‘masculine’-type equine XY sex reversal might be more prevalent than the single previous report (Switonski et al. 2005) and the 5 cases described in this study.

Detailed molecular analysis of the Y chromosome showed that the ‘feminine’ (SRY-negative) and ‘masculine’ (SRY-positive) XY sex reversals differed genetically more than just the absence or presence of SRY. While SRY-negative animals showed various ECAY deletions, the Y chromosome of SRY-positive mares was the same as in normal males; even the unusually large Y chromosome in Animal 15 was molecularly normal by PCR, FISH, and sequence analysis, and the abnormal size could be attributed to substantially enlarged heterochromatic region (Fig. 1b). We infer that the SRY-positive condition is likely not Y-linked. However, human studies suggest that a Y-linked ‘growth’ gene might be responsible for the larger than usual body size (adult height) (Ogata & Matsuo 1992; McDonough 2003) of XY females. Further, it has been proposed that testicular feminization and male pseudohermaphroditism in SRY-positive mares might be caused by a mutation in the X-linked androgen receptor (AR) gene (Crabbe et al. 1992; Howden 2004; Switonski et al. 2005). To date, there is no experimental evidence to support this. It is also possible that, similarly to humans, the SRY-positive sex reversal is a genetically heterogeneous disorder (Sarafoglou & Ostrer 2000). In humans, some cases are Y-linked, showing different missense and frameshift mutations in the SRY-coding region (Salehi et al. 2006; Shahid et al. 2008; Marchina et al. 2009). However, almost 80% of 46,XY women have no mutations in SRY or other Y-linked genes, indicating the involvement of X-linked or autosomal factors. The few different autosomal (Barbaro et al. 2009; Biason-Lauber et al. 2009; Schimmer & White 2010) and X-linked (Sarafoglou & Ostrer 2000) mutations described in XY women do not give consistent answers, and the underlying genetic causes of SRY-positive sex reversal in humans and horses alike remain poorly understood.

Occurrence of XY sex reversal in horses and other species

Male-to-female XY sex reversal, especially the SRY-negative form, is a relatively frequent chromosomal abnormality in horses. Incidence of XY mares in our cytogenetic analysis practice is as high as 26% among all chromosomally abnormal animals studied during the period between 2001 and 2009. This is in line with earlier data showing that 12%–30% of cytogenetic abnormalities in horses count for XY females (Bowling et al. 1987; Power 1990). The condition has also been described in humans (Sarafoglou & Ostrer 2000; Michala et al. 2008), where about 10%–20% XY women are SRY negative, and 80–90% have normal SRY. Both SRY-positive and SRY-negative XY females have been found in cattle (Ferrer et al. 2009; Villagomez et al. 2009) and mouse (Arnold & Chen 2009). In contrast, surprisingly few and exclusively SRY-positive ‘masculine’-type XY females have been reported for other species, such as river buffalo (Di Meo et al. 2008), dog (Nowacka-Woszuk et al. 2007; Whyte et al. 2009), and sheep (Ferrer et al. 2009). Notably, no XY sows have been found in pigs (Villagomez et al. 2009). This disparity might be because of uneven cytogenetic sampling of populations in different species. However, given the well-organized cytogenetic screening system of domestic species, especially pigs, in France and many other European countries (Ducos et al. 2008), this is unlikely. Instead, we hypothesize that the prevalence of Y-linked XY SRY-negative condition is related to the diversity of the organization of the Y chromosome in different species (Skaletsky et al. 2003; Raudsepp et al. 2004b; Murphy et al. 2006; Hughes et al. 2010). For example, SRY is a single-copy gene in human (Skaletsky et al. 2003), mouse (Lundrigan & Tucker 1997), and horse (Paria 2009). This implies that any Y chromosome rearrangement that causes the loss of SRY will result in an SRY-negative condition. In contrast, species like cat (Pearks Wilkerson et al. 2008), rabbit (Geraldes & Ferrand 2006), rat (Turner et al. 2007), and several other rodents (Lundrigan & Tucker 1997) have multiple copies of SRY. Consequently, deletion of one SRY copy leaves other copies intact to carry out their function. Therefore, one plausible reason why species like pigs, dogs or sheep have no SRY-negative XY females might be the presence of multicopy SRY. It could also be that SRY location in relation to inverted and directional repeats is different across species, thus facilitating SRY deletions in some species but not in others. It is anticipated that the ongoing mapping and sequencing projects for the mammalian Y chromosomes will soon provide better explanations for these ideas. Likewise, the availability of genome-wide analysis tools, such as SNP-chips and tiling arrays, are expected to improve the discovery of genes and rearrangements underlying the SRY-positive form of sex reversal in horses and other species.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflict of interest
  9. References

This work was supported by USDA grant 2006-04801 and CVMBS LINK Endowment for Equine Genomics. The University of Kentucky Agricultural Experiment Station number for this paper is 10-14-077.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflict of interest
  9. References
  • Abe S., Miyake Y.I., Kageyama S.I., Watanabe G., Taya K. & Kawakura K. (1999) Deletion of the Sry region on the Y chromosome detected in a case of equine gonadal hypoplasia (XY female) with abnormal hormonal profiles. Equine Veterinary Journal 31, 3368.
  • Agulnik A.I., Bishop C.E., Lerner J.L., Agulnik S.I. & Solovyev V.V. (1997) Analysis of mutation rates in the SMCY/SMCX genes shows that mammalian evolution is male driven. Mamm Genome 8, 134138.
  • Arnold A.P. & Chen X. (2009) What does the “four core genotypes” mouse model tell us about sex differences in the brain and other tissues? Frontiers in Neuroendocrinology 30, 19.
  • Arrighi F.E. & Hsu T.C. (1971) Localization of heterochromatin in human chromosomes. Cytogenetics 10, 816.
  • Barbaro M., Balsamo A., Anderlid B.M., Myhre A.G., Gennari M., Nicoletti A., Pittalis M.C., Oscarson M. & Wedell A. (2009) Characterization of deletions at 9p affecting the candidate regions for sex reversal and deletion 9p syndrome by MLPA. European Journal of Human Genetics 17, 143947.
  • Biason-Lauber A., Konrad D., Meyer M., DeBeaufort C. & Schoenle E.J. (2009) Ovaries and female phenotype in a girl with 46,XY karyotype and mutations in the CBX2 gene. American Journal of Human Genetics 84, 65863.
  • Blaschke R.J. & Rappold G.A. (2001) SHOX in short stature syndromes. Hormone Research 55(Suppl. 1), 213.
  • Bowling A.T., Millon L. & Hughes J.P. (1987) An update of chromosomal abnormalities in mares. Journal of Reproduction and Fertility. Supplement 35, 14955.
  • Bugno M., Klukowska J., Slota E., Tischner M. & Switonski M. (2003) A sporadic case of the sex-reversed mare (64,XY; SRY-negative): molecular and cytogenetic studies of the Y chromosome. Theriogenology 59, 1597603.
  • Chandley A.C., Fletcher J., Rossdale P.D., Peace C.K., Ricketts S.W., McEnery R.J., Thorne J.P., Short R.V. & Allen W.R. (1975) Chromosome abnormalities as a cause of infertility in mares. Journal of Reproduction and Fertility. Supplement, 23, 37783.
  • Crabbe B.G., Freeman D.A., Grant B.D., Kennedy P., Whitlatch L. & MacRae K. (1992) Testicular feminization syndrome in a mare. Journal of the American Veterinary Medical Association 200, 168991.
  • Di Meo G.P., Perucatti A., Di Palo R., Iannuzzi A., Ciotola F., Peretti V., Neglia G., Campanile G., Zicarelli L. & Iannuzzi L. (2008) Sex chromosome abnormalities and sterility in river buffalo. Cytogenet Genome Res 120, 12731.
  • Ducos A., Revay T., Kovacs A. et al. (2008) Cytogenetic screening of livestock populations in Europe: an overview. Cytogenet Genome Res 120, 2641.
  • Elliott D.J. (2004) The role of potential splicing factors including RBMY, RBMX, hnRNPG-T and STAR proteins in spermatogenesis. International Journal of Andrology 27, 32834.
  • Ellison J.W., Wardak Z., Young M.F., Gehron Robey P., Laig-Webster M. & Chiong W. (1997) PHOG, a candidate gene for involvement in the short stature of Turner syndrome. Human Molecular Genetics 6, 13417.
  • Ferrer L.M., Monteagudo L.V., Garcia de Jalon J.A., Tejedor M.T., Ramos J.J. & Lacasta D. (2009) A case of ovine female XY sex reversal syndrome not related to anomalies in the sex-determining region Y (SRY). Cytogenet Genome Res 126, 32932.
  • Geraldes A. & Ferrand N. (2006) A 7-bp insertion in the 3′ untranslated region suggests the duplication and concerted evolution of the rabbit SRY gene. Genet Sel Evol 38, 31320.
  • Hasegawa T., Ishida M., Harigaya T., Sato F., Ishida N. & Mukoyama H. (1999) Linear SRY transcript in equine testis. Journal of Veterinary Medical Science 61, 97100.
  • Hasegawa T., Sato F., Ishida N., Fukushima Y. & Mukoyama H. (2000) Sex determination by simultaneous amplification of equine SRY and amelogenin genes. J Vet Med Sci 62, 11091110.
  • Howden K.J. (2004) Androgen insensitivity syndrome in a thoroughbred mare (64, XY--testicular feminization). Canadian Veterinary Journal 45, 5013.
  • Hughes J.F., Skaletsky H., Pyntikova T. et al. (2010) Chimpanzee and human Y chromosomes are remarkably divergent in structure and gene content. Nature 463, 5369.
  • Kent M.G., Shoffner R.N., Buoen L. & Weber A.F. (1986) XY sex-reversal syndrome in the domestic horse. Cytogenetics and Cell Genetics 42, 818.
  • Kent M.G., Schneller H.E., Hegsted R.L., Johnston S.D. & Wachtel S.S. (1988a) Concentration of serum testosterone in XY sex reversed horses. Journal of Endocrinological Investigation 11, 60913.
  • Kent M.G., Shoffner R.N., Hunter A., Elliston K.O., Schroder W., Tolley E. & Wachtel S.S. (1988b) XY sex reversal syndrome in the mare: clinical and behavioral studies, H-Y phenotype. Human Genetics 79, 3218.
  • Kieffer N.M. (1976) Male pseudohermaphroditism of the testicular feminizing type in a horse. Equine Veterinary Journal 8, 3841.
  • Lange J., Skaletsky H., Van Daalen S.K., Embry S.L., Korver C.M., Brown L.G., Oates R.D., Silber S., Repping S. & Page D.C. (2009) Isodicentric Y chromosomes and sex disorders as byproducts of homologous recombination that maintains palindromes. Cell 138, 85569.
  • Lear T.L. & Bailey E. (2008) Equine clinical cytogenetics: the past and future. Cytogenet Genome Res 120, 429.
  • Lindgren G., Breen M., Godard S., Bowling A., Murray J., Scavone M., Skow L., Sandberg K., Guerin G., Binns M. & Ellegren H. (2001) Mapping of 13 horse genes by fluorescence in-situ hybridization (FISH) and somatic cell hybrid analysis. Chromosome Res 9, 5359.
  • Long S.E. (1988) Chromosome anomalies and infertility in the mare. Equine Veterinary Journal 20, 8993.
  • Lundrigan B.L. & Tucker P.K. (1997) Evidence for multiple functional copies of the male sex-determining locus, Sry, in African murine rodents. Journal of Molecular Evolution 45, 605.
  • Makinen A., Hasegawa T., Makila M. & Katila T. (1999) Infertility in two mares with XY and XXX sex chromosomes. Equine Veterinary Journal 31, 3469.
  • Makinen A., Suojala L., Niini T., Katila T., Tozaki T., Miyake Y. & Hasegawa T. (2001) X chromosome detection in an XO mare using a human X paint probe, and PCR detection of SRY and amelogenin genes in 3 XY mares. Equine Veterinary Journal 33, 52730.
  • Marchina E., Gambera A., Spinelli E., Clerici P., Scagliola P., Sartori E. & Barlati S. (2009) Identification of a new mutation in the SRY gene in a 46,XY woman with Swyer syndrome. Fertility and Sterility 91, 932.e93711.
  • McDonough P.G. (2003) In syndromes of confused gonads, height can be important! Fertility and Sterility 79, 4623.
  • Michala L., Goswami D., Creighton S.M. & Conway G.S. (2008) Swyer syndrome: presentation and outcomes. BJOG 115, 73741.
  • Murphy W.J., Wilkerson A.J., Raudsepp T., Agarwala R., Schaffer A.A., Stanyon R. & Chowdhary B.P. (2006) Novel gene acquisition on carnivore Y chromosomes. PLoS Genet 2, e43.
  • Nowacka-Woszuk J., Nizanski W., Klimowicz M. & Switonski M. (2007) Normal male chromosome complement and a lack of the SRY and SOX9 gene mutations in a male pseudohermaphrodite dog. Anim Reprod Sci 98, 3716.
  • Ogata T. & Matsuo N. (1992) Comparison of adult height between patients with XX and XY gonadal dysgenesis: support for a Y specific growth gene(s). Journal of Medical Genetics 29, 53941.
  • Pailhoux E., Cribiu E.P., Parma P. & Cotinot C. (1995) Molecular analysis of an XY mare with gonadal dysgenesis. Hereditas 122, 10912.
  • Paria N., 2009. Discovery of Candidate Genes for Stallion Fertility, Ph.D. Thesis, College of Veterinary Medicine, Texas A&M University, College Station. p. 223.
  • Pearks Wilkerson A.J., Raudsepp T., Graves T., Albracht D., Warren W., Chowdhary B.P., Skow L.C. & Murphy W.J. (2008) Gene discovery and comparative analysis of X-degenerate genes from the domestic cat Y chromosome. Genomics 92, 32938.
  • Power M.M. (1986) XY sex reversal in a mare. Equine Veterinary Journal 18, 2336.
  • Power M.M. (1990) Chromosomes of the horse. In: Advances in Veterinary Science and Comparative Medicine, Domestic Animal Cytogenetics (Ed. by R.A.McFeely), pp. 13167. Academic Press Inc, San Diego.
  • Raudsepp T. & Chowdhary B.P. (1999) Construction of chromosome-specific paints for meta- and submetacentric autosomes and the sex chromosomes in the horse and their use to detect homologous chromosomal segments in the donkey. Chromosome Research 7, 10314.
  • Raudsepp T. & Chowdhary B.P. (2008a) FISH for mapping single copy genes. In: Phylogenomics: Methods in Molecular Biology (Ed. by W.Murphy), pp. 310. Humana Press, New Jersey.
  • Raudsepp T. & Chowdhary B.P. (2008b) The horse pseudoautosomal region (PAR): characterization and comparison with the human, chimp and mouse PARs. Cytogenet Genome Res 121, 1029.
  • Raudsepp T., Lee E.-J., Kata S.R., Brinkmeyer C., Mickelson J.R., Skow L.C., Womack J.E. & Chowdhary B.P. (2004a) Exceptional conservation of horse-human gene order on X chromosome revealed by high-resolution radiation hybrid mapping. Proceedings of the National Academy of Sciences of the United States of America 101, 238691.
  • Raudsepp T., Santani A., Wallner B., Kata S.R., Ren C., Zhang H.B., Womack J.E., Skow L.C. & Chowdhary B.P. (2004b) A detailed physical map of the horse Y chromosome. Proceedings of the National Academy of Sciences of the United States of America 101, 93216.
  • Rosser Z.H., Balaresque P. & Jobling M.A. (2009) Gene conversion between the X chromosome and the male-specific region of the Y chromosome at a translocation hotspot. American Journal of Human Genetics 85, 1304.
  • Salehi L.B., Scarciolla O., Vanni G.F., Nardone A.M., Frajese G., Novelli G. & Stuppia L. (2006) Identification of a novel mutation in the SRY gene in a 46, XY female patient. Eur J Med Genet 49, 4948.
  • Sarafoglou K. & Ostrer H. (2000) Clinical review 111: familial sex reversal: a review. Journal of Clinical Endocrinology and Metabolism 85, 48393.
  • Schimmer B.P. & White P.C. (2010) Minireview: steroidogenic factor 1: its roles in differentiation, development, and disease. Molecular Endocrinology 24, 13221337.
  • Shahid M., Dhillon V.S., Hussain Z. et al. (2008) Analysis of the SRY gene in two sex-reversed XY sisters identifies two new novel point mutations in the high mobility group box domain. Fertility and Sterility 90, 1911198.
  • Sharp A.J., Wachtel S.S. & Benirschke K. (1980) H-Y antigen in a fertile XY female horse. Journal of Reproduction and Fertility 58, 15760.
  • Skaletsky H., Kuroda-Kawaguchi T., Minx P.J. et al. (2003) The male-specific region of the human Y chromosome is a mosaic of discrete sequence classes. Nature 423, 82537.
  • Switonski M., Chmurzynska A., Szczerbal I., Lipczynski A., Yang F. & Nowicka-Posluszna A. (2005) Sex reversal syndrome (64,XY; SRY-positive) in a mare demonstrating masculine behaviour. J Anim Breed Genet 122(Suppl. 1), 603.
  • Turner M.E., Martin C., Martins A.S., Dunmire J., Farkas J., Ely D.L. & Milsted A. (2007) Genomic and expression analysis of multiple Sry loci from a single Rattus norvegicus Y chromosome. BMC Genet 8, 11.
  • Villagomez D.A., Parma P., Radi O., Di Meo G., Pinton A., Iannuzzi L. & King W.A. (2009) Classical and molecular cytogenetics of disorders of sex development in domestic animals. Cytogenet Genome Res 126, 11031.
  • Wade C., Giulotto E., Sigurdsson S. et al. (2009) Genome sequence, comparative analysis and population genetics of the domestic horse (Equus caballus). Science 326, 8657.
  • Wallner B., Piumi F., Brem G., Muller M. & Achmann R. (2004) Isolation of Y chromosome-specific microsatellites in the horse and cross-species amplification in the genus Equus. J Hered 95, 158164.
  • Whyte A., Monteagudo L.V., Diaz-Otero A., Lebrero M.E., Tejedor M.T., Falceto M.V., Whyte J. & Gallego M. (2009) Malformations of the epididymis, incomplete regression of the mesonephric tubules and hyperplasia of Leydig cells in canine persistence of Mullerian duct syndrome. Anim Reprod Sci 115, 32833.